The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haro, T.
Right arrow Articles by Harada, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haro, T.
Right arrow Articles by Harada, M.
The Journal of Immunology, 2004, 173: 1151-1157.
Copyright © 2004 by The American Association of Immunologists

Tyrosine Kinase 2 Interacts with and Phosphorylates Receptor for Activated C Kinase-1, a WD Motif-Containing Protein1

Takashi Haro*, Kazuya Shimoda2,*, Haruko Kakumitsu*, Kenjirou Kamezaki*, Akihiko Numata*, Fumihiko Ishikawa*, Yuichi Sekine{dagger}, Ryuta Muromoto{dagger}, Tadashi Matsuda{dagger} and Mine Harada*

* First Department of Internal Medicine, Faculty of Medicine, and Medicine and Biosystemic Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan; and {dagger} Department of Immunology, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Receptor for activated C kinase (Rack)-1 is a protein kinase C-interacting protein, and contains a WD repeat but has no enzymatic activity. In addition to protein kinase C, Rack-1 also binds to Src, phospholipase C{gamma}, and ras-GTPase-activating proteins. Thus, Rack-1 is thought to function as a scaffold protein that recruits specific signaling elements. In a cytokine signaling cascade, Rack-1 has been reported to interact with the IFN-{alpha}{beta} receptor and Stat1. In addition, we show here that Rack-1 associates with a member of Jak, tyrosine kinase 2 (Tyk2). Rack-1 interacts weakly with the kinase domain and interacts strongly with the pseudokinase domain of Tyk2. Rack-1 associates with Tyk2 via two regions, one in the N terminus and one in the middle portion (aa 138–203) of Rack-1. Jak activation causes the phosphorylation of tyrosine 194 on Rack-1. After phosphorylation, Rack-1 is translocated toward the perinuclear region. In addition to functioning as a scaffolding protein, these results raise the possibility that Rack-1 functions as a signaling molecule in cytokine signaling cascades.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Many cytokines bind to specific cell surface receptors and activate members of the Janus family of protein tyrosine kinases (Jaks), which are associated with cytokine receptors (1). The activated Jaks phosphorylate the tyrosine residues of the receptors, thereby recruiting Stats and other signaling molecules into the activated receptor complex. Stats are then phosphorylated by Jaks, and are subsequently translocated to the nucleus, where they affect gene expression. This Jak-Stat signaling pathway is widely used by members of the cytokine receptor super family (2). There are four mammalian Jaks: Jak1, Jak2, Jak3, and tyrosine kinase 2 (Tyk2). 3 Tyk2 has been identified as a novel protein kinase which can compensate for IFN-{alpha} nonresponsive mutated fibroblasts (3). IFN-{alpha} specifically activates Jak1 and Tyk2, which phosphorylate Stat 1 and 2. These activated Stats subsequently associate to form either Stat1 homodimers or the transcription factor ISGF-3, which then translocate to the nucleus to regulate gene expression (2, 4). Both Tyk2 and Jak1 were thought to be essential for signal transduction downstream of IFN-{alpha} in mutated fibroblasts, which are not responsive to IFN-{alpha} (4). However, using Tyk2-deficient mice, we and others have shown that Tyk2 has a restricted function and does not play a major role in IFN-{alpha} signaling (5, 6). In contrast, Jak 1-null cells fail to respond to IFN-{alpha} (7). In addition, Stat1-null mice are defective in almost all IFN-{alpha}-induced responses (8, 9). Stat2-null mice also demonstrated an increased susceptibility to viral infection (10). Based on these data, the Jak1-Stat signaling pathway is thought to be essential for IFN-{alpha} signaling. Recently, we reported that Tyk2 was essential for IFN-{alpha}-induced B lymphocyte growth inhibition (11). Stat1 is not required for this IFN-{alpha}-mediated inhibition (12); therefore, other signaling molecules must exist downstream of activated Tyk2 to transduce the IFN-{alpha} signal inhibiting B lymphocyte growth. Thus, we performed a yeast two-hybrid screen for proteins that interact with Tyk2.

In this report, we identify receptor for activated C kinase (Rack)-1, originally described as a receptor for activated C kinase {beta}, as a protein that interacts with Tyk2. Rack-1 has previously been reported to constitutively interact with the {beta} long subunit of the type I IFNR (13), Jak1, Tyk2 (14), and Stat1 (15). We show here that Rack-1 associates with Jaks, and is phosphorylated on tyrosine residues by Jaks. This raises the possibility that Rack-1 functions as a signaling molecule in cytokine signaling cascades.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Abs and reagents

Anti-Rack-1, -Tyk2, -Jak1, -Jak2, and -Jak3 Abs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphotyrosine mAb (clone 4G10) was purchased from Upstate Biotechnology (Lake Placid, NY). Anti-c-Myc mAb was purchased from BD Clontech (Palo Alto, CA). Anti-Flag M2 mAb was purchased from Sigma-Aldrich (St. Louis, MO). Murine IFN-{alpha} was purchased from HyCult Biotechnology (Uden, The Netherlands).

Yeast two-hybrid screen

A cDNA encoding the kinase domain (aa 833-1187) of human Tyk2 was subcloned into the Gal DNA-binding domain plasmid pGBKT7 (BD Clontech), and was used as bait in a yeast two-hybrid screen of a human B lymphocyte cDNA library constructed in pACT (BD Clontech). Approximately 1.6 x 106 colonies were screened for activation of the ADE2, HIS3, and lacZ reporter genes using the host strain AH109. The inserts from positive library plasmids were then amplified by PCR and mapped by AluI digestion. Plasmids were sequenced after isolation and bacterial transformation.

Mammalian expression vector constructs

Murine Jak1, Jak2, Jak3, and human Tyk2 expression constructs were gifts from Dr. J. Ihle (St. Jude Children’s Research Hospital, Memphis, TN). Kinase-negative versions of the Jak proteins were generated by mutating lysine (K833) to glutamine in murine Jak1 (Jak1 KE) and lysine (K882) to glutamine in murine Jak2 (Jak2 KE) (16).

The partial human Tyk2 cDNAs expressing the various domains (aa 1–450, 266–733, 600–1086, or 833–1187) indicated in Fig. 3A were generated by PCR, and were subcloned into pCMV-MyC (BD Clontech). The clone 4-86 cDNA (C-terminal region of Rack-1 encoding aa 137–317), whose gene product associated with Tyk2 (aa 833–1187) in yeast, was removed from pACT2 by SfiI/XhoI digest, and was subcloned into pCMV-HA (BD Clontech). The full-length human Rack-1 cDNA was generated by RT-PCR from human peripheral blood lymphocytes, and was subcloned into pCR2.1-TOPO (Invitrogen Life Technologies, Carlsbad, CA). HindIII-ApaI, XhoI, BamHI-EcoRI, BglII-EcoRI, and BamHI fragments of the full-length Rack-1 were subcloned into the Flag-tagged mammalian expression plasmid pCMV-Tag2 (BD Clontech) to generate Rack-1 (aa 1–317), (aa125–317), (aa 204–317), (aa 258–317), and (aa 1–204) indicated in Fig. 3C. Rack-1 (1–137) was generated by PCR using Rack-1 in pCR2.1-TOPO as the template, and was subcloned into the BamHI site in pCMV-Tag2. Rack-1 ({Delta}138–203) was generated by ligation of the aa 1–137 fragment to the 204–317 fragment in pCMV-Tag2.



View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 3. Mapping the sites in Tyk2 and Rack-1 required for binding. A, A schematic of the domain structure of Tyk2 and the mutant fragments. B, Full-length Tyk2 or Myc-tagged Tyk2 mutants were coexpressed with Flag-tagged Rack-1 in 293T cells. Forty-eight hours after transfection, the cells were lysed and immunoprecipitations were performed with anti-Tyk2 or anti-Myc Ab. The immunoprecipitates were immunoblotted with anti-Flag Ab (upper panel), anti-Tyk2 Ab (middle panel), or anti-Myc Ab (lower panel). C, A schematic of the domain structure of Rack-1 and the mutant fragments. D, Rack-1 mutants were coexpressed with Tyk2 in 293T cells. Forty-eight hours after transfection, the cells were lysed and immunoprecipitations were performed with anti-Tyk2 Ab. The immunoprecipitates were immunoblotted with anti-Flag Ab (upper panel) or anti-Tyk2 Ab (lower panel).

 
Oligonucleotide-directed mutagenesis was used to substitute phenylalanine for tyrosine at residues 140, 194, 228, and 246 of wild-type Rack1 in pCMV-Tag2. The Transformer site-directed mutagenesis kit was used according to the manufacturer’s protocol (BD Clontech) with the following oligonucleotides: Y140F oligo, GGTGTGTGCAAATTCACTGTCCAG; Y194F oligo, CACACAGGCTTTCTGAACACGGTG; Y228F oligo, GGCAAACACCTTTTCACGCTAGAT; Y246F oligo, CCTAACCGCTTCTGGCTGTGTGCT.

Cell culture and transfection

HEK293T cells were plated at 2–4 x 106 cells/ml in DMEM (Sigma-Aldrich) containing 10% heat-inactivated FBS (JRH Biosciences, Lenexa, KS), 2 mM L-glutamine (Invitrogen Life Technologies, Gaithersburg, MD), MEM nonessential amino acids (Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen Life Technologies), 100 U/ml penicillin, and 10 µg/ml streptomycin (Invitrogen Life Technologies), and grown at 37°C in 5% CO2 to 60% confluence. 293T cells were transfected with 10 µg of plasmid DNA using the calcium phosphate precipitation protocol. Cells were cultured to almost 100% confluence and harvested, after appropriate stimulation.

The IL-3-dependent cell line, BAF/3, was maintained in RPMI 1640 medium supplemented with 10% FCS and IL-3.

Immunoprecipitation and immunoblotting

Cells were lysed as previously described (16). Cell lysates were centrifuged at 12,000 x g for 15 min to remove debris. For immunoprecipitation, the indicated Abs were added to the supernatant of each sample, incubated for 8 h, and mixed with protein A-agarose (Sigma-Aldrich). Total cell lysates or immunoprecipitated proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes (Amersham Biosciences, Uppsala, Sweden). Membranes were probed using the appropriate Abs and visualized by ECL (Amersham Biosciences).

Immunofluorescence

HEK293T cells were maintained in DMEM containing 10% FCS and transfected with Flag-tagged wild-type or E mutant Rack-1 with or without Tyk2, Jak1, Jak2, the Jak1 KE mutant, or the Jak2 KE mutant by the calcium phosphate precipitation protocol. Forty-eight hours after transfection, cells were fixed with a solution containing 4% paraformaldehyde and incubated with an anti-Flag Ab. The cells were then incubated with a FITC-conjugated anti-mouse IgG Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) and mounted with a drop of Vectashield mounting medium (Vector Laboratories, Burlingame, CA). Cells were observed using a confocal laser fluorescence microscope. The intracellular localization of labeled Rack-1 was assessed in reference to nuclear 4'6'-diamidine-2-phenylindole dihydrochloride (DAPI) staining. The digital images were processed by layering and the contrast of all images was increased by 50% using Adobe Photoshop 4.0 (Adobe Systems, Mountain View, CA). Nuclear DAPI staining appears blue and Rack-1 appears green.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Identification of Rack-1 as a Tyk2-interacting protein

To identify novel Tyk2-interacting proteins, a yeast two-hybrid screen was performed using the kinase domain of Tyk2 fused to the Gal DNA-binding domain as bait. A human bone marrow cell cDNA library was screened. Among a number of positive clones, three clones termed 4-6, 4-86, and 4-160, encoded the C-terminal portion of the previously described Rack-1 (Fig. 1A). To determine whether these clones encoded a protein able to interact with Tyk2 in mammalian cells, clone 4-86 was subcloned into the mammalian expression vector pCMV-HA. The resulting expression vector produced a protein that interacted strongly with Tyk2 in 293T cells (Fig. 1B), suggesting that the region comprising aa 137–317 of Rack-1 contains the binding site for Tyk2.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. Rack-1 interacts with Tyk2. A, A schematic representation of the Rack-1 protein identified by yeast two-hybrid screen using the Tyk2 tyrosine kinase domain as bait. Amino acids 137–317 of Rack-1 were present in three clones which interacted with Tyk2 in yeast cells. B, Coimmunoprecipitation of clone 4-86 with Tyk2 in mammalian 293T cells. 293T cells were transfected with clone 4-86 and/or Tyk2. Cell lysates were immunoprecipitated with anti-Tyk2 Ab, and immunoblotted with anti-Rack-1 Ab.

 
We next examined the association between Tyk2 and Rack-1 using the full-length cDNA in mammalian cells. The full-length Flag tagged Rack-1 cDNA was transiently transfected into 293T cells with or without the full-length Tyk2 expression vector. Fig. 2A shows that Tyk2 coimmunoprecipitated with Rack-1 and Rack-1 coimmunoprecipitated with Tyk2 when both Tyk2 and Rack-1 were expressed in 293T cells. We next investigated whether endogenous Rack-1 was able to interact with Tyk2 and how this might be affected by the activation of Tyk2. To activate Tyk2, a mouse pro-B cell line, BAF/3, was stimulated or not stimulated with IFN-{alpha}. Tyk2 immunoprecipitates were assessed for the presence of endogenous Rack-1 by Western blotting. As can be seen in Fig. 2B, Tyk2 was present in the Rack-1 immunoprecipitates. Furthermore, equivalent amounts of Tyk2 were present in samples which had or had not been stimulated with IFN-{alpha}. This indicates that Rack-1 associates with Tyk2 in BAF/3 cells, and that this interaction is not altered by stimulation with IFN-{alpha}.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 2. The physical interaction between Rack-1 and Tyk2 is independent of IFN stimulation. A, 293T cells were transfected with Tyk2 and/or Rack-1. Top, Cell lysates were immunoprecipitated with anti-Rack-1 Ab and immunoblotted with anti-Tyk2 (upper panel) or anti-Rack-1 Ab (lower panel). Open arrow indicates transfected Rack-1, and the filled arrow indicates endogenous Rack-1. Bottom, Cell lysates were immunoprecipitated with anti-Tyk2 Ab and immunoblotted with anti-Rack-1 Ab (upper panel) or anti-Tyk2 Ab (lower panel). B, BAF/3 cells were either stimulated for the indicated time with IFN-{alpha} (1000 U/ml) or left unstimulated as a control. Cell lysates were immunoprecipitated with nonspecific mouse IgG or anti-Rack-1 Ab and immunoblotted with anti-Tyk2 Ab (upper panel) or anti-Rack-1 Ab (lower panel).

 
Mapping the sites in Tyk2 and Rack-1 required for binding

We next sought to determine which region of Tyk2 was responsible for the interaction with Rack-1. We separated the Tyk2 cDNA into four regions (Fig. 3A), and each region was subcloned in frame with a myc tag in the mammalian expression vector pCMV-Myc. The full-length Tyk2 construct or each partial Tyk2 construct was transiently transfected into 293T cells along with the full-length Rack-1 construct. Cell lysates were immunoprecipitated with anti-Tyk2 or anti-Myc Ab, and Western blotted with anti-flag Ab. Fig. 3B shows that Rack-1 interacted with Tyk2 (266–733) and Tyk2 (600–1086) as well as full-length Tyk2. In addition, Rack-1 interacted weakly with Tyk2 (833–1187), which contains the kinase domain of Tyk2. As Rack-1 did not interact with Tyk2 (1–450), these data indicate that Rack-1 interacts weakly with the kinase domain of Tyk2 and interacts strongly with the pseudokinase domain of Tyk2. Furthermore, as there is no overlapping region in Tyk2 (266–733) and Tyk2 (833–1187), there is the possibility that multiple RACK-1 binding sites exist in Tyk2.

We next determined the region of Rack-1 required for the interaction with Tyk2. Fig. 3C shows the full-length and deletion mutants of Rack-1 used in this experiment. As shown in Fig. 3D, full-length Rack-1 (1–317), Rack-1 (125–317), and Rack-1 (1–204) bound to Tyk2. The C-terminal region of Rack-1 (aa 204–317) did not associate with Tyk2. Taken together with the fact that the two-hybrid candidate clone 4-86 encodes aa 137–317 of Rack-1, these data suggest that the middle portion of Rack-1, aa 137–203, may associate with Tyk2. We next examined the binding of Rack-1 {Delta} 138–203, which lacks aa 138–203, to Tyk2. Unexpectedly, Rack-1 {Delta} 138–203 also binds to Tyk2 (Fig. 3D). This indicates that two regions of Rack-1, the N terminus and the middle portion, might bind to Tyk2. This was confirmed by the fact that Rack-1 (1–137) binds to Tyk2 (Fig. 3D).

Rack-1 is phosphorylated on Tyr194, a residue in the fifth WD repeat, by Jaks

As Tyk2 is a tyrosine kinase, we assessed whether Rack-1 could be phosphorylated by Tyk2. When Rack-1 was transiently cotransfected into 293T cells with Tyk2, Rack-1 was phosphorylated by Tyk2 (Fig. 4A). There are six tyrosine residues in Rack-1; to identify the specific tyrosine residue(s) that is phosphorylated by Tyk2 in vivo, we performed site-directed mutagenesis, substituting phenylalanine for tyrosine at individual and multiple sites in Rack-1 (Fig. 4B). The Rack-1 mutants were then transiently coexpressed with Tyk2 in 293T cells, and proteins were immunoprecipitated with anti-Rack-1 and subjected to immunoblot analysis with anti-phosphotyrosine (Fig. 4C). We found that the Rack-1 mutants containing phenylalanine at position 194 (the E, F, H, and I mutants) were not phosphorylated by Tyk2. Because the Rack-1 E mutant is a single substitution of tyrosine 194 to phenylalanine and this mutant is not phosphorylated, Tyk2 must phosphorylate Rack-1 on Tyr194. In addition, the immunoprecipitates of all Rack-1 mutants contained phosphorylated Tyk2, indicating that the tyrosine phosphorylation of Rack-1 has no influence on the association of Rack-1 and Tyk2. This result was confirmed by the transient transfection of wild type or the E mutant of Rack-1 with or without Tyk2 in 293T cells. Proteins were immunoprecipitated with Tyk2 or Rack-1. The results shown in Fig. 5 demonstrate that Rack-1 was present in the Tyk2 immunoprecipitates at equivalent levels whether aa 194 of Rack-1 was tyrosine or phenylalanine. In addition, Tyk2 was present in the Rack-1 immunoprecipitates at equivalent amounts. Taken together, these results demonstrate that phosphorylation of tyrosine 194 of Rack-1 is not important for the interaction of Rack-1 and Tyk2.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 4. Tyk2 phosphorylates Rack-1 on Tyr194, a residue in the fifth WD repeat. A, Rack-1 is phosphorylated by Tyk2. Tyk2 and/or Flag-tagged Rack-1 were expressed in 293T cells. Total cell lysates were immunoprecipitated with anti-Flag Ab and immunoblotted with anti-phospho tyrosine Ab (upper panel) or anti-Flag Ab (lower panel). B, Site-directed mutagenesis of Rack-1 was performed to substitute phenylalanine for tyrosine at individual and multiple sites. C, Tyk2 phosphorylates Rack-1 on Tyr194, a residue in the fifth WD repeat. 293T cells were transfected with a series of wild-type or Rack-1 mutants. Forty-eight hours after transfection, cells were lysed, immunoprecipitated with anti-Rack-1 Ab, and immunoblotted with anti-phosphotyrosine Ab (upper panel) or anti-Rack-1 Ab (lower panel). The arrows indicate tyrosine phosphorylated Rack-1 and Tyk2 which coimmunoprecipitates with Rack-1.

 


View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. Tyrosine phosphorylation of Rack-1 has no influence on the association between Rack-1 and Tyk2. Empty vector (pCMV-Tag2A), wild-type Rack-1, or the Rack-1 E mutant (Y194F) were coexpressed with Tyk2 in 293T cells. Total cell lysates were immunoprecipitated with anti-Tyk2 Ab (left panel) or anti-Rack-1 Ab (right panel) and immunoblotted with anti-Tyk2 Ab (upper panel) or anti-Rack-1 Ab (lower panel).

 
We next examined whether other Jaks could phosphorylate Rack-1. In addition to Tyk2, Jak1, Jak2, and Jak3 were able to phosphorylate Rack-1 (Fig. 6). We also transfected kinase-dead Jak1 or Jak2 (KE mutant) with Rack-1 into 293T cells (Fig. 6, lane 3 and 5). In this case, Rack-1 was not phosphorylated, although Rack-1 associated with Jak1KE and Jak2KE. This indicates that Jaks directly phosphorylate Rack-1. Furthermore, none of the Jak family kinases phosphorylated the Rack-1 E mutant (Fig. 6, right), indicating that all Jaks phosphorylate Rack-1 on a single tyrosine, residue 194. Notably, immunoprecipitates containing the Rack-1 E mutant contained Jak1, Jak2, Jak3, and Tyk2. Therefore, Jaks associate with Rack-1 whether Rack-1 is tyrosine phosphorylated or not.



View larger version (90K):
[in this window]
[in a new window]
  		FIGURE 6. In addition to Tyk2, Jak1, Jak2, and Jak3 phosphorylate tyrosine 194 on Rack-1. Wild-type or the Rack-1 E mutant (Y194F) were coexpressed with either Jak1, the Jak1 KE mutant, Jak2, the Jak2 KE mutant, Jak3, or Tyk2 in 293T cells. Total cell lysates were immunoprecipitated with anti-Rack-1 Ab and immunoblotted with anti-phosphotyrosine Ab, anti-Rack-1 Ab, or anti-Jak Abs (mixture or individual anti-Jak1, anti-Jak2, and anti-Tyk2 Abs) as indicated.

 
Perinuclear translocation of Rack-1 by Jaks

293T cells were used to localize the distribution of Rack-1 within cells with or without the activation of Jaks (Fig. 7A). When Rack-1 was transfected into 293T cells, it was detected throughout the cytoplasm. When both Rack-1 and Tyk2 were transfected into 293T cells, intracellular redistribution of Rack-1 toward the perinuclear area was observed. The transfection of Jak1 or Jak2 with Rack-1 in 293T cells also induced the perinuclear translocation of Rack-1. To determine whether the perinuclear translocation of Rack-1 was induced by Jaks, we transfected the Jak1 KE mutant or the Jak2 KE mutant with Rack-1 in 293T cells. Under these conditions, Rack-1 was detected throughout the cytoplasm, and was not translocated to the perinuclear region. Next, we examined whether perinuclear translocation of Rack-1 required the phosphorylation of Rack-1. When the Rack-1 E mutant (Y194F) was transfected with Tyk2 into 293T cells, perinuclear translocation of the Rack-1 E mutant was observed to the same extent as Rack-1 wild type (Fig. 7B).



View larger version (74K):
[in this window]
[in a new window]
  		FIGURE 7. Localization of Rack-1. A, Flag-tagged Rack-1 (wild type or E mutant) was expressed either alone or in combination with one of Tyk2, Jak1, the Jak1 KE mutant, Jak2, or the Jak2 KE mutant in 293T cells. After 48 h, the localization of tagged proteins was visualized by confocal microscopy. B, The number of cells showing perinuclear localization of Rack-1 was calculated. Data represent the mean with SD of four different experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The main substrates of Jaks are the Stats, and the phosphorylation of Stats is essential for the biological activities of cytokines (2). Analysis of Stat-deficient mice has demonstrated that Stats transduce almost all cytokine signaling (17). In the case of inhibition of IL-7-induced B cell growth by IFN-{alpha}, Stat1 activation was not required (12), although we found that Tyk2 activation was necessary (11). To find Tyk2-activated signaling molecules other than the Stats, we performed a yeast two-hybrid screen for proteins that associated with Tyk2. We found that Rack-1, which was originally described as a receptor for activated protein kinase C (PKC)-{beta} (18), associated with Tyk2 (Fig. 1). Interestingly, it has recently been reported that Rack-1 associates with the {beta}-chain of the type I IFNR and recruits Stat1 to the receptor complex. This raises the possibility that Rack-1 serves as a scaffolding protein during cytokine signal transduction. We have shown here that Tyk2 associates with Rack-1 in 293 T cells and BAF/3 cells (Fig. 2). This association was not altered by stimulation with IFN-{alpha} (Fig. 2B). Recently, Usacheva et al. (14) reported that Tyk2 and Jak1 associated with Rack-1 using GST-fusion proteins. Consistent with our result, they also reported that association of Jak1 and Rack-1 was not affected by IFN-{beta} treatment. Additionally, we have determined the binding sites on Tyk2 and Rack-1. Tyk2 binds strongly to Rack-1 through the kinase domain, and binds weakly through the pseudokinase domain (Fig. 3B). Therefore, Tyk2 probably associates with Rack-1 through more than one binding site. Similarly, Rack-1 binds to Tyk2 through two regions, one in the N terminus and one in the middle portion of the protein (aa 137–203) (Fig. 3D).

As Tyk2 is a tyrosine kinase, we next analyzed whether Rack-1 could serve as a substrate of Tyk2. When Tyk2 and Rack-1 were transiently transfected into 293T cells, Rack-1 was phosphorylated by Tyk2 (Fig. 4A). In addition to Tyk2, other members of the Jak family (Jak1, Jak2, and Jak3) phosphorylated Rack-1 (Fig. 6). Kinase-dead Jaks (Jak1 KE or Jak2 KE mutants) were unable to phosphorylate Rack-1, suggesting that Jaks directly phosphorylate Rack-1.

When cells are stimulated by PMA, PKC is activated and Src phosphorylates Rack-1 on Tyr228 and/or Tyr246 (19). Therefore, we wanted to determine whether the site of Tyk2 phosphorylation was the same as the site of Src phosphorylation. We demonstrated that the A (Y-228-F), B (Y-246-F), and C (Y-228, 246-F) mutants of Rack-1 were phosphorylated by Tyk2 (Fig. 4C). Next, we substituted tyrosine 140 and/or 194 to phenylalanine. The substitution of tyrosine 194 to phenylalanine in Rack-1 (this mutation is present in the E, F, H, and I mutants) diminished the phosphorylation of Rack-1 by Tyk2 (Fig. 4C). In addition to Tyk2, other members of the Jak family (Jak1, Jak2, and Jak3) phosphorylated tyrosine 194 on Rack-1 (Fig. 6). Therefore, Jaks phosphorylate only tyrosine 194 of Rack-1. In addition, these results indicate that Jaks and Src kinase phosphorylate different tyrosine residues on Rack-1.

Although the binding of Rack-1 to Src required the phosphorylation of Rack-1 (19), Rack-1 mutants (E, F, H, and I) which were not phosphorylated by Tyk2 were still able to associate with Tyk2 (Fig. 4C). Indeed, wild-type Rack-1 and the Rack-1 E mutant associated with Tyk2 to the same degree (Fig. 5). These results indicate that the association of Rack-1 and Tyk2 occurred regardless of Rack-1 phosphorylation, and this association is not enhanced by tyrosine phosphorylation of Rack-1. In addition, catalytic activity of Jaks is not essential for binding to Rack-1, as the KE mutants of both Jak1 and Jak2 associated with Rack-1 (Fig. 6). This result is consistent with previous observations that Rack-1 associated with Tyk2 in BAF/3 cells in the presence or absence of IFN-{alpha} stimulation (Fig. 2B).

IFN-{beta} stimulation has been reported to translocate Rack-1 toward the perinuclear region (13). Transient expression of Jaks in 293T cells led to the autophosphorylation of the Jaks. When Rack-1 alone was transfected into 293T cells, Rack-1 was present throughout the cytoplasm. In contrast, when both Jak (Jak1, Jak2 or Tyk2) and Rack-1 were transfected into 293T cells, Rack-1 was translocated to the perinuclear region (Fig. 7). This perinuclear translocation was not observed when Jak1 KE or Jak2 KE was cotransfected with Rack-1, indicating that the kinase activity of Jaks is required for the translocation of Rack-1. As Tyk2 phosphorylated Rack-1, and as the kinase activity was essential for the perinuclear translocation of Rack-1, it was possible that phosphorylated Rack-1 might translocate to the perinuclear region. To test this hypothesis, we transfected Tyk2 and the Rack-1 E mutant, which lacks tyrosine 194, the residue that is phosphorylated by Jaks. Surprisingly, the Rack-1 E mutant translocated to the perinuclear region in a similar manner as wild-type Rack-1 (Fig. 7). One possible explanation for this observation is that Tyk2 might phosphorylate another target, which forms a complex with Rack-1, and translocates Rack-1 to the perinuclear region. Another possible explanation is that Tyk2 might phosphorylate endogenous Rack-1 in 293T cells, this phosphorylated endogenous Rack-1 might form a complex with the transfected Rack-1 E mutant, and the two types of Rack-1 might then be translocated to the perinuclear region together. To determine the precise mechanism of Rack-1 translocation, similar analysis must be performed using Rack-1 null cells.

In summary, we have demonstrated that Rack-1 associates with Jaks. Specifically, Rack-1 interacts with the pseudokinase and kinase domains of Tyk2. Two regions of Rack-1, the N terminus and the middle portion of the protein (aa 138–203), contribute to binding Tyk2. In addition, we have shown that tyrosine 194 of Rack-1 is phosphorylated by Jaks. Neither the phosphorylation state of Rack-1 nor of the Jak has an influence on the association of the two proteins. Furthermore, Rack-1 is translocated to the perinuclear region by the activation of Jaks.

The function of Rack-1 in cytokine signaling is still unclear. Because Rack-1 is a WD repeat-containing protein with no enzymatic activity (20), and because Rack-1 binds to PKC, Src homology 2-containing proteins such as Src, phospholipase C{gamma}, and ras-GTPase-activating proteins (21, 22), it has been reported that Rack-1 functions as a scaffold protein that recruits specific signaling elements. Rack-1 also binds to the IFNR {beta}-chain (13), Stat1 (15), and, as we have shown here, Jaks. It is possible that Rack-1 functions as a scaffold protein that aligns the signaling molecules in the cytokine-signaling cascade. Additionally, the fact that Rack-1 is phosphorylated by Jaks and is translocated to the perinuclear region by activation of Jaks raises the possibility that Rack-1 functions as a signaling molecule in the cytokine signaling cascade.


   Acknowledgments
 
We thank M. Sato and M. Ito for their excellent technical assistance.


   Footnotes
 
1 This work was supported in part by a grant from the Japan Leukemia Foundation, a Grant for Clinical Research, and Grants-in-Aid for Scientific Research (Nos. 13218096, 15390302) from the Ministry of Education, Culture, Sports, Science and Technology in Japan. Back

2 Address correspondence and reprint requests to Dr. Kazuya Shimoda, First Department of Internal Medicine, Faculty of Medicine, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, Fukuoka 812-8582, Japan. E-mail address: kshimoda{at}intmed1.med.kyushu-u.ac.jp Back

3 Abbreviations used in this paper: Tyk2, tyrosine kinase 2; Rack, receptor for activated C kinase; PKC, protein kinase C. Back

Received for publication November 25, 2003. Accepted for publication May 5, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ihle, J. N.. 1995. Cytokine receptor signalling. Nature 377:591.[Medline]
  2. Ihle, J. N., T. Nosaka, W. Thierfelder, F. W. Quelle, K. Shimoda. 1997. Jaks and Stats in cytokine signaling. Stem Cells 1:(Suppl. 15):105.
  3. Velazquez, L., M. Fellous, G. R. Stark, S. Pellegrini. 1992. A protein tyrosine kinase in the interferon {alpha}/{beta} signaling pathway. Cell 70:313.[Medline]
  4. Darnell, J. E., Jr, I. M. Kerr, G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415.[Abstract/Free Full Text]
  5. Shimoda, K., K. Kato, K. Aoki, T. Matsuda, A. Miyamoto, M. Shibamori, M. Yamashita, A. Numata, K. Takase, S. Kobayashi, et al 2000. Tyk2 plays a restricted role in IFN {alpha} signaling, although it is required for IL-12-mediated T cell function. Immunity 13:561.[Medline]
  6. Karaghiosoff, M., H. Neubauer, C. Lassnig, P. Kovarik, H. Schindler, H. Pircher, B. McCoy, C. Bogdan, T. Decker, G. Brem, et al 2000. Partial impairment of cytokine responses in Tyk2-deficient mice. Immunity 13:549.[Medline]
  7. Rodig, S. J., M. A. Meraz, J. M. White, P. A. Lampe, J. K. Riley, C. D. Arthur, K. L. King, K. C. Sheehan, L. Yin, D. Pennica, et al 1998. Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93:373.[Medline]
  8. Meraz, M. A., J. M. White, K. C. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, et al 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431.[Medline]
  9. Durbin, J. E., R. Hackenmiller, M. C. Simon, D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443.[Medline]
  10. Park, C., S. Li, E. Cha, C. Schindler. 2000. Immune response in Stat2 knockout mice. Immunity 13:795.[Medline]
  11. Shimoda, K., K. Kamesaki, A. Numata, K. Aoki, T. Matsuda, K. Oritani, S. Tamiya, K. Kato, K. Takase, R. Imamura, et al 2002. Cutting edge: Tyk2 is required for the induction and nuclear translocation of Daxx which regulates IFN-{alpha}-induced suppression of B lymphocyte formation. J. Immunol. 169:4707.[Abstract/Free Full Text]
  12. Gongora, R., R. P. Stephan, R. D. Schreiber, M. D. Cooper. 2000. Stat-1 is not essential for inhibition of B lymphopoiesis by type I IFNs. J. Immunol. 165:2362.[Abstract/Free Full Text]
  13. Croze, E., A. Usacheva, D. Asarnow, R. D. Minshall, H. D. Perez, O. Colamonici. 2000. Receptor for activated C-kinase (RACK-1), a WD motif-containing protein, specifically associates with the human type I IFN receptor. J. Immunol. 165:5127.[Abstract/Free Full Text]
  14. Usacheva, A., X. Tian, R. Sandoval, D. Salvi, D. Levy, O. R. Colamonici. 2003. The WD motif-containing protein RACK-1 functions as a scaffold protein within the type I IFN receptor-signaling complex. J. Immunol. 171:2989.[Abstract/Free Full Text]
  15. Usacheva, A., R. Smith, R. Minshall, G. Baida, S. Seng, E. Croze, O. Colamonici. 2001. The WD motif-containing protein receptor for activated protein kinase C (RACK1) is required for recruitment and activation of signal transducer and activator of transcription 1 through the type I interferon receptor. J. Biol. Chem. 276:22948.[Abstract/Free Full Text]
  16. Shimoda, K., J. Feng, H. Murakami, S. Nagata, D. Watling, N. C. Rogers, G. R. Stark, I. M. Kerr, J. N. Ihle. 1997. Jak1 plays an essential role for receptor phosphorylation and Stat activation in response to granulocyte colony-stimulating factor. Blood 90:597.[Abstract/Free Full Text]
  17. Ihle, J. N.. 1996. STATs: signal transducers and activators of transcription. Cell 84:331.[Medline]
  18. Ron, D., C. H. Chen, J. Caldwell, L. Jamieson, E. Orr, D. Mochly-Rosen. 1994. Cloning of an intracellular receptor for protein kinase C: a homolog of the {beta} subunit of G proteins. Proc. Natl. Acad. Sci. USA 91:839.[Abstract/Free Full Text]
  19. Chang, B. Y., R. A. Harte, C. A. Cartwright. 2002. RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 21:7619.[Medline]
  20. Neer, E. J., C. J. Schmidt, R. Nambudripad, T. F. Smith. 1994. The ancient regulatory-protein family of WD-repeat proteins. Nature 371:297.[Medline]
  21. Chang, B. Y., K. B. Conroy, E. M. Machleder, C. A. Cartwright. 1998. RACK1, a receptor for activated C kinase and a homolog of the {beta} subunit of G proteins, inhibits activity of src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18:3245.[Abstract/Free Full Text]
  22. Chang, B. Y., M. Chiang, C. A. Cartwright. 2001. The interaction of Src and RACK1 is enhanced by activation of protein kinase C and tyrosine phosphorylation of RACK1. J. Biol. Chem. 276:20346.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
W. Zhang, C. S. Zong, U. Hermanto, P. Lopez-Bergami, Z. Ronai, and L.-H. Wang
RACK1 Recruits STAT3 Specifically to Insulin and Insulin-Like Growth Factor 1 Receptors for Activation, Which Is Important for Regulating Anchorage-Independent Growth
Mol. Cell. Biol., January 15, 2006; 26(2): 413 - 424.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Z. Du, Y. Shen, W. Yang, I. Mecklenbrauker, B. G. Neel, and L. B. Ivashkiv
Inhibition of IFN-{alpha} signaling by a PKC- and protein tyrosine phosphatase SHP-2-dependent pathway
PNAS, July 19, 2005; 102(29): 10267 - 10272.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
T. Kubota, N. Yokosawa, S.-i. Yokota, N. Fujii, M. Tashiro, and A. Kato
Mumps Virus V Protein Antagonizes Interferon without the Complete Degradation of STAT1
J. Virol., April 1, 2005; 79(7): 4451 - 4459.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haro, T.
Right arrow Articles by Harada, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haro, T.
Right arrow Articles by Harada, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS