|
|
||||||||
Department of Microbiology and Immunology, Weill Medical College, Cornell University, 1300 York Avenue, New York, NY 10021
| Abstract |
|---|
|
|
|---|
, and IFN-
. Consistently, IL-12 p35/, IFN-
/, and LT
/ mice are also highly vulnerable to MNU-induced carcinogenesis. Administration of rIL-12 to IRF-1/ mice restores normal expression of LT
and IFN-
, and significantly enhances the ability of IRF-1/ mice to resist MNU-induced pathogenesis. This strongly suggests an IRF-1/IL-12/IFN-
regulatory axis in tumor surveillance. By DNA microarray analysis, we comprehensively identify differences and patterns in gene expression in splenocytes of wild-type (WT) vs IRF-1/ mice challenged with MNU. This study contributes to efforts to elucidate the cellular/molecular mechanisms and the downstream players involved in IRF-1-mediated host defense against lymphoproliferative malignancies. | Introduction |
|---|
|
|
|---|
IFN regulatory factor-1 (IRF-1)3 has a remarkable functional diversity in the regulation of cellular response in host defense. IRF-1 selectively targets different sets of genes in various cell types in response to diverse cellular stimuli and evokes appropriate innate and adaptive immune responses (2). It has been firmly established as a critical effector molecule in IFN-
-mediated signaling and in the development and function of NK, NKT, and CTL (3, 4, 5, 6, 7, 8). IRF-1 also has direct antiproliferative effects, thus acting as a tumor suppressor and tumor susceptibility gene.
IL-12 is a heterodimer (p40 and p35) produced primarily by macrophages and dendritic cells (DCs) in both innate and adaptive immune responses. It is a key factor in the induction of T cell-dependent and -independent activation of macrophages, NK cells, generation of Th1 cells and CTL, induction of opsonizing, complement-fixing Abs, and resistance to intracellular infections (9). Systemic (10) and local (11) administration of exogenous IL-12 is highly effective against the growth of a large number of transplantable (10, 11) as well as chemically (12, 13) and oncogene-induced (13) primary mouse tumors by activation of lymphoid cells that kill tumor cells, damage tumor vessels, release secondary messengers such as IFN-
and TNF-
, and trigger the production of third level antiangiogenic chemokines, such as IFN-
inducible protein-10 and monokine induced by IFN-
(11, 14).
The first demonstration of the importance of IRF-1 in IL-12 production and IL-12-mediated induction of Th1 immune responses was provided by the work of Taki et al. (5), who showed that T cells from mice lacking IRF-1 failed to mount Th1 responses and, instead, exclusively underwent Th2 differentiation in vitro. Compromised Th1 differentiation was associated with defects in IL-12 production by macrophages and hyporesponsiveness of CD4+ T cells to IL-12. Subsequently, two independent studies have confirmed the role of IRF-1 in the regulation of IL-12 p40 and p35 gene transcription (15, 16). Our own recent study has revealed an intimate relationship between IRF-1 and IL-12, in that IRF-1 regulates the production of IL-12 by selectively controlling transcriptional activation of IL-12 p35 gene (17). These studies provide a mechanistic explanation for the IFN-
priming effect, i.e., IFN-
-mediated activation of APCs that is required for vigorous IL-12 production to generate robust cellular immunity (5). Reciprocally, IL-12 can also directly induce IRF-1 expression in NK and T cells independently of IFN-
production. This induction is mediated by Stat4. Thus IRF-1 is an important contributor to IL-12 signaling (18).
However, the cellular/molecular mechanisms and additional downstream players involved in IRF-1-mediated tumor surveillance against lymphoid malignancies have not been systematically identified and characterized. In this work, we investigate the role of IRF-1 and IL-12 in host resistance to N-methyl-N-nitrosourea (MNU)-induced lymphoproliferative disease in the mouse, and attempt to identify the molecular mediators of the actions of IRF-1.
| Materials and Methods |
|---|
|
|
|---|
Female IRF-1/, IFN-
/, IL-12 p40/, IL-12 p35/, LT
/ mice and their control, C57BL/6J mice, at the age of 4
5 wk were obtained from The Jackson Laboratory (Bar Harbor, ME), and housed in cages with filter tops in a laminar flow hood and fed food and acid water ad libitum.
Cells
Peritoneal macrophages were obtained directly from the peritoneum cavity. Cells were washed and resuspended in RPMI 1640 containing 10% FCS and standard supplements. Macrophages were plated in 24-well tissue culture dishes (0.5 x 106 cells/well). After a 2-h incubation to allow for adherence of macrophages, monolayers were washed three times to remove nonadherent cells, and incubated with RPMI 1640 containing 10% FCS and standard supplements. The next day some wells were treated with LPS (1 µg/ml) in a final volume of 1 ml, or IFN-
(10 ng/ml) first for 16 h (priming), followed by LPS treatment. To obtain splenocytes, the spleen was ground and filtered to make a single cell suspension, and then the RBC were lysed. The splenocytes were plated in 100-mm tissue culture dishes for 2 h to deplete the adherent cells. The nonadherent cells were plated in six-well tissue culture plates and treated with Con A (5 µg/ml) or Con A plus murine IL-12 (2 ng/ml) for 3 days.
Reagents
MNU was purchased from Sigma-Aldrich (St. Louis, MO). Recombinant murine (rm) IL-12 was provided by Genetics Institute (Cambridge, MA). rmIFN-
was purchased from Genzyme (Boston, MA). LPS from Escherichia coli 0217:B8 was purchased from Sigma-Aldrich.
Lymphoma model and in vivo treatment
T lymphoma was induced in 45-wk-old mice by a single i.p. injection of MNU freshly prepared in PBS buffer at the dose of 50 mg/kg body weight. Animals were sacrificed when symptoms of thymic lymphoma such as hunched posture and labored breathing were evident, and a cumulative tally of the number of animals that developed lymphoma was recorded. All animals were sacrificed by 18 wk after MNU injection. IL-12 treatment was given by i.p. injection at 500 ng per dose, three times a week, commencing 1 day after MNU injection, and repeated weekly for 18 wk until the experiment was terminated. An identical volume of PBS was given by i.p. injection three times a week to the control group.
Histopathology
Systematic autopsies were performed for each animal from all groups. Samples of tumors and selected organs (lung, liver, kidney, thymus, spleen, and lymph node) were fixed in 10% buffered Formalin, processed through graded alcohols and xylene, and embedded in paraffin. Five-micrometer sections were cut and stained with H&E. Sections were imaged with an Olympus microscope (Olympus Optical, Tokyo, Japan) equipped with a Spot digital camera (Sony, Tokyo, Japan).
EMSAs
Supernatants from macrophage cultures were harvested at 24 h after LPS stimulation and stored at 20°C. Supernatants from splenocytes cultures were collected after 3 days of stimulation with Con A or Con A plus rmIL-12. Mouse IL-12 p70 and IFN-
were detected by using the OPT-EIA ELISA kit (BD Pharmingen, San Diego, CA) according to the manufacturers instructions. Concentrations were calculated by regression analysis of a standard curve.
RNase protection assay (RPA)
Total RNA was isolated from the spleens of WT and IRF-1/ mice following the in vivo experimentation, and 10 µg of total RNA from each sample was subjected to multiprobe RPA (BD Pharmingen) according to the manufacturers instructions.
RT-PCR
Reverse transcription reactions were conducted as follows: 2 µg of total RNA were mixed with 2 µl of oligo(dT) primers (16 mer, 0.5 mg/ml) and double-distilled H2O to equalize volumes of all samples at 8.5 µl. The mix was heated at 65°C for 10 min, quenched on ice, spun down briefly, and 11.5 µl of a Master Mix was added. The Reverse Transcription Master Mix consisted of 4 µl of 5x first stand buffer (Invitrogen, Carlsbad, CA), 4 µl of 2.5 mM dNTPs, 2 µl of 0.1 M DTT, 0.5 µl of RNase inhibitor (40 U/µl; Invitrogen), 1 µl of Superscript II (200 U/µl; Invitrogen). The action was incubated at 37°C for 90 min, then 95°C for 10 min, followed by 4°C soak. To each sample (in 20 µl total volume) 80 µl of double-distilled H2O was added. A total of 3 µl was used for each PCR of 25 µl in volume. The following primers were used for PCR amplification: mouse IL-12 p40 sense, ATGGCCATGTGGGAGCTGGAG, and antisense, TTTGGTGCTTCACACTTCAGG; mouse IL-12 p35 sense, TCCTGCACTGCTGAAGACAT, and antisense, AGAGGGCCTTGAGCTTTCAG; mouse CD11b sense, AGCAATGAGTTCGACTACCCATCC and antisense, GTCACTGTATCCGTGAAACCCAGT; mouse CD11c sense, CCAGAGGATTTCAGCATCCCAGAT, and antisense, ACAGTACTTCGGAGGTCACCTAGT; mouse spasmolytic peptide (SP) sense, TGACACCCCACAACAGAAAG, and antisense, GGAAAAGCAGCAGTTTCGAC; mouse pancreatic RNase (Rib-1) sense, CATCAACAGCCCCACCTACT, and antisense, TTGGGATACTTGGAGTTGCC; mouse preproelastase II (ELA2R) sense, GCCTGCTGGTTGTGGACTAT, and antisense, GTAGTTGCAGCCCAGAGAGG; mouse carboxyl ester lipase (U37386) sense, CCAAGCCACCTTTGACATCT, and antisense, GGAGGTCATCAGCATGGTCT; mouse RANTES sense, CCCTCACCATCATCCTCACT, and antisense, CTTCTTCTCTGGGTTGGCAC; and mouse HPRT sense, GTTGGATACAGGCCAGACTTTGTTG, and antisense, GAGGGTAGGCTGGCCTATGGCT.
Microarray experiment
The high-density oligonucleotide microarray system of Affymetrix (Santa Clara, CA), murine Genome U74A Array version 2, containing 12,488 genes, was used. Total RNA was isolated from the spleen of WT and IRF-1/ mice treated or not with MNU for 18 wk. RNA samples of each mouse within each experimental group were pooled from 9 to 10 mice. RNA (10 µg total) was used to synthesize cDNA using Superscript cDNA synthesis kit (Invitrogen, Carlsbad, CA) with a primer containing oligo(dT) and T7 RNA polymerase promoter sequences. Double-stranded cDNA was then purified by phase lock gel (Eppendorf, Westbury, NY) with phenol/chloroform extraction. The purified cDNA was used as a template to generate biotinylated cRNA using the Bioarray High Yield RNA Transcript Labeling kit (Enzo Biochem, New York, NY). Then biotinylated cRNAs were fragmented and hybridized to Affymetrix Test 3 chips. All RNA samples passed quality control (ratio of 3':5' < 3), then the samples were hybridized to the Murine Genome Array U74Av2 array that contains 12,488 well-substantiated mouse genes. After overnight hybridization, the arrays were washed, stained with streptavidin-PE (Molecular Probes, Eugene, OR) on the GeneChip Fluidics Station (Affymetrix), and scanned according to the standard Affymetrix protocol.
Microarray data collection and analysis
Affymetrix GeneChip 5.0 was used as the image acquisition software for the U74Av2 chips. The signal, which represents the intensity of each gene, was extracted from the image. The target intensity value from each chip was scaled to 250. Data normalization, log transformation, statistical analysis and pattern study were performed with GeneSpring software (Silicon Genetics, Redwood City, CA). Array data were globally normalized using GeneSpring software. Firstly, all of the measurements on each chip were divided by the 50th percentile value (per chip normalization). Secondly, each gene was normalized to the baseline value of the control samples (per gene normalization). A two-way hierarchical clustering method (19) was used to visualize the coordinated expression profiles and study coexpression patterns of all 12,488 genes over all the samples. The standard correlation was chosen to measure the similarity, and the minimum distance to separate genes or samples was 0.001.
Statistical analysis
The Student t test was performed wherever applicable. SD of the mean is shown unless otherwise indicated.
| Results |
|---|
|
|
|---|
We hypothesized that IRF-1, by virtue of its importance for IFN-
signaling, may be crucial for host resistance to malignant lymphoproliferative diseases. We thus conducted a series of experiments to test this hypothesis. MNU is one of the nitroso compounds that are well-known carcinogens that induce thymic lymphomas in mice (20, 21). These compounds cause neoplasia by alkylation- and/or methylation-mediated mutagenesis of nucleic acids, proteins, and lipids (22, 23).
Two groups of mice: WT (C57BL/6J) and IRF-1/ of 45 wk of age, were given a single dose of MNU at the beginning, and the rate of mortality from the resulting lymphomas was monitored. As shown in Fig. 1A, only 2 of the 25 WT animals died of lymphomas within the experimental period. In contrast, 20 of 24 IRF-1/ mice died of massive lymphoid neoplasia. Autopsy examination of the mice indicated that, compared with normal mice, IRF-1/ mice had enlarged spleens, lymph nodes, particularly, thymuses (Fig. 1, B and C), and anemia.
|
Association of tumor susceptibility with strongly defective LT
, IFN-
, and IL-12 gene expression
To determine the functional basis of the difference between IRF-1/ mice in their susceptibility to MNU-induced lymphoid malignancy, we measured the mRNA expression of a number of effector cytokines important for host resistance to cancer development, such as LT
, LT
, TNF-
, and IFN-
, by RPA at the endpoint of the experiment (Fig. 2A). Normal mice expressed LT
, LT
, TNF-
, IFN-
, TGF-
1, and macrophage migration inhibitory factor in the spleen. MNU treatment of these mice did not alter the cytokine expression pattern. In contrast, MNU-treated IRF-1/ mice expressed much lower levels of LT
, LT
, IFN-
, and somewhat lower levels of TGF-
1, but higher levels of macrophage migration inhibitory factor, indicating that MNU-induced malignancy provoked an active suppression of these effector molecules in IRF-1/ animals.
|
Consistent with the impairment in IL-12 p40 and p35 mRNA expression, the ability of resident peritoneal macrophages of IRF-1/ mice to produce IL-12 p70 protein in response to in vitro stimulation with LPS and IFN-
was also reduced compared with WT mice (Fig. 2D).
Susceptibility of IL-12 p40/, IL-12 p35/, LT
/, and IFN-
/ mice to MNU-induced lymphoma
The severe deficiencies in the expression of IL-12 p40, IL-12 p35, IFN-
, and LT
genes in IRF-1/ mice treated with MNU prompted us to further investigate the role of each of these individual genes in host resistance against lymphoproliferative diseases. WT mice and mice genetically depleted of IRF-1, IL-12 p40, IL-12 p35, IFN-
, and LT
genes individually were given the MNU treatment as described above and their survival was monitored. These genetically deficient mice were to varying degrees susceptible to mortality caused by MNU-induced lymphoma in the increasing order of IL-12 p40/, LT
/, IRF-1/, IFN-
/, and IL-12 p35/, measured at wk 18 after MNU injection (Fig. 3A). Histopathological analyses of the spleen of these mice revealed phenotypic characteristics such as the destruction of the lymphoid architectures and presence of large numbers of malignant lymphocytes correlated with their degree of susceptibility (Fig. 3B). These results strongly point to the IRF-1/IL-12/IFN-
regulatory pathway as an essential component of host defense against malignant lymphoproliferation.
|
production
Our group has recently shown that IRF-1 is a critical transcription factor for IL-12 p35 gene expression and IL-12 p70 production (17). To further investigate the regulatory relationship of IRF-1 and IL-12 in the context of their respective role in controlling malignant lymphoproliferation, we sought to determine whether the loss of the IRF-1/ gene had any impact on cellular response to IL-12-mediated signaling. Splenic lymphocytes were isolated from WT and IRF-1/ mice, and stimulated in vitro with Con A with or without rmIL-12. The response to IL-12 was measured by the production of IFN-
in the culture supernatant (Fig. 4). IRF-1/ lymphocytes were strongly impaired in their ability to produce IFN-
in response to Con A stimulation. However, this defect was largely overcome by the IL-12 treatment, indicating that the IRF-1/ gene deletion does not affect the cells response to IL-12 with respect to IFN-
production.
|
Encouraged by the observation that IFN-
production in response to IL-12 remained intact in IRF-1/ lymphocytes, we administered rIL-12 to IRF-1/ mice treated with MNU in an attempt to determine whether IL-12 was able to rescue these mice from MNU-induced lethality. As shown in Fig. 5A, 80% of the MNU-treated WT mice survived during the 18-wk period, whereas only 10% of the IRF-1/ mice did. IRF-1/ mice that received the IL-12 treatment did considerably better than those that did not receive IL-12 with a 60% survival rate. Splenic RNA from these groups of mice was analyzed for several lymphokines at the end of the experiment. Again, mRNA expression of LT
, LT
, TNF-
, IFN-
, and TGF-
1 were normal in WT mice treated with MNU, whereas their expression was drastically reduced in IRF-1/ mice treated with MNU (Fig. 5B, compare lanes 2 and 5). The IL-12 treatment restored normal expression of these cytokines in some of the IRF-1/ mice that did not develop massive lymphoma (Fig. 5B, compare lanes 6 and 3), but not in those IRF-1/ mice that did not respond to the IL-12 treatment (lane 7). These results provide a possible mechanistic explanation for the enhanced resistance of IRF-1/ mice to MNU-induced mortality following IL-12 treatment.
|
We were interested in identifying genes that are controlled by IRF-1 in immune cells in the spleen, which may contribute to the mediation of IRF-1s immune surveillance function. To achieve this objective, the Affymetrix oligonucleotide microarrays were used to identify mRNA expression differences in splenocytes between normal and IRF-1/ mice challenged or not with MNU. Four experimental groups were included in this analysis: WT mice without MNU (group 1), WT mice with MNU (group 2), IRF-1/ mice without MNU treatment (group 3), and IRF-1/ mice with MNU-treatment (group 4). All spleen samples were taken at the end of the 18-wk experimental period.
Following appropriate normalization and standardization, the data on each chip were compared with each other using a hierarchical clustering method (Fig. 6A). It revealed two major groups of genes: those that were induced in groups 24 (clusters of red bars), and those that were reduced in expression (clusters of blue bars). The functional significance of this clear separation is presently unclear because they appear to be independent of both IRF-1 and MNU. However, our focus was the comparison between WT treated with MNU (group 2) and IRF-1/ treated with MNU (group 4), one developed no lymphomas and the other did. The objective was to identify those genes that were induced by MNU treatment in the presence of IRF-1, but not in the absence of it. To verify the differential gene expression patterns revealed by the microarray analysis, five genes were selected for confirmation by semiquantitative RT-PCR: SP, pancreatic RNase (Rib-1), preproelastase II (ELA2R), carboxyl ester lipase (U37386), and RANTES. Expression of all five genes was potently induced by MNU treatment in WT mice, but not in IRF-1/ mice (Fig. 6B, columns 14). Interestingly, all five genes appear expressed at similar levels to WT in IFN-
/ and LT
/ mice treated with MNU (columns 5 and 8), suggesting that they are not regulated by IFN-
or LT
. Expression of RANTES mRNA mimics closely the pattern detected by the microarray experiment. Unlike the other four genes, RANTES was also expressed in IL-12 p35/ or p40/ mice treated with MNU (columns 6 and 7), suggesting that it is not regulated by IL-12.
|
The microarray data were further sorted based on two major criteria: 1) Only those genes that were called "present" and induced 4-fold or more in MNU-challenged WT mice over nontreated WT mice were chosen; and 2) These genes should also satisfy the condition that they show no statistically significantly greater expression in IRF-1/ mice with or without MNU treatment than in non-MNU-treated WT mice because of our assumption that the IRF-1 deficiency should render these genes inactive regardless of experimental conditions imposed on them, if they are directly controlled by IRF-1. The statistical limit set by the program (GeneSpring) is <2-fold of change, which is considered not significant or reliably different. This stringency also required the 4-fold standard in criterion number 1 for the expression levels in WT mice challenged with MNU to be at least 2-fold higher than any of the other three groups of mice. These stringent constraints resulted in the identification of 32 genes (Table I).
|
| Discussion |
|---|
|
|
|---|
production, confers resistance to MNU-induced tumorigenesis. The data presented in this study strongly highlights the importance of such a regulatory circuitry in host resistance to neoplastic transformation.
We show that some important cytokines such as IFN-
, LT
, and IL-12 were expressed normally in WT mice treated with MNU, while IRF-1/ mice were severely deficient in their expression (Fig. 2). This suggests that treatment with MNU induces an active suppression of normally expressed genes critical to host defense and tumor surveillance. However, IL-12 treatment of IRF-1/ mice was able to largely restore the normal expression of these cytokines (Fig. 5B), and significantly rescue the animals from MNU-induced lethality (Fig. 5A). There is a concern why IL-12 treatment of normal mice was not able to induce more IFN-
mRNA expression. The answer is that normal mice can produce IL-12 on their own when challenged with MNU (Fig. 2B). IRF-1/ mice cannot produce adequate amounts of IL-12 (Fig. 2C), but are able to respond to exogenous IL-12 (Fig. 4).
The present and previous work from our group, as well as from many others, provide us with an unsolved dilemma regarding the relationship between IL-12 and IFN-
. On the one hand, IL-12 is recognized as the primary stimulator of IFN-
production by NK and T cells (24) through a Stat4-dependent mechanism (25). On the other hand, IFN-
is also critical for high levels of IL-12 production (5) in an IRF-1-dependent manner (15, 16, 17). These seemingly "paradoxical" results derived from multiple studies could be reconciled by the hypothesis of the existence of an amplification loop/close circuit in the IL-12/IFN-
pathway. It could be speculated that during a microbial infection, infectious agents such as bacteria and parasites stimulate innate immune cells such as macrophages to produce the initial small amount of IL-12, which then activates NK cells to produce IFN-
. This IFN-
production then acts as a costimulatory factor for macrophages in the presence of the microbial agent to induce much larger amounts of IL-12 production via transcriptional activation of IL-12 p40 primarily by IFN consensus sequence binding protein (26), and p35 via IRF-1 (15, 16, 17), both induced by IFN-
. This second-wave large amount of IL-12 production can exert both local and systemic effects on APCs and lymphocytes in the ensuing adaptive phase of the immune response, and help sustain a Th1-response against the pathogen.
It is of interest that IL-12 p40/ and IL-12 p35/ mice showed significantly different propensity to MNU-induced pathogenesis in that the former is more resistant than the latter. The basis of this difference is not understood presently. p40 is a shared component of IL-12 (with p35) and IL-23 (with p19). It is conceivable that IL-12 and IL-23 may play a different role in host defense against MNU-induced lymphoma, i.e., IL-12 being protective as evidenced by the extreme susceptibility of IL-12 p35/ mice, and IL-23 being exacerbating for the disease, resulting in an intermediate susceptibility in IL-12 p40/ mice. Divergent roles of IL-23 and IL-12 have been reported in mycobacterial infection (27), in autoimmune inflammation of the brain (28), and in joint inflammation (29). Alternatively, IL-23 and IL-12 may target different cell types and subtypes (NK, T, macrophage, DC) (30, 31, 32), which may explain the difference in the susceptibility of IL-12 p40/ and IL-12 p35/ mice to MNU-induced lymphoma. This hypothesis could be tested with IL-23 p19/ mice.
We designed the microarray experiment with the objective to identify genes whose expression is induced by MNU in an IRF-1-dependent manner in immune cells of the spleen. These genes may contribute to the mediation of IRF-1s immune surveillance function. Identification of these genes could provide a more integrated framework where IRF-1 regulates immune responses to a developing malignancy. A very similarly designed experiment by Gerhold et al. (33) to examine alterations in gene regulation in liver induced by the PPAR
agonist Wy14643 in WT and PPAR
knockout mice identified the direct target genes of PPAR
: CD36, CPT1, CPT2, ACO, and BE, all of which are key factors in lipid uptake and lipid
oxidation, indicating a central role PPAR
plays in lipid metabolism.
The list of 32 genes induced by MNU in WT but not IRF-1/ mice includes three TCR V
locus-derived mRNA expression, suggesting that IRF-1 may be required in the stimulation of the expansion of a specific subset(s) of T cells bearing a particular V
chain(s) in response to MNU treatment. Many genes encode enzymes such as proteases and RNase, suggesting that IRF-1 may exert its tumor-suppressor activity by inducing these effector molecules in apoptotic killing of target cells. For example, human pancreatic RNase 1 has been used as a therapeutic toxin against hyperproliferative T lymphocytes such as T cell leukemia (34). Secreted and tumor-targeted human carboxyl esterase has been engineered to activate the anticancer prodrug irinotecan (CPT-11) for the treatment of colon cancer (35). RANTES is a member of the chemokine family of proteins, which plays an essential role in inflammation by recruiting T cells, macrophages, and eosinophils to inflammatory sites (36, 37, 38). Expression of RANTES has been shown to be synergistically induced by TNF-
and IFN-
through NF-
B and IRF-1, respectively (39), and is a predictor of survival in stage I lung adenocarcinoma (40). The induction of Bcl-2 can be rationalized by the findings by Ohteki et al. (41), who showed that endogenous Bcl-2 expression is substantially reduced in IRF-1/CD8+ thymocytes, and that introduction of a human Bcl-2 transgene driven by Emu or lck promoter in IRF-1/ mice restored the defective CD8+ T cell development and function. In contrast to thymus-derived CD8+ T cells, other lymphocyte subsets including NK, NKT, and TCR
intestinal intraepithelial lymphocytes, which are also impaired in IRF-1/ mice, were not rescued by expressing human Bcl-2. These results indicate that IRF-1 differentially regulates the development of these lymphocyte subsets and that survival signals involving Bcl-2 are critical for the development of thymus-dependent CD8+ T cells.
However, a cautionary note is that it was not possible, by this experimental design, to rule out that the differential expression patterns were due to a major difference in the type of cells present in the spleen of MNU-treated WT and IRF-1/ mice at the time of analysis. This concern could be addressed by gene expression analysis earlier in the development of the lymphomas when there are not yet severe alterations in the lymphoid architecture and composition. In addition, a kinetic microarray-based search focusing on early time points following MNU injection could provide stronger clues about the direct targets of IRF-1, instead of secondary and tertiary events influenced by IRF-1 at later time points.
This study purports the hypothesis that the increased susceptibility of IRF-1/ mice to MNU-induced lethal lymphoma is due, not only to a deregulated induction of apoptosis in the absence of IRF-1, but also to an altered immune-mediated regulatory circuit. We base our hypothesis on the following observations and considerations: 1) In MNU-treated IRF-1/ mice, there were strong deficiencies in the expression of some of the immunologically important genes such as LT
, TNF-
, IFN-
, and IL-12 (Fig. 2) that were associated with their respective susceptibility to lymphoma (Fig. 3A); and 2) IL-12 treatment of MNU-challenged IRF-1/ mice could partially rescue them from lethal lymphoma (Fig. 5A) (3). IRF-1/ mice have strong impairment in the development and function of NK, NKT, and CTL, all of which are critical to immune surveillance against neoplastic transformation (5). It should be stressed that the immunological mechanism is in concert and concurrent with the nonimmunological mechanism mediated by IRF-1. They are not mutually exclusive.
In summary, our study provides direct evidence that IRF-1 is vitally important in immune surveillance against MNU-induced lymphoproliferative malignancy in a manner that may crucially depend on the production of IL-12, IFN-
, LT
, and perhaps other unidentified factors. In other words, IRF-1 is a centrally located molecule in multiple pathways that forms the host defense against neoplastic transformation. The global gene expression analysis is the first step toward a comprehensive identification of the critical players in IRF-1-regulated networks of immune resistance.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Xiaojing Ma, Department of Microbiology and Immunology, Weill Medical College, Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: xim2002{at}med.cornell.edu ![]()
3 Abbreviations used in this paper: IRF-1, IFN regulatory factor-1; DC, dendritic cells; LT, lymphotoxin; MNU, N-methyl-N-nitrosourea; rm, recombinant murine; RPA, RNase protection assay; SP, spasmolytic peptide; WT, wild type. ![]()
Received for publication January 13, 2004. Accepted for publication May 11, 2004.
| References |
|---|
|
|
|---|
/
+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells. J. Exp. Med. 187:967.
affect tumorigenicity and response to IL-12 therapy and antiangiogenesis. Immunity 9:25.[Medline]
and lipopolysaccharide stimulation. J. Immunol. 167:5653.
-primed IL-12 production by IFN regulatory factor 1. J. Exp. Med. 198:1265.
-inducible transcription factor, IFN consensus sequence binding protein (ICSBP), stimulates IL-12 p40 expression in macrophages. J. Immunol. 165:271.
induce the migration and activation of normal human eosinophil granulocytes. J. Exp. Med. 176:1489.
, or human interleukin 8. J. Exp. Med. 178:1913.
and interferon-
synergistically activate the RANTES promoter through nuclear factor
B and interferon regulatory factor 1 (IRF-1) transcription factors. Biochem. J. 350:(Pt. 1):131.
This article has been cited by other articles:
![]() |
K. D. McCall, N. Harii, C. J. Lewis, R. Malgor, W. Bae Kim, M. Saji, A. D. Kohn, R. T. Moon, and L. D. Kohn High Basal Levels of Functional Toll-Like Receptor 3 (TLR3) and Noncanonical Wnt5a Are Expressed in Papillary Thyroid Cancer and Are Coordinately Decreased by Phenylmethimazole Together with Cell Proliferation and Migration Endocrinology, September 1, 2007; 148(9): 4226 - 4237. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-c. Chen, R. Wang, X. Zhao, Y.-q. Wei, M. Hu, Y.-s. Wang, X.-w. Zhang, R. Zhang, L. Zhang, B. Yao, et al. Prophylaxis against carcinogenesis in three kinds of unestablished tumor models via IL12-gene-engineered MSCs Carcinogenesis, December 1, 2006; 27(12): 2434 - 2441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goriely, C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit, V. Flamand, F. Willems, and M. Goldman Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 gene activation Blood, February 1, 2006; 107(3): 1078 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, X. Guan, and X. Ma Interferon Regulatory Factor 1 Is an Essential and Direct Transcriptional Activator for Interferon {gamma}-induced RANTES/CCl5 Expression in Macrophages J. Biol. Chem., July 1, 2005; 280(26): 24347 - 24355. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |