The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.
Right arrow Articles by Ma, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.
Right arrow Articles by Ma, X.
The Journal of Immunology, 2004, 173: 1184-1193.
Copyright © 2004 by The American Association of Immunologists

Role of IFN Regulatory Factor-1 and IL-12 in Immunological Resistance to Pathogenesis of N-Methyl-N-Nitrosourea-Induced T Lymphoma1

Jianguo Liu, Zhaoying Xiang and Xiaojing Ma2

Department of Microbiology and Immunology, Weill Medical College, Cornell University, 1300 York Avenue, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN regulatory factor-1 (IRF-1) is a critical effector molecule in IFN signaling and acts as a tumor suppressor and tumor susceptibility gene. IL-12 is a key factor in the induction of innate resistance and generation of Th1 cells and CTL. Our recent study has revealed an intimate relationship between IRF-1 and IL-12 in that IRF-1 regulates the production of IL-12 by selectively controlling transcriptional activation of IL-12 p35 gene. In this work, we find that IRF-1-deficient mice are highly susceptible to N-methyl-N-nitrosourea (MNU)-induced T lymphomas. This susceptibility is associated with strong defects in the expression of IL-12, lymphotoxin (LT){beta}, and IFN-{gamma}. Consistently, IL-12 p35–/–, IFN-{gamma}–/–, and LT{beta}–/– mice are also highly vulnerable to MNU-induced carcinogenesis. Administration of rIL-12 to IRF-1–/– mice restores normal expression of LT{beta} and IFN-{gamma}, and significantly enhances the ability of IRF-1–/– mice to resist MNU-induced pathogenesis. This strongly suggests an IRF-1/IL-12/IFN-{gamma} regulatory axis in tumor surveillance. By DNA microarray analysis, we comprehensively identify differences and patterns in gene expression in splenocytes of wild-type (WT) vs IRF-1–/– mice challenged with MNU. This study contributes to efforts to elucidate the cellular/molecular mechanisms and the downstream players involved in IRF-1-mediated host defense against lymphoproliferative malignancies.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The concept of immune surveillance against neoplastic transformation has been reinvigorated in recent years, which lends strong theoretical support for efforts to control malignant development by boosting the host immune recognition and mobilization (1).

IFN regulatory factor-1 (IRF-1)3 has a remarkable functional diversity in the regulation of cellular response in host defense. IRF-1 selectively targets different sets of genes in various cell types in response to diverse cellular stimuli and evokes appropriate innate and adaptive immune responses (2). It has been firmly established as a critical effector molecule in IFN-{gamma}-mediated signaling and in the development and function of NK, NKT, and CTL (3, 4, 5, 6, 7, 8). IRF-1 also has direct antiproliferative effects, thus acting as a tumor suppressor and tumor susceptibility gene.

IL-12 is a heterodimer (p40 and p35) produced primarily by macrophages and dendritic cells (DCs) in both innate and adaptive immune responses. It is a key factor in the induction of T cell-dependent and -independent activation of macrophages, NK cells, generation of Th1 cells and CTL, induction of opsonizing, complement-fixing Abs, and resistance to intracellular infections (9). Systemic (10) and local (11) administration of exogenous IL-12 is highly effective against the growth of a large number of transplantable (10, 11) as well as chemically (12, 13) and oncogene-induced (13) primary mouse tumors by activation of lymphoid cells that kill tumor cells, damage tumor vessels, release secondary messengers such as IFN-{gamma} and TNF-{alpha}, and trigger the production of third level antiangiogenic chemokines, such as IFN-{gamma} inducible protein-10 and monokine induced by IFN-{gamma} (11, 14).

The first demonstration of the importance of IRF-1 in IL-12 production and IL-12-mediated induction of Th1 immune responses was provided by the work of Taki et al. (5), who showed that T cells from mice lacking IRF-1 failed to mount Th1 responses and, instead, exclusively underwent Th2 differentiation in vitro. Compromised Th1 differentiation was associated with defects in IL-12 production by macrophages and hyporesponsiveness of CD4+ T cells to IL-12. Subsequently, two independent studies have confirmed the role of IRF-1 in the regulation of IL-12 p40 and p35 gene transcription (15, 16). Our own recent study has revealed an intimate relationship between IRF-1 and IL-12, in that IRF-1 regulates the production of IL-12 by selectively controlling transcriptional activation of IL-12 p35 gene (17). These studies provide a mechanistic explanation for the IFN-{gamma} priming effect, i.e., IFN-{gamma}-mediated activation of APCs that is required for vigorous IL-12 production to generate robust cellular immunity (5). Reciprocally, IL-12 can also directly induce IRF-1 expression in NK and T cells independently of IFN-{gamma} production. This induction is mediated by Stat4. Thus IRF-1 is an important contributor to IL-12 signaling (18).

However, the cellular/molecular mechanisms and additional downstream players involved in IRF-1-mediated tumor surveillance against lymphoid malignancies have not been systematically identified and characterized. In this work, we investigate the role of IRF-1 and IL-12 in host resistance to N-methyl-N-nitrosourea (MNU)-induced lymphoproliferative disease in the mouse, and attempt to identify the molecular mediators of the actions of IRF-1.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

Female IRF-1–/–, IFN-{gamma}–/–, IL-12 p40–/–, IL-12 p35–/–, LT{beta}–/– mice and their control, C57BL/6J mice, at the age of 4~5 wk were obtained from The Jackson Laboratory (Bar Harbor, ME), and housed in cages with filter tops in a laminar flow hood and fed food and acid water ad libitum.

Cells

Peritoneal macrophages were obtained directly from the peritoneum cavity. Cells were washed and resuspended in RPMI 1640 containing 10% FCS and standard supplements. Macrophages were plated in 24-well tissue culture dishes (0.5 x 106 cells/well). After a 2-h incubation to allow for adherence of macrophages, monolayers were washed three times to remove nonadherent cells, and incubated with RPMI 1640 containing 10% FCS and standard supplements. The next day some wells were treated with LPS (1 µg/ml) in a final volume of 1 ml, or IFN-{gamma} (10 ng/ml) first for 16 h (priming), followed by LPS treatment. To obtain splenocytes, the spleen was ground and filtered to make a single cell suspension, and then the RBC were lysed. The splenocytes were plated in 100-mm tissue culture dishes for 2 h to deplete the adherent cells. The nonadherent cells were plated in six-well tissue culture plates and treated with Con A (5 µg/ml) or Con A plus murine IL-12 (2 ng/ml) for 3 days.

Reagents

MNU was purchased from Sigma-Aldrich (St. Louis, MO). Recombinant murine (rm) IL-12 was provided by Genetics Institute (Cambridge, MA). rmIFN-{gamma} was purchased from Genzyme (Boston, MA). LPS from Escherichia coli 0217:B8 was purchased from Sigma-Aldrich.

Lymphoma model and in vivo treatment

T lymphoma was induced in 4–5-wk-old mice by a single i.p. injection of MNU freshly prepared in PBS buffer at the dose of 50 mg/kg body weight. Animals were sacrificed when symptoms of thymic lymphoma such as hunched posture and labored breathing were evident, and a cumulative tally of the number of animals that developed lymphoma was recorded. All animals were sacrificed by 18 wk after MNU injection. IL-12 treatment was given by i.p. injection at 500 ng per dose, three times a week, commencing 1 day after MNU injection, and repeated weekly for 18 wk until the experiment was terminated. An identical volume of PBS was given by i.p. injection three times a week to the control group.

Histopathology

Systematic autopsies were performed for each animal from all groups. Samples of tumors and selected organs (lung, liver, kidney, thymus, spleen, and lymph node) were fixed in 10% buffered Formalin, processed through graded alcohols and xylene, and embedded in paraffin. Five-micrometer sections were cut and stained with H&E. Sections were imaged with an Olympus microscope (Olympus Optical, Tokyo, Japan) equipped with a Spot digital camera (Sony, Tokyo, Japan).

EMSAs

Supernatants from macrophage cultures were harvested at 24 h after LPS stimulation and stored at –20°C. Supernatants from splenocytes cultures were collected after 3 days of stimulation with Con A or Con A plus rmIL-12. Mouse IL-12 p70 and IFN-{gamma} were detected by using the OPT-EIA ELISA kit (BD Pharmingen, San Diego, CA) according to the manufacturer’s instructions. Concentrations were calculated by regression analysis of a standard curve.

RNase protection assay (RPA)

Total RNA was isolated from the spleens of WT and IRF-1–/– mice following the in vivo experimentation, and 10 µg of total RNA from each sample was subjected to multiprobe RPA (BD Pharmingen) according to the manufacturer’s instructions.

RT-PCR

Reverse transcription reactions were conducted as follows: 2 µg of total RNA were mixed with 2 µl of oligo(dT) primers (16 mer, 0.5 mg/ml) and double-distilled H2O to equalize volumes of all samples at 8.5 µl. The mix was heated at 65°C for 10 min, quenched on ice, spun down briefly, and 11.5 µl of a Master Mix was added. The Reverse Transcription Master Mix consisted of 4 µl of 5x first stand buffer (Invitrogen, Carlsbad, CA), 4 µl of 2.5 mM dNTPs, 2 µl of 0.1 M DTT, 0.5 µl of RNase inhibitor (40 U/µl; Invitrogen), 1 µl of Superscript II (200 U/µl; Invitrogen). The action was incubated at 37°C for 90 min, then 95°C for 10 min, followed by 4°C soak. To each sample (in 20 µl total volume) 80 µl of double-distilled H2O was added. A total of 3 µl was used for each PCR of 25 µl in volume. The following primers were used for PCR amplification: mouse IL-12 p40 sense, ATGGCCATGTGGGAGCTGGAG, and antisense, TTTGGTGCTTCACACTTCAGG; mouse IL-12 p35 sense, TCCTGCACTGCTGAAGACAT, and antisense, AGAGGGCCTTGAGCTTTCAG; mouse CD11b sense, AGCAATGAGTTCGACTACCCATCC and antisense, GTCACTGTATCCGTGAAACCCAGT; mouse CD11c sense, CCAGAGGATTTCAGCATCCCAGAT, and antisense, ACAGTACTTCGGAGGTCACCTAGT; mouse spasmolytic peptide (SP) sense, TGACACCCCACAACAGAAAG, and antisense, GGAAAAGCAGCAGTTTCGAC; mouse pancreatic RNase (Rib-1) sense, CATCAACAGCCCCACCTACT, and antisense, TTGGGATACTTGGAGTTGCC; mouse preproelastase II (ELA2R) sense, GCCTGCTGGTTGTGGACTAT, and antisense, GTAGTTGCAGCCCAGAGAGG; mouse carboxyl ester lipase (U37386) sense, CCAAGCCACCTTTGACATCT, and antisense, GGAGGTCATCAGCATGGTCT; mouse RANTES sense, CCCTCACCATCATCCTCACT, and antisense, CTTCTTCTCTGGGTTGGCAC; and mouse HPRT sense, GTTGGATACAGGCCAGACTTTGTTG, and antisense, GAGGGTAGGCTGGCCTATGGCT.

Microarray experiment

The high-density oligonucleotide microarray system of Affymetrix (Santa Clara, CA), murine Genome U74A Array version 2, containing 12,488 genes, was used. Total RNA was isolated from the spleen of WT and IRF-1–/– mice treated or not with MNU for 18 wk. RNA samples of each mouse within each experimental group were pooled from 9 to 10 mice. RNA (10 µg total) was used to synthesize cDNA using Superscript cDNA synthesis kit (Invitrogen, Carlsbad, CA) with a primer containing oligo(dT) and T7 RNA polymerase promoter sequences. Double-stranded cDNA was then purified by phase lock gel (Eppendorf, Westbury, NY) with phenol/chloroform extraction. The purified cDNA was used as a template to generate biotinylated cRNA using the Bioarray High Yield RNA Transcript Labeling kit (Enzo Biochem, New York, NY). Then biotinylated cRNAs were fragmented and hybridized to Affymetrix Test 3 chips. All RNA samples passed quality control (ratio of 3':5' < 3), then the samples were hybridized to the Murine Genome Array U74Av2 array that contains 12,488 well-substantiated mouse genes. After overnight hybridization, the arrays were washed, stained with streptavidin-PE (Molecular Probes, Eugene, OR) on the GeneChip Fluidics Station (Affymetrix), and scanned according to the standard Affymetrix protocol.

Microarray data collection and analysis

Affymetrix GeneChip 5.0 was used as the image acquisition software for the U74Av2 chips. The signal, which represents the intensity of each gene, was extracted from the image. The target intensity value from each chip was scaled to 250. Data normalization, log transformation, statistical analysis and pattern study were performed with GeneSpring software (Silicon Genetics, Redwood City, CA). Array data were globally normalized using GeneSpring software. Firstly, all of the measurements on each chip were divided by the 50th percentile value (per chip normalization). Secondly, each gene was normalized to the baseline value of the control samples (per gene normalization). A two-way hierarchical clustering method (19) was used to visualize the coordinated expression profiles and study coexpression patterns of all 12,488 genes over all the samples. The standard correlation was chosen to measure the similarity, and the minimum distance to separate genes or samples was 0.001.

Statistical analysis

The Student t test was performed wherever applicable. SD of the mean is shown unless otherwise indicated.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Susceptibility of IRF-1–/– mice to chemically induced lymphoid neoplasia

We hypothesized that IRF-1, by virtue of its importance for IFN-{gamma} signaling, may be crucial for host resistance to malignant lymphoproliferative diseases. We thus conducted a series of experiments to test this hypothesis. MNU is one of the nitroso compounds that are well-known carcinogens that induce thymic lymphomas in mice (20, 21). These compounds cause neoplasia by alkylation- and/or methylation-mediated mutagenesis of nucleic acids, proteins, and lipids (22, 23).

Two groups of mice: WT (C57BL/6J) and IRF-1–/– of 4–5 wk of age, were given a single dose of MNU at the beginning, and the rate of mortality from the resulting lymphomas was monitored. As shown in Fig. 1A, only 2 of the 25 WT animals died of lymphomas within the experimental period. In contrast, 20 of 24 IRF-1–/– mice died of massive lymphoid neoplasia. Autopsy examination of the mice indicated that, compared with normal mice, IRF-1–/– mice had enlarged spleens, lymph nodes, particularly, thymuses (Fig. 1, B and C), and anemia.



View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 1. Susceptibility of IRF-l–/– mice to MNU-induced lymphoproliferative malignancy. A, A total of 25 WT and 24 IRF-1–/– mice of 4–5 wk of age were injected with a single dose of MNU (50 mg/kg). The mortality due to lymphomas was monitored for 18 wk after MNU injection. The first IRF-1–/– mouse died of lymphomas at 12 wk after MNU injection. The first WT animals died of lymphomas at 16 wk after MNU injection. B, Gross examination of lymphoid organs (spleen, inguinal lymph nodes, and thymus) showing organ enlargement in IRF-1–/– mice challenged with MNU. C, Quantification of the sizes of spleens and thymuses of the mice at the end of the experiment. The sizes are in millimeters of two dimensions (length and width) of each organ. The measurements represent mean plus SD from five to six mice. D, H&E staining of spleen sections. Spleens were taken from a WT mouse and an IRF-l–/– mouse that died from MNU-induced tumors. The tissues were fixed in 10% formalin, embedded in paraffin, and H&E stained. Some relevant structures and elements are illustrated.

 
Histopathological analyses of tissues samples (spleen, thymus, inguinal lymph nodes, liver, and kidney) taken from IRF-1–/– mice revealed highly visible malignancies in these organs. In the spleen (Fig. 1D), the normal architecture of red and white pulps was destroyed in IRF-1–/– mice with a massive spread of lymphocytes (compare D3 to D1). In addition, the splenic T lymphocytes in IRF-1–/– mice displayed the classical malignant phenotype: large numbers of giant multinucleated mitotic figures (compare D4 to D2), very similar to the lymphoma observed in the thymus (20). This pattern of destruction of the lymphoid architectures and rampant cellular proliferation and infiltration was very similar in the thymus and lymph nodes (data not shown).

Association of tumor susceptibility with strongly defective LT{beta}, IFN-{gamma}, and IL-12 gene expression

To determine the functional basis of the difference between IRF-1–/– mice in their susceptibility to MNU-induced lymphoid malignancy, we measured the mRNA expression of a number of effector cytokines important for host resistance to cancer development, such as LT{alpha}, LT{beta}, TNF-{alpha}, and IFN-{gamma}, by RPA at the endpoint of the experiment (Fig. 2A). Normal mice expressed LT{alpha}, LT{beta}, TNF-{alpha}, IFN-{gamma}, TGF-{beta}1, and macrophage migration inhibitory factor in the spleen. MNU treatment of these mice did not alter the cytokine expression pattern. In contrast, MNU-treated IRF-1–/– mice expressed much lower levels of LT{alpha}, LT{beta}, IFN-{gamma}, and somewhat lower levels of TGF-{beta}1, but higher levels of macrophage migration inhibitory factor, indicating that MNU-induced malignancy provoked an active suppression of these effector molecules in IRF-1–/– animals.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2. Association of tumor susceptibility with defective IFN-{gamma} and IL-12 expression. Analysis of mRNA expression in the spleen. Total RNA were isolated directly from the spleens of WT and IRF-1–/– mice and subjected to RPA (A) for the expression of the indicated cytokines using mCK3b (BD Pharmingen) or by RT-PCR for the expression of IL-12 p35, IL-12 p40, CD11b, and CD11c mRNA (B). L32 and GAPDH were internal loading controls in the RPA, and HPRT mRNA was measured as a loading control for RT-PCR. One representative of three separate analyses is shown. C, RT-PCR analysis of IL-12 p35 and p40 mRNA expression normalized to CD11c expression. D, IL-12 production by IRF-1–/– macrophages. IL-12 p70 was measured by ELISA from cell-free supernatants of resident mouse peritoneal macrophage cultures (0.5 x 106 cells in 1 ml) stimulated with LPS or primed with IFN-{gamma} for 16 h followed by LPS for 24 h.

 
We also determined IL-12 p40 and p35 mRNA expression in the spleens by RT-PCR because of the low numbers of IL-12-producing cells, macrophages and DCs, in the spleen (Fig. 2B). MNU treatment induced IL-12 p40 and p35 mRNA expression in WT but not IRF-1–/– mice. Curiously, IL-12 p35 mRNA was detected in IRF-1–/– mice not treated with MNU, while its expression was strongly inhibited when challenged with MNU (Fig. 2B), again suggestive of the effect of active suppression by MNU in the absence of a critical immune activator (IRF-1). Because the spleen of IRF-1–/– mice challenged with MNU was considerably larger than WT spleen, due to infiltration of large numbers of malignant T cells at the end of the 18-wk lymphoma induction, the number of APCs could be even lower, thus contributing to the decreased IL-12 expression. To determine whether this was the case, we performed RT-PCR analysis of CD11b (macrophage) and CD11c (DC) mRNA expression. As shown in Fig. 2B, both CD11b and CD11c were highly expressed in the spleen of WT mice. MNU treatment led to a significant down-regulation of their mRNA expression. However, the APCs in the spleen of WT mice were able to produce IL-12 p35 and IL-12 p40 transcripts despite diminished CD11b and CD11c expression. In IRF-1–/– mice, expression of CD11c mRNA was strongly impaired indicating an intrinsic reduction in the number of DCs in the spleen. Upon MNU challenge, CD11b and CD11c expression further declined similarly to that observed in WT spleens. Presently, it is not clear whether the MNU treatment affected the number of macrophages and DCs in the spleen, or merely the transcription of CD11b and CD11c. However, if we normalized the cDNAs on the basis of equal CD11c expression across all samples, the defective IL-12 p35 mRNA expression in IRF-1–/– mice treated with MNU was less severe, although IL-12 p40 mRNA expression remained profoundly impaired (Fig. 2C). This implies that DCs in IRF-1–/– mice, although decreased in number, are able to express the IL-12 p35 gene but not the p40 gene.

Consistent with the impairment in IL-12 p40 and p35 mRNA expression, the ability of resident peritoneal macrophages of IRF-1–/– mice to produce IL-12 p70 protein in response to in vitro stimulation with LPS and IFN-{gamma} was also reduced compared with WT mice (Fig. 2D).

Susceptibility of IL-12 p40–/–, IL-12 p35–/–, LT{beta}–/–, and IFN-{gamma} –/– mice to MNU-induced lymphoma

The severe deficiencies in the expression of IL-12 p40, IL-12 p35, IFN-{gamma}, and LT{beta} genes in IRF-1–/– mice treated with MNU prompted us to further investigate the role of each of these individual genes in host resistance against lymphoproliferative diseases. WT mice and mice genetically depleted of IRF-1, IL-12 p40, IL-12 p35, IFN-{gamma}, and LT{beta} genes individually were given the MNU treatment as described above and their survival was monitored. These genetically deficient mice were to varying degrees susceptible to mortality caused by MNU-induced lymphoma in the increasing order of IL-12 p40–/–, LT{beta}–/–, IRF-1–/–, IFN-{gamma}–/–, and IL-12 p35–/–, measured at wk 18 after MNU injection (Fig. 3A). Histopathological analyses of the spleen of these mice revealed phenotypic characteristics such as the destruction of the lymphoid architectures and presence of large numbers of malignant lymphocytes correlated with their degree of susceptibility (Fig. 3B). These results strongly point to the IRF-1/IL-12/IFN-{gamma} regulatory pathway as an essential component of host defense against malignant lymphoproliferation.



View larger version (55K):
[in this window]
[in a new window]
  		FIGURE 3. Susceptibility of genetically deficient mice to MNU-induced lymphoma development. A, The survival rate of mice after a single i.p. injection of MNU (50 mg/kg) is compared in WT (–), n = 10; IRF-1–/– (•), n = 10; IFN-{gamma}–/– ({blacktriangledown}), n = 10; IL-12 p40–/– ({circ}), n = 9; IL-12 p35–/– ({triangledown}), n = 5; and LT{beta}–/– ({diamond}), n = 5; during the 18-wk experimental period. These genetically deficient mice were to varying degrees susceptible to mortality caused by MNU-induced lymphoma in the increasing order of IL-12 p40–/– (66%), LT{beta}–/– (25%), IRF-1–/– (10%), IFN-{gamma}–/– (0%), and IL-12 p35–/– (0%), measured at wk 18 after MNU injection. B, H&E staining of spleen sections. Spleens were taken from IFN-{gamma}–/–, IL-12 p40–/–, p35–/–, and LT{beta}–/– mice that died from MNU-induced tumors. The tissues were fixed in 10% formalin, embedded in paraffin, and H&E-stained. Some relevant structures and elements are indicated.

 
IRF-1 deficiency does not affect IL-12-mediated IFN-{gamma} production

Our group has recently shown that IRF-1 is a critical transcription factor for IL-12 p35 gene expression and IL-12 p70 production (17). To further investigate the regulatory relationship of IRF-1 and IL-12 in the context of their respective role in controlling malignant lymphoproliferation, we sought to determine whether the loss of the IRF-1–/– gene had any impact on cellular response to IL-12-mediated signaling. Splenic lymphocytes were isolated from WT and IRF-1–/– mice, and stimulated in vitro with Con A with or without rmIL-12. The response to IL-12 was measured by the production of IFN-{gamma} in the culture supernatant (Fig. 4). IRF-1–/– lymphocytes were strongly impaired in their ability to produce IFN-{gamma} in response to Con A stimulation. However, this defect was largely overcome by the IL-12 treatment, indicating that the IRF-1–/– gene deletion does not affect the cell’s response to IL-12 with respect to IFN-{gamma} production.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 4. IL-12-induced IFN-{gamma} production in IRF-1–/– T lymphocytes. Splenic lymphocytes obtained by removal of adherent macrophages from WT or IRF-1–/– mice were stimulated in vitro with Con A (5 µg/ml) or Con A + rmIL-12 (2 ng/ml) for 72 h. mIL-12 p70 was measured from cell-free supernatant by ELISA. Results shown are mean plus SD of three independent experiments. UD, undetectable.

 
IL-12 is able to enhance resistance of IRF-1–/– mice to MNU-induced lymphoma

Encouraged by the observation that IFN-{gamma} production in response to IL-12 remained intact in IRF-1–/– lymphocytes, we administered rIL-12 to IRF-1–/– mice treated with MNU in an attempt to determine whether IL-12 was able to rescue these mice from MNU-induced lethality. As shown in Fig. 5A, 80% of the MNU-treated WT mice survived during the 18-wk period, whereas only 10% of the IRF-1–/– mice did. IRF-1–/– mice that received the IL-12 treatment did considerably better than those that did not receive IL-12 with a 60% survival rate. Splenic RNA from these groups of mice was analyzed for several lymphokines at the end of the experiment. Again, mRNA expression of LT{alpha}, LT{beta}, TNF-{alpha}, IFN-{gamma}, and TGF-{beta}1 were normal in WT mice treated with MNU, whereas their expression was drastically reduced in IRF-1–/– mice treated with MNU (Fig. 5B, compare lanes 2 and 5). The IL-12 treatment restored normal expression of these cytokines in some of the IRF-1–/– mice that did not develop massive lymphoma (Fig. 5B, compare lanes 6 and 3), but not in those IRF-1–/– mice that did not respond to the IL-12 treatment (lane 7). These results provide a possible mechanistic explanation for the enhanced resistance of IRF-1–/– mice to MNU-induced mortality following IL-12 treatment.



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 5. Enhanced resistance to MNU-induced lymphoma in IRF-1–/– mice treated with IL-12. A, Effects of IL-12 on survival of MNU-treated IRF-1–/– mice. IRF-1–/– (twenty) mice of 4–5 wk of age were injected with a single dose of MNU (50 mg/kg) on the first day. IL-12 treatment started on day 2 in 10 of the 20 mice, and was injected i.p. three times a week at 500 ng per mouse. The mortality due to lymphomas was monitored for 18 wk after MNU injection. B, Effects of IL-12 treatment on cytokine gene expression in IRF-1–/– mice. Total RNA was isolated from the spleens of WT and IRF-1–/– mice with or without IL-12 treatment, and subjected to RPA for the expression of the indicated cytokines using mCK3b (BD Pharmingen). Lanes 6 and 7 (*) of IRF-1–/– mice differed mainly in the efficacy of the IL-12 treatment with a better response of the former mouse than the latter. One representative of three separate analyses is shown.

 
Genome-wide analysis of IRF-1-mediated gene expression

We were interested in identifying genes that are controlled by IRF-1 in immune cells in the spleen, which may contribute to the mediation of IRF-1’s immune surveillance function. To achieve this objective, the Affymetrix oligonucleotide microarrays were used to identify mRNA expression differences in splenocytes between normal and IRF-1–/– mice challenged or not with MNU. Four experimental groups were included in this analysis: WT mice without MNU (group 1), WT mice with MNU (group 2), IRF-1–/– mice without MNU treatment (group 3), and IRF-1–/– mice with MNU-treatment (group 4). All spleen samples were taken at the end of the 18-wk experimental period.

Following appropriate normalization and standardization, the data on each chip were compared with each other using a hierarchical clustering method (Fig. 6A). It revealed two major groups of genes: those that were induced in groups 2–4 (clusters of red bars), and those that were reduced in expression (clusters of blue bars). The functional significance of this clear separation is presently unclear because they appear to be independent of both IRF-1 and MNU. However, our focus was the comparison between WT treated with MNU (group 2) and IRF-1–/– treated with MNU (group 4), one developed no lymphomas and the other did. The objective was to identify those genes that were induced by MNU treatment in the presence of IRF-1, but not in the absence of it. To verify the differential gene expression patterns revealed by the microarray analysis, five genes were selected for confirmation by semiquantitative RT-PCR: SP, pancreatic RNase (Rib-1), preproelastase II (ELA2R), carboxyl ester lipase (U37386), and RANTES. Expression of all five genes was potently induced by MNU treatment in WT mice, but not in IRF-1–/– mice (Fig. 6B, columns 1–4). Interestingly, all five genes appear expressed at similar levels to WT in IFN-{gamma}–/– and LT{beta}–/– mice treated with MNU (columns 5 and 8), suggesting that they are not regulated by IFN-{gamma} or LT{beta}. Expression of RANTES mRNA mimics closely the pattern detected by the microarray experiment. Unlike the other four genes, RANTES was also expressed in IL-12 p35–/– or p40–/– mice treated with MNU (columns 6 and 7), suggesting that it is not regulated by IL-12.



View larger version (61K):
[in this window]
[in a new window]
  		FIGURE 6. Hierarchical clustering of microarray data. A, Gene clusters. The microarray data generated in this experiment was analyzed by hierarchical clustering with all genes (12,488). The four groups are: 1) WT mice without MNU treatment serving as the baseline, 2) WT mice treated with MNU, 3) IRF-1–/– mice without MNU, and 4) IRF-1–/– mice with MNU. All data were normalized against group 1, which was set as 1. The cylinder-shaped bar on the right represents color-coded scales of mRNA expression in log2 scale. This analysis was performed using GeneSpring. B, Confirmation of differential expression of mRNA between WT and IRF-1–/– mice. The splenic RNA used in the microarray experiment was subjected to RT-PCR analysis for several genes as indicated. HPRT was used as an internal control. The amplified products were analyzed by agarose electrophoresis with appropriate size markers (M).

 
Genes induced by MNU in WT but not IRF-1–/– mice

The microarray data were further sorted based on two major criteria: 1) Only those genes that were called "present" and induced 4-fold or more in MNU-challenged WT mice over nontreated WT mice were chosen; and 2) These genes should also satisfy the condition that they show no statistically significantly greater expression in IRF-1–/– mice with or without MNU treatment than in non-MNU-treated WT mice because of our assumption that the IRF-1 deficiency should render these genes inactive regardless of experimental conditions imposed on them, if they are directly controlled by IRF-1. The statistical limit set by the program (GeneSpring) is <2-fold of change, which is considered not significant or reliably different. This stringency also required the 4-fold standard in criterion number 1 for the expression levels in WT mice challenged with MNU to be at least 2-fold higher than any of the other three groups of mice. These stringent constraints resulted in the identification of 32 genes (Table I).


View this table:
[in this window]
[in a new window]
  		Table I. Genes directly affected by IRF-1 deficiency in MNU-treated micea

 
Thirteen of the 32 genes are expressed sequence tags with unidentified functions. Most of the 19 known genes have not been previously recognized as targets of IRF-1. Many of the known targets of IRF-1 were indeed induced in MNU-challenged WT mice, but not strong enough to make this list. Consistently, IRF-1 itself is on the list, induced by MNU treatment only in WT mice, not in IRF-1–/– mice treated or not with MNU.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
It is well established that the tumor suppressor activity of IRF-1 is closely associated with that of p53 as a cell intrinsic mechanism against mutagenesis-induced neoplastic transformation. However, as a central factor in innate and adaptive immunity, the immunological anticancer properties of IRF-1 have not been adequately explored. Our study is an attempt to investigate the immunological context in which IRF-1, through its regulatory role in IL-12 and IFN-{gamma} production, confers resistance to MNU-induced tumorigenesis. The data presented in this study strongly highlights the importance of such a regulatory circuitry in host resistance to neoplastic transformation.

We show that some important cytokines such as IFN-{gamma}, LT{beta}, and IL-12 were expressed normally in WT mice treated with MNU, while IRF-1–/– mice were severely deficient in their expression (Fig. 2). This suggests that treatment with MNU induces an active suppression of normally expressed genes critical to host defense and tumor surveillance. However, IL-12 treatment of IRF-1–/– mice was able to largely restore the normal expression of these cytokines (Fig. 5B), and significantly rescue the animals from MNU-induced lethality (Fig. 5A). There is a concern why IL-12 treatment of normal mice was not able to induce more IFN-{gamma} mRNA expression. The answer is that normal mice can produce IL-12 on their own when challenged with MNU (Fig. 2B). IRF-1–/– mice cannot produce adequate amounts of IL-12 (Fig. 2C), but are able to respond to exogenous IL-12 (Fig. 4).

The present and previous work from our group, as well as from many others, provide us with an unsolved dilemma regarding the relationship between IL-12 and IFN-{gamma}. On the one hand, IL-12 is recognized as the primary stimulator of IFN-{gamma} production by NK and T cells (24) through a Stat4-dependent mechanism (25). On the other hand, IFN-{gamma} is also critical for high levels of IL-12 production (5) in an IRF-1-dependent manner (15, 16, 17). These seemingly "paradoxical" results derived from multiple studies could be reconciled by the hypothesis of the existence of an amplification loop/close circuit in the IL-12/IFN-{gamma} pathway. It could be speculated that during a microbial infection, infectious agents such as bacteria and parasites stimulate innate immune cells such as macrophages to produce the initial small amount of IL-12, which then activates NK cells to produce IFN-{gamma}. This IFN-{gamma} production then acts as a costimulatory factor for macrophages in the presence of the microbial agent to induce much larger amounts of IL-12 production via transcriptional activation of IL-12 p40 primarily by IFN consensus sequence binding protein (26), and p35 via IRF-1 (15, 16, 17), both induced by IFN-{gamma}. This second-wave large amount of IL-12 production can exert both local and systemic effects on APCs and lymphocytes in the ensuing adaptive phase of the immune response, and help sustain a Th1-response against the pathogen.

It is of interest that IL-12 p40–/– and IL-12 p35–/– mice showed significantly different propensity to MNU-induced pathogenesis in that the former is more resistant than the latter. The basis of this difference is not understood presently. p40 is a shared component of IL-12 (with p35) and IL-23 (with p19). It is conceivable that IL-12 and IL-23 may play a different role in host defense against MNU-induced lymphoma, i.e., IL-12 being protective as evidenced by the extreme susceptibility of IL-12 p35–/– mice, and IL-23 being exacerbating for the disease, resulting in an intermediate susceptibility in IL-12 p40–/– mice. Divergent roles of IL-23 and IL-12 have been reported in mycobacterial infection (27), in autoimmune inflammation of the brain (28), and in joint inflammation (29). Alternatively, IL-23 and IL-12 may target different cell types and subtypes (NK, T, macrophage, DC) (30, 31, 32), which may explain the difference in the susceptibility of IL-12 p40–/– and IL-12 p35–/– mice to MNU-induced lymphoma. This hypothesis could be tested with IL-23 p19–/– mice.

We designed the microarray experiment with the objective to identify genes whose expression is induced by MNU in an IRF-1-dependent manner in immune cells of the spleen. These genes may contribute to the mediation of IRF-1’s immune surveillance function. Identification of these genes could provide a more integrated framework where IRF-1 regulates immune responses to a developing malignancy. A very similarly designed experiment by Gerhold et al. (33) to examine alterations in gene regulation in liver induced by the PPAR{alpha} agonist Wy14643 in WT and PPAR{alpha} knockout mice identified the direct target genes of PPAR{alpha}: CD36, CPT1, CPT2, ACO, and BE, all of which are key factors in lipid uptake and lipid {beta} oxidation, indicating a central role PPAR{alpha} plays in lipid metabolism.

The list of 32 genes induced by MNU in WT but not IRF-1–/– mice includes three TCR V{beta} locus-derived mRNA expression, suggesting that IRF-1 may be required in the stimulation of the expansion of a specific subset(s) of T cells bearing a particular V{beta} chain(s) in response to MNU treatment. Many genes encode enzymes such as proteases and RNase, suggesting that IRF-1 may exert its tumor-suppressor activity by inducing these effector molecules in apoptotic killing of target cells. For example, human pancreatic RNase 1 has been used as a therapeutic toxin against hyperproliferative T lymphocytes such as T cell leukemia (34). Secreted and tumor-targeted human carboxyl esterase has been engineered to activate the anticancer prodrug irinotecan (CPT-11) for the treatment of colon cancer (35). RANTES is a member of the chemokine family of proteins, which plays an essential role in inflammation by recruiting T cells, macrophages, and eosinophils to inflammatory sites (36, 37, 38). Expression of RANTES has been shown to be synergistically induced by TNF-{alpha} and IFN-{gamma} through NF-{kappa}B and IRF-1, respectively (39), and is a predictor of survival in stage I lung adenocarcinoma (40). The induction of Bcl-2 can be rationalized by the findings by Ohteki et al. (41), who showed that endogenous Bcl-2 expression is substantially reduced in IRF-1–/–CD8+ thymocytes, and that introduction of a human Bcl-2 transgene driven by Emu or lck promoter in IRF-1–/– mice restored the defective CD8+ T cell development and function. In contrast to thymus-derived CD8+ T cells, other lymphocyte subsets including NK, NKT, and TCR{gamma}{delta} intestinal intraepithelial lymphocytes, which are also impaired in IRF-1–/– mice, were not rescued by expressing human Bcl-2. These results indicate that IRF-1 differentially regulates the development of these lymphocyte subsets and that survival signals involving Bcl-2 are critical for the development of thymus-dependent CD8+ T cells.

However, a cautionary note is that it was not possible, by this experimental design, to rule out that the differential expression patterns were due to a major difference in the type of cells present in the spleen of MNU-treated WT and IRF-1–/– mice at the time of analysis. This concern could be addressed by gene expression analysis earlier in the development of the lymphomas when there are not yet severe alterations in the lymphoid architecture and composition. In addition, a kinetic microarray-based search focusing on early time points following MNU injection could provide stronger clues about the direct targets of IRF-1, instead of secondary and tertiary events influenced by IRF-1 at later time points.

This study purports the hypothesis that the increased susceptibility of IRF-1–/– mice to MNU-induced lethal lymphoma is due, not only to a deregulated induction of apoptosis in the absence of IRF-1, but also to an altered immune-mediated regulatory circuit. We base our hypothesis on the following observations and considerations: 1) In MNU-treated IRF-1–/– mice, there were strong deficiencies in the expression of some of the immunologically important genes such as LT{alpha}{beta}, TNF-{alpha}, IFN-{gamma}, and IL-12 (Fig. 2) that were associated with their respective susceptibility to lymphoma (Fig. 3A); and 2) IL-12 treatment of MNU-challenged IRF-1–/– mice could partially rescue them from lethal lymphoma (Fig. 5A) (3). IRF-1–/– mice have strong impairment in the development and function of NK, NKT, and CTL, all of which are critical to immune surveillance against neoplastic transformation (5). It should be stressed that the immunological mechanism is in concert and concurrent with the nonimmunological mechanism mediated by IRF-1. They are not mutually exclusive.

In summary, our study provides direct evidence that IRF-1 is vitally important in immune surveillance against MNU-induced lymphoproliferative malignancy in a manner that may crucially depend on the production of IL-12, IFN-{gamma}, LT{beta}, and perhaps other unidentified factors. In other words, IRF-1 is a centrally located molecule in multiple pathways that forms the host defense against neoplastic transformation. The global gene expression analysis is the first step toward a comprehensive identification of the critical players in IRF-1-regulated networks of immune resistance.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant CA79772 to X.M. Back

2 Address correspondence and reprint requests to Dr. Xiaojing Ma, Department of Microbiology and Immunology, Weill Medical College, Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: xim2002{at}med.cornell.edu Back

3 Abbreviations used in this paper: IRF-1, IFN regulatory factor-1; DC, dendritic cells; LT, lymphotoxin; MNU, N-methyl-N-nitrosourea; rm, recombinant murine; RPA, RNase protection assay; SP, spasmolytic peptide; WT, wild type. Back

Received for publication January 13, 2004. Accepted for publication May 11, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dunn, G. P., A. T. Bruce, H. Ikeda, L. J. Old, R. D. Schreiber. 2002. Cancer immunoediting: from immunosurveillance to tumor escape. Nat. Immunol. 3:991.[Medline]
  2. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
  3. Matsuyama, T., T. Kimura, M. Kitagawa, K. Pfeffer, T. Kawakami, N. Watanabe, T. M. Kundig, R. Amakawa, K. Kishihara, A. Wakeham, et al 1993. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75:83.[Medline]
  4. Duncan, G. S., H. W. Mittrucker, D. Kagi, T. Matsuyama, T. W. Mak. 1996. The transcription factor interferon regulatory factor-1 is essential for natural killer cell function in vivo. J. Exp. Med. 184:2043.[Abstract/Free Full Text]
  5. Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki, M. Mitsuyama, E. H. Shin, S. Kojima, et al 1997. Multistage regulation of Th1-type immune responses by the transcription factor IRF-1. Immunity 6:673.[Medline]
  6. Ogasawara, K., S. Hida, N. Azimi, Y. Tagaya, T. Sato, T. Yokochi-Fukuda, T. A. Waldmann, T. Taniguchi, S. Taki. 1998. Requirement for IRF-1 in the microenvironment supporting development of natural killer cells. Nature 391:700.[Medline]
  7. Ohteki, T., H. Yoshida, T. Matsuyama, G. S. Duncan, T. W. Mak, P. S. Ohashi. 1998. The transcription factor interferon regulatory factor 1 (IRF-1) is important during the maturation of natural killer 1.1+ T cell receptor-{alpha}/{beta}+ (NK1+ T) cells, natural killer cells, and intestinal intraepithelial T cells. J. Exp. Med. 187:967.[Abstract/Free Full Text]
  8. Lohoff, M., G. S. Duncan, D. Ferrick, H. W. Mittrucker, S. Bischof, S. Prechtl, M. Rollinghoff, E. Schmitt, A. Pahl, T. W. Mak. 2000. Deficiency in the transcription factor interferon regulatory factor (IRF)-2 leads to severely compromised development of natural killer and T helper type 1 cells. J. Exp. Med. 192:325.[Abstract/Free Full Text]
  9. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  10. Brunda, M. J., L. Luistro, R. R. Warrier, R. B. Wright, B. R. Hubbard, M. Murphy, S. F. Wolf, M. K. Gately. 1993. Antitumor and antimetastatic activity of interleukin 12 against murine tumors. J. Exp. Med. 178:1223.[Abstract/Free Full Text]
  11. Cavallo, F., E. Di Carlo, M. Butera, R. Verrua, M. P. Colombo, P. Musiani, G. Forni. 1999. Immune events associated with the cure of established tumors and spontaneous metastases by local and systemic interleukin 12. Cancer Res. 59:414.[Abstract/Free Full Text]
  12. Noguchi, Y., A. Jungbluth, E. C. Richards, L. J. Old. 1996. Effect of interleukin 12 on tumor induction by 3-methylcholanthrene. Proc. Natl. Acad. Sci. USA 93:11798.[Abstract/Free Full Text]
  13. Boggio, K., G. Nicoletti, E. Di Carlo, F. Cavallo, L. Landuzzi, C. Melani, M. Giovarelli, I. Rossi, P. Nanni, C. De Giovanni, et al 1998. Interleukin 12-mediated prevention of spontaneous mammary adenocarcinomas in two lines of Her-2/neu transgenic mice. J. Exp. Med. 188:589.[Abstract/Free Full Text]
  14. Coughlin, C. M., K. E. Salhany, M. S. Gee, D. C. LaTemple, S. Kotenko, X. Ma, G. Gri, M. Wysocka, J. E. Kim, L. Liu, et al 1998. Tumor cell responses to IFN{gamma} affect tumorigenicity and response to IL-12 therapy and antiangiogenesis. Immunity 9:25.[Medline]
  15. Maruyama, S., K. Sumita, H. Shen, M. Kanoh, X. Xu, M. Sato, M. Matsumoto, H. Shinomiya, Y. Asano. 2003. Identification of IFN regulatory factor-1 binding site in IL-12 p40 gene promoter. J. Immunol. 170:997.[Abstract/Free Full Text]
  16. Kollet, J., C. Witek, J. D. Gentry, X. Liu, S. D. Schwartzbach, T. M. Petro. 2001. Deletional analysis of the murine IL-12 p35 promoter comparing IFN-{gamma} and lipopolysaccharide stimulation. J. Immunol. 167:5653.[Abstract/Free Full Text]
  17. Liu, J., S. Cao, L. M. Herman, X. Ma. 2003. Differential regulation of interleukin (IL)-12 p35 and p40 gene expression and interferon (IFN)-{gamma}-primed IL-12 production by IFN regulatory factor 1. J. Exp. Med. 198:1265.[Abstract/Free Full Text]
  18. Galon, J., C. Sudarshan, S. Ito, D. Finbloom, J. J. O’Shea. 1999. IL-12 induces IFN regulating factor-1 (IRF-1) gene expression in human NK and T cells. J. Immunol. 162:7256.[Abstract/Free Full Text]
  19. Eisen, M. B., P. T. Spellman, P. O. Brown, D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95:14863.[Abstract/Free Full Text]
  20. Joshi, V. V., J. V. Frei. 1970. Effects of dose and schedule of methylnitrosourea on incidence of malignant lymphoma in adult female mice. J. Natl. Cancer Inst. 45:335.
  21. Frei, J. V.. 1980. Methylnitrosourea induction of thymomas in AKR mice requires one or two "hits" only. Carcinogenesis 1:721.[Abstract/Free Full Text]
  22. Magee, P. N., J. M. Barnes. 1967. Carcinogenic nitroso compounds. A. Haddow, and S. Weinhouse, eds. In Advances in Cancer Research Vol. 10:163. Academic, New York.
  23. Dumenco, L. L., E. Allay, K. Norton, S. L. Gerson. 1993. The prevention of thymic lymphomas in transgenic mice by human O6-alkylguanine-DNA alkyltransferase. Science 259:219.[Abstract/Free Full Text]
  24. Mattner, F., J. Magram, J. Ferrante, P. Launois, K. Di Padova, R. Behin, M. K. Gately, J. A. Louis, G. Alber. 1996. Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response. Eur. J. Immunol. 26:1553.[Medline]
  25. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  26. Wang, I. M., C. Contursi, A. Masumi, X. Ma, G. Trinchieri, K. Ozato. 2000. An IFN-{gamma}-inducible transcription factor, IFN consensus sequence binding protein (ICSBP), stimulates IL-12 p40 expression in macrophages. J. Immunol. 165:271.[Abstract/Free Full Text]
  27. Holscher, C., R. A. Atkinson, B. Arendse, N. Brown, E. Myburgh, G. Alber, F. Brombacher. 2001. A protective and agonistic function of IL-12p40 in mycobacterial infection. J. Immunol. 167:6957.[Abstract/Free Full Text]
  28. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421:744.[Medline]
  29. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua. 2003. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med. 198:1951.[Abstract/Free Full Text]
  30. Lo, C. H., S. C. Lee, P. Y. Wu, W. Y. Pan, J. Su, C. W. Cheng, S. R. Roffler, B. L. Chiang, C. N. Lee, C. W. Wu, M. H. Tao. 2003. Antitumor and antimetastatic activity of IL-23. J. Immunol. 171:600.[Abstract/Free Full Text]
  31. Aggarwal, S., N. Ghilardi, M. H. Xie, F. J. de Sauvage, A. L. Gurney. 2003. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J. Biol. Chem. 278:1910.[Abstract/Free Full Text]
  32. Belladonna, M. L., J. C. Renauld, R. Bianchi, C. Vacca, F. Fallarino, C. Orabona, M. C. Fioretti, U. Grohmann, P. Puccetti. 2002. IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells. J. Immunol. 168:5448.[Abstract/Free Full Text]
  33. Gerhold, D. L., R. V. Jensen, S. R. Gullans. 2002. Better therapeutics through microarrays. Nat. Genet. 32:(Suppl):547.
  34. Psarras, K., M. Ueda, M. Tanabe, M. Kitajima, S. Aiso, S. Komatsu, M. Seno. 2000. Targeting activated lymphocytes with an entirely human immunotoxin analogue: human pancreatic RNase1-human IL-2 fusion. Cytokine 12:786.[Medline]
  35. Oosterhoff, D., H. M. Pinedo, I. H. van der Meulen, M. de Graaf, T. Sone, F. A. Kruyt, V. W. van Beusechem, H. J. Haisma, W. R. Gerritsen. 2002. Secreted and tumour targeted human carboxylesterase for activation of irinotecan. Br. J. Cancer. 87:659.[Medline]
  36. Schall, T. J., K. Bacon, K. J. Toy, D. V. Goeddel. 1990. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 347:669.[Medline]
  37. Rot, A., M. Krieger, T. Brunner, S. C. Bischoff, T. J. Schall, C. A. Dahinden. 1992. RANTES and macrophage inflammatory protein 1{alpha} induce the migration and activation of normal human eosinophil granulocytes. J. Exp. Med. 176:1489.[Abstract/Free Full Text]
  38. Meurer, R., G. Van Riper, W. Feeney, P. Cunningham, D. Hora, Jr, M. S. Springer, D. E. MacIntyre, H. Rosen. 1993. Formation of eosinophilic and monocytic intradermal inflammatory sites in the dog by injection of human RANTES but not human monocyte chemoattractant protein 1, human macrophage inflammatory protein 1{alpha}, or human interleukin 8. J. Exp. Med. 178:1913.[Abstract/Free Full Text]
  39. Lee, A. H., J. H. Hong, Y. S. Seo. 2000. Tumour necrosis factor-{alpha} and interferon-{gamma} synergistically activate the RANTES promoter through nuclear factor {kappa}B and interferon regulatory factor 1 (IRF-1) transcription factors. Biochem. J. 350:(Pt. 1):131.
  40. Moran, C. J., D. A. Arenberg, C. C. Huang, T. J. Giordano, D. G. Thomas, D. E. Misek, G. Chen, M. D. Iannettoni, M. B. Orringer, S. Hanash, D. G. Beer. 2002. RANTES expression is a predictor of survival in stage I lung adenocarcinoma. Clin. Cancer Res. 8:3803.[Abstract/Free Full Text]
  41. Ohteki, T., C. Maki, S. Koyasu. 2001. Overexpression of Bcl-2 differentially restores development of thymus-derived CD4–8+ T cells and intestinal intraepithelial T cells in IFN-regulatory factor-1-deficient mice. J. Immunol. 166:6509.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
K. D. McCall, N. Harii, C. J. Lewis, R. Malgor, W. Bae Kim, M. Saji, A. D. Kohn, R. T. Moon, and L. D. Kohn
High Basal Levels of Functional Toll-Like Receptor 3 (TLR3) and Noncanonical Wnt5a Are Expressed in Papillary Thyroid Cancer and Are Coordinately Decreased by Phenylmethimazole Together with Cell Proliferation and Migration
Endocrinology, September 1, 2007; 148(9): 4226 - 4237.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
X.-c. Chen, R. Wang, X. Zhao, Y.-q. Wei, M. Hu, Y.-s. Wang, X.-w. Zhang, R. Zhang, L. Zhang, B. Yao, et al.
Prophylaxis against carcinogenesis in three kinds of unestablished tumor models via IL12-gene-engineered MSCs
Carcinogenesis, December 1, 2006; 27(12): 2434 - 2441.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Goriely, C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit, V. Flamand, F. Willems, and M. Goldman
Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 gene activation
Blood, February 1, 2006; 107(3): 1078 - 1084.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Liu, X. Guan, and X. Ma
Interferon Regulatory Factor 1 Is an Essential and Direct Transcriptional Activator for Interferon {gamma}-induced RANTES/CCl5 Expression in Macrophages
J. Biol. Chem., July 1, 2005; 280(26): 24347 - 24355.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.
Right arrow Articles by Ma, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.
Right arrow Articles by Ma, X.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS