The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takada, Y.
Right arrow Articles by Aggarwal, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takada, Y.
Right arrow Articles by Aggarwal, B. B.
The Journal of Immunology, 2004, 173: 1066-1077.
Copyright © 2004 by The American Association of Immunologists

TNF Activates Syk Protein Tyrosine Kinase Leading to TNF-Induced MAPK Activation, NF-{kappa}B Activation, and Apoptosis1

Yasunari Takada and Bharat B. Aggarwal2

Cytokine Research Laboratory, Department of Bioimmunotherapy, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Spleen tyrosine kinase (Syk), a nonreceptor protein kinase initially found to be expressed only in hemopoietic cells, has now been shown to be expressed in nonhemopoietic cells and to mediate signaling of various cytokines. Whether Syk plays any role in TNF signaling was investigated. Treatment of Jurkat T cells with TNF activated Syk kinase but not ZAP70, another member of Syk kinase family, and the optimum activation occurred at 10 s and with 1 nM TNF. TNF also activated Syk in myeloid and epithelial cells. TNF-induced Syk activation was abolished by piceatannol (Syk-selective inhibitor), which led to the suppression of TNF-induced activation of c- JNK, p38 MAPK, and p44/p42 MAPK. Jurkat cells that did not express Syk (JCaM1, JCaM1/lck) showed lack of TNF-induced Syk, JNK, p38 MAPK, and p44/p42 MAPK activation, as well as TNF-induced I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and NF-{kappa}B activation. TNF-induced NF-{kappa}B activation was enhanced by overexpression of Syk by Syk-cDNA and suppressed when Syk expression was down-regulated by expression of Syk-small interfering RNA (siRNA-Syk). The apoptotic effects of TNF were reduced by up-regulation of NF-{kappa}B by Syk-cDNA, and enhanced by down-regulation of NF-{kappa}B by siRNA-Syk. Immunoprecipitation of cells with Syk Abs showed TNF-dependent association of Syk with both TNFR1 and TNFR2; this association was enhanced by up-regulation of Syk expression with Syk-cDNA and suppressed by down-regulation of Syk using siRNA-Syk. Overall, our results demonstrate that Syk activation plays an essential role in TNF-induced activation of JNK, p38 MAPK, p44/p42 MAPK, NF-{kappa}B, and apoptosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TNF, a proapoptotic and an inflammatory cytokine, is produced primarily by the macrophages. It mediates its effects through two distinct receptors, TNFR p60 (also called TNFR1 or p55) and TNFR p80 (also called TNFR2 or p75). TNFR p60 is expressed on all cell types, whereas p80 is expressed primarily on hemopoietic cells and endothelial cells. Most TNF signaling has been ascribed to the p60 receptor, whereas the role of the p80 receptor is controversial. It is thought that p60 receptor mediates apoptosis and p80 receptor mediates proliferation (1). Others have suggested that the p80 receptor mediates its signaling through the p60 receptor. That soluble TNF is a ligand for p60 receptor and that transmembrane TNF is a ligand for the p80 receptor has also been demonstrated (2, 3, 4).

Recent studies with genetic deletion of TNF receptors have shown that both receptors are needed for optimum signaling (5, 6). When TNF binds with the receptor, it activates early events (within minutes), which include activation of NF-{kappa}B, JNK, p38 MAPK, and p44/p42 MAPK (7, 8, 9), and late events (within days), which include induction of apoptosis (10). Sequential recruitment of TNFR-associated death domain protein (TRADD), Fas-associated death domain protein, and FLICE by the p60 receptor leads to apoptosis; recruitment of TRADD, receptor-interacting protein, and I{kappa}B kinase-{beta} leads to NF-{kappa}B activation; and recruitment of TRADD, TRAF2, and MAPK kinase (MKK)7 leads to JNK activation (7, 11, 12, 13, 14, 15, 16, 17). The role of protein-tyrosine kinases in TNF signaling, however, is not well understood.

Proline-rich tyrosine kinase (Pyk2)3 (18, 19) and p53/Lyn p56 (20) have roles in TNF-induced neutrophil activation; Etk/Bmx in TNF-induced endothelial cell migration and angiogenesis; c-Src in TNF-induced NF-{kappa}B activation in the marrow macrophages (21, 22); and TNF in regulation of gap junctions in airway epithelial cells (23). Pyk2 has also been implicated in TNF-induced JNK activation (24). In neutrophils, TNF has been shown to promote the association of Pyk2 to spleen tyrosine kinase (Syk) (19) and activate Syk, one of the downstream targets of Pyk2 (25).

Syk is a 72-kDa nonreceptor protein kinase that serves as a key regulator of multiple biochemical signal transduction events and has high homology to ZAP70 protein-tyrosine kinase (26). This kinase is ubiquitously expressed in hemopoietic cells and regulates proliferation, differentiation, and apoptosis. In B cells, phospholipase C{gamma}2 and PI3K are key targets of Syk tyrosine phosphorylation (27). Phosphorylation of phospholipase C{gamma}2 by Syk results in downstream activation of p44/p42 MAPK and JNK kinases (28), whereas PI3K phosphorylation by Syk mediates Akt activity (29). Recent evidence indicates that Syk is also expressed in nonhemopoietic cells, including hepatocytes (30), colon cancer cells (31), and breast cancer cells (32).

Recently, we showed that Syk plays a critical role in H2O2-induced NF-{kappa}B activation (33). What role Syk plays in TNF-induced signaling, however, is not known. We investigated whether TNF can activate Syk in hemopoietic and nonhemopoietic cells and whether Syk activation is involved in TNF-induced NF-{kappa}B, JNK, p38 MAPK, p44/p42 MAPK, and apoptosis. Our results indicate that TNF rapidly and potently activates Syk and that the deletion of Syk down-regulates TNF-induced activation of JNK, p38 MAPK, p44/p42 MAPK, and NF-{kappa}B but enhances apoptosis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Bacteria-derived human rTNF, purified to homogeneity with a specific activity of 5 x 107 U/mg, was kindly provided by Genentech (South San Francisco, CA). Penicillin, streptomycin, IMDM, DMEM, RPMI 1640, FBS, and LipofectAMINE 2000 were obtained from InVitrogen (Carlsbad, CA). Ab against {beta}-actin and piceatannol were purchased from Sigma-Aldrich (St. Louis, MO). Abs anti-phosphotyrosine (PY99), ZAP70, JNK1, I{kappa}B{alpha}, PARP, and annexin V staining kit were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Abs against phospho-I{kappa}B{alpha}, phospho-p38 MAPK, p38 MAPK, phospho-p44/p42 MAPK, and p44/p42 MAPK were purchased from Cell Signaling (Beverly, MA). Anti-Syk and anti-phosphotyrosine (4G10) Abs were purchased from Neo Markers (Fremont, CA). Wild-type Syk-cDNA, as described previously (32), was kindly provided by Dr. S. C. Mueller (Georgetown University Medical School, Washington, DC). Anti-TNFR1 mAb (htr-9) was kindly provided by Dr. M. Brockhaus (F. Hoffmann-LaRoche, Basel, Switzerland). Anti-TNFR2 mAb (MR2-1) was kindly provided by Dr. W. A. Buurman (Maastricht University, Maastricht, The Netherlands). ,

Generation of small interfering RNA-Syk (siRNA-Syk) plasmid vector

The generation of siRNA-Syk plasmid as previously described (33) was kindly supplied by Dr. S. Singh (Imgenex, San Diego, CA). The sequence (bp 555–575) used was TCGAGCAGACATGGAACCTGCAGGGGAGTACTGCCCTGCAGGTTCCATGTCTGCTTTTT (binding sequences are in bold letters, stem loop sequences are in italics, and the SalI cloning overhang site is underlined).

Cell lines

Jurkat (human T cells), JCaM1 (Lck and Syk-deficient), U937, KBM-5 (human myeloid), and HeLa (human epithelial) cells were obtained from the American Type Culture Collection (Manassas, VA). The characterization of JCaM1 cells has been previously reported (34). JCaM1/lck (lck-reconstituted JCaM1 cells), were kindly supplied by Dr. A. Weiss (University of California, San Francisco, CA). Jurkat, JCaM1, JCaM1/lck, and U937 cells were cultured in RPMI 1640 with 10% FBS; KBM-5 cells were cultured in IMDM supplemented with 15% FBS; HeLa cells were cultured in DMEM supplemented with 10% FBS with 100 U/ml penicillin and 100 µg/ml streptomycin.

Western blot analysis

To determine the levels of protein expression in cytoplasm and nuclear extracts, we prepared each extract (35) from TNF-treated cells and fractionated each by SDS-PAGE. After electrophoresis, the proteins were electrotransferred to nitrocellulose membranes, blotted with each Ab, and detected by ECL regent (Amersham, Piscataway, NJ). The density of the bands was measured using a personal densitometer scan version 1.30 and Imagequant software version 3.3 (Molecular Dynamics, Sunnyvale, CA).

JNK assay

The JNK assay was performed as described previously (36). Briefly, cells were lysed for 30 min on ice in whole cell extraction buffer (20 mM HEPES (pH 7.9), 50 mM NaCl, 1% Nonidet P-40, 2 mM EDTA, 0.5 mM EGTA, 2 µg/ml aprotinin, 2 µg/ml leupeptin, 0.5 mM PMSF, and 2 mM sodium orthovanadate). Lysate containing 200 µg of proteins in extraction buffer was incubated with 1 µg/ml anti-JNK1 Ab overnight, followed by treatment with protein A/G-Sepharose beads. After a 2-h incubation, the beads were washed with lysis buffer and then assayed in kinase assay mixture containing 50 mM HEPES (pH 7.4), 20 mM MgCl2, 2 mM DTT, 20 µCi [{gamma}-32P]ATP, 10 µM unlabeled ATP, and 2 µg of substrate GST-c-Jun(1–59). After incubation at 30°C for 30 min, the reaction was terminated by boiling with SDS sample buffer for 5 min. Finally, the protein was resolved on a 10% SDS-PAGE, the gel was dried, and the radioactive bands were visualized by PhosphorImager (Molecular Dynamics). To determine the total amounts of JNK1, 30 µg of the whole cell extract were resolved on 7.5% SDS-PAGE, electrotransferred to a nitrocellulose membrane, and then blotted with anti-JNK1 Ab.

EMSA

To determine NF-{kappa}B activation, we performed EMSA as described (37). Briefly, nuclear extracts prepared from TNF-treated cells (2 x 106/ml) were incubated with 32P-end-labeled 45-mer double-stranded NF-{kappa}B oligonucleotides (10 µg of protein with 16 fmol of DNA) from the HIV long terminal repeat, 5'-TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGG-3' (boldface indicates NF-{kappa}B binding sites) for 30 min at 37°C, and the DNA-protein complex formed was separated from free oligonucleotides on 6.6% native polyacrylamide gels. A double-stranded mutated oligonucleotides, 5'-TTGTTACAACTCACTTTCCGCTGCTCACTTTCCAGGGAGGCGTGG-3', was used to examine the specificity of binding of NF-{kappa}B to the DNA. The dried gels were visualized, and radioactive bands were quantitated by a PhosphorImager using Imagequant software.

Syk immunoprecipitation

Cells were lysed for 30 min on ice in whole cell extraction buffer (20 mM HEPES (pH 7.9), 50 mM NaCl, 1% Nonidet P-40, 2 mM EDTA, 0.5 mM EGTA, 2 µg/ml aprotinin, 2 µg/ml leupeptin, 0.5 mM PMSF, and 2 mM sodium orthovanadate). Lysate containing 500 µg of proteins in extraction buffer were incubated with 1 µg/ml Abs overnight. The immunocomplex was precipitated using protein A/G-Sepharose beads for 1 h at 4°C. Beads were washed with extraction buffer and resuspended in SDS sample buffer, boiled for 5 min, and fractionated in SDS-PAGE.

siRNA-Syk and wild-type Syk-cDNA (Syk-Wt) transfection

To determine the role of Syk protein tyrosine kinase in TNF-induced NF-{kappa}B activation, 2 x 105 cells were transfected either with siRNA-Syk or with Syk-Wt. Two micrograms plasmid in each case was diluted in 200 µl of DMEM (without serum and antibiotics) and then mixed with 200 µl of DMEM containing 4 µl of LipofectAMINE 2000. This mixture was added to the cells and incubated for 4 h. After incubation, cells were washed with RPMI 1640, repeated the transfection procedure, washed again, and then maintained for an additional 48 h before using for experiments. Transfection efficiency was found to be 50–60% as examined by {beta}-galactosidase transfection (data not shown). After transfection, cells were found to be 80–90% viable based on trypan blue dye exclusion method. Dead cells were removed by centrifugation before each experiment.

Flow cytometric analysis

To determine apoptosis, annexin V-positive cells were examined using an annexin V staining kit purchased from Santa Cruz Biotechnology. TNF-treated cells were washed in PBS, resuspended in 100 µl of binding buffer containing FITC-conjugated annexin V, and analyzed by a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA).

TUNEL assay

TNF-induced apoptosis was also determined by TUNEL assay using In Situ Cell Death Detection reagent (Roche Applied Science, Indianapolis, IN). Briefly, 1 x 105cells were treated with 1 nM TNF for 16 h at 37°C. Thereafter, cells were plated on a poly-L-lysine-coated glass slide by centrifugation using a Cytospin 4 (Thermoshendon, Pittsburg, PA), air-dried, fixed with 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate. After washing, cells were incubated with reaction mixture for 60 min at 37°C. Stained cells were mounted with mounting medium (Sigma-Aldrich) and analyzed under a fluorescence microscope (Labophot 2; Nikon, Melville, NY).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we investigated the role of Syk in TNF-induced activation of JNK, p44/p42 MAPK and p38 MAPK, and NF-{kappa}B and in apoptosis. We used Syk-selective metabolic inhibitors, Syk-deficient cell lines, Syk-overexpressing cells, and Syk-down-regulated cells for this study.

TNF activates Syk protein tyrosine kinase in Jurkat cells

To determine the effect of TNF on the activation of Syk protein tyrosine kinase in Jurkat cells, cells were treated with TNF for different times, whole cell extracts were immunoprecipitated with anti-Syk Ab, and then subjected to Western blot using anti-phosphotyrosine Ab. The results in Fig. 1A shows that TNF induced activation of Syk in a time-dependent manner; the activation can be seen as early as 5 s, reached maximum at 15 s, and decreased thereafter. TNF had no effect on the expression of Syk protein (Fig. 1A, bottom). TNF also activated Syk in a dose-dependent manner, starting at 10 pM and continuing to increase at 1000 pM (Fig. 1B). To determine the cell type specificity of TNF-induced Syk activation, myeloid (U937 and KBM-5) and epithelial (HeLa) cells were treated with TNF for the indicated times and examined for Syk activation. TNF activated Syk in all cell lines (Fig. 1C) but was less pronounced than that observed in Jurkat cells (Fig. 1A).



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 1. Time- and dose-dependent activation of Syk protein-tyrosine kinase by TNF in Jurkat cells. Jurkat cells were treated with 1 nM TNF for the indicated times (A) or treated with various concentrations of TNF for 30 s (B). After treatment, whole cell extracts were prepared and then incubated with anti-Syk Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and then submitted to 7.5% SDS-PAGE. Western blot (WB) analysis was performed using an anti-phosphotyrosine Ab (4G10). TNF activates Syk protein tyrosine kinase in U937 (C1), KBM-5 (C2), and HeLa (C3) cells. The cells were treated with 1 nM TNF for the indicated times, and then whole cell extracts were prepared and incubated with anti-Syk Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and then submitted to 7.5% SDS-PAGE. Western blot analysis was performed using the anti-phosphotyrosine Ab 4G10. D, Cells were treated with various concentration of TNF for 30 s, the whole cell extracts were prepared and fractionated on SDS-PAGE, and then Western blot analysis was performed using anti-phosphotyrosine Ab. E, Cells were treated with 1 nM TNF for indicated times, whole cell extracts were prepared and precipitated with anti-ZAP70 Ab, and Western blot analysis was performed using anti-phosphotyrosine Ab. The sample without immunoprecipitation (IP) was used as a positive control.

 
Whether TNF induces tyrosine phosphorylation of proteins other than Syk, was also investigated. To determine this, whole cell extracts from TNF-treated cells were resolved on SDS-PAGE and then analyzed by Western blot using anti-phosphotyrosine Ab (Fig. 1D). The results show that TNF induced tyrosine phosphorylation in a dose-dependent manner of only one protein with a molecular mass of ~72 kDa; this size corresponds to that of Syk protein. ZAP70 is another protein-tyrosine kinase with high homology to Syk protein (38). Whether TNF also activates ZAP70 was examined. To determine this, cells were treated with TNF for indicated times, and whole cell extracts were prepared, immunoprecipitated with anti-ZAP70 Ab, and then subjected to Western blot analysis using anti-phosphotyrosine Ab (Fig. 1E). These results indicate that TNF does not induce the phosphorylation of ZAP70, suggesting that Syk is the only target of TNF-induced tyrosine phosphorylation. The Western blot analysis shows that Jurkat cells do express ZAP70 protein (Fig. 1E).

Syk-specific inhibitor, piceatannol, blocks TNF-induced Syk activation in parallel with its inhibition of TNF-induced activation of JNK, p38 MAPK, and p44/p42 MAPK

It has been shown that piceatannol is a specific inhibitor of Syk protein-tyrosine kinase (39). To determine whether TNF-induced Syk activation is inhibited by piceatannol, Jurkat cells were incubated with piceatannol for 1 h and then treated with TNF for different times. Piceatannol completely inhibited TNF-induced activation of Syk (Fig. 2A). This experiments further support the notion that TNF can activate Syk.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 2. The Syk-specific inhibitor piceatannol blocks TNF-induced Syk activation. A, Cells were incubated with 20 µM piceatannol for 1 h. Cells were then treated with 1 nM TNF for the indicated times, and whole cell extracts were prepared and incubated with anti-Syk Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and submitted to 7.5% SDS-PAGE. Western blot (WB) analysis was performed using the anti-phosphotyrosine Ab. B, Cells were incubated with 20 µM piceatannol for 1 h and treated with 1 nM TNF for the indicated times, whole cell extracts were prepared and fractionated on SDS-PAGE, and Western blot analysis was performed using anti-phosphotyrosine Ab. C, Cells were incubated with 20 µM piceatannol for 1 h and treated with 1 nM TNF for the indicated times. Then whole cell extracts were prepared and incubated with anti-JNK1 Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and then submitted to JNK kinase reaction. Then, samples were fractionated on 10% SDS-PAGE, dried, and exposed to an imaging plate. Western blot analysis was performed using an anti-phospho-specific p38 MAPK (D) or anti-phospho-specific p44/p42 MAPK Abs (E). IP, Immunoprecipitation.

 
Whether piceatannol inhibits the tyrosine phosphorylation of proteins other than Syk, was also examined. To determine this, piceatannol-pretreated cells were treated with TNF for different times, the whole cell extracts were prepared and resolved on SDS-PAGE, and Western blot analysis was performed using anti-phosphotyrosine Ab (Fig. 2B). These results clearly show that piceatannol primarily inhibits the TNF-induced phosphorylation of a single protein at 72 kDa, corresponding to that of Syk.

Because TNF-induced Syk activation occurs in seconds, we wondered whether it would affect TNF-induced JNK activation. To determine this, piceatannol-pretreated Jurkat cells were stimulated with 0.1 nM TNF for different times and then examined for JNK. As shown in Fig. 2C, TNF induced activation of JNK as early as 5 min, and it reached maximum at 15 min. Treatment with piceatannol completely inhibited the TNF-induced JNK activation.

Because TNF is a potent activator of p38 MAPK and p44/p42 MAPK, we also investigated the role of Syk activation in activation of these MAPKs. Cells were treated as indicated above and examined for activation of p38 MAPK and p44/p42 MAPK using phospho-specific Abs. As shown in Fig. 2D, TNF induced activation of p38 MAPK as early as 5 min, and it reached maximum at 15 min. Treatment with piceatannol again completely inhibited the TNF-induced activation of p38 MAPK. Similarly, TNF-induced activation of p44/p42 MAPK in Jurkat cells, and treatment with piceatannol suppressed TNF-induced activation of p44/p42 MAPK (Fig. 2E). Thus, TNF-induced Syk activation regulated TNF-induced activation of JNK, p38 MAPK, and p44/p42 MAPK.

TNF does not activate JNK, p38 MAPK, and p44/p42 MAPK in Syk-deficient JCaM1 cells

Metabolic inhibitors, although convenient, are not always specific. Therefore, it is possible that the inhibitory effect of piceatannol on TNF signaling was independent of inhibition of Syk activation. Thus, we compared the effect of TNF on Jurkat cells with JCaM1 cells, a clone of Jurkat cells genetically deficient in nonreceptor Syk protein-tyrosine kinase (40). As shown in Fig. 3A, Jurkat cells express Syk protein but JCaM1 cells do not. As expected, TNF induced Syk activation in Jurkat cells but not in JCaM1 cells (Fig. 3B). We next compared the Syk-expressing (Jurkat) and Syk-deficient (JCaM1) cells for TNF-induced activation of JNK, p38 MAPK, and p44/p42 MAPK. As can be seen, TNF activated JNK (Fig. 3C), p38 MAPK (Fig. 3D), and p44/p42 MAPK (Fig. 3E) in Jurkat cells, but activation was minimal in JCaM1 cells, again suggesting that Syk activation was needed for the activation of these MAPKs.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 3. TNF activates Syk protein-tyrosine kinase in lck-deficient JCaM1 cells. A, Expression levels of Syk and lck protein-tyrosine kinase in JCaM1 and lck-reconstituted JcaM1/lck cells. Whole cell extracts were prepared, and then Western blot analysis was performed using anti-lck, anti-Syk or anti-{beta}-actin Abs. B, Cells were treated with 1 nM TNF for the indicated times, and then whole cell extracts were prepared and incubated with anti-Syk Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and then submitted to 10% SDS-PAGE. Western blot (WB) analysis was performed using an anti-phosphotyrosine Ab. C, Cells were incubated treated with 1 nM TNF for the indicated times. Then whole cell extracts were prepared and incubated with anti-JNK1 Ab overnight. The immunocomplex was precipitated with protein A/G-Sepharose beads and then submitted to JNK kinase reaction. Then, samples were fractionated on 10% SDS-PAGE, dried, and exposed to an imaging plate. Western blot analysis was performed using an anti-phospho-specific p38 MAPK (D) or anti-phospho-specific p44/p42 MAPK Abs (E). Effect of TNF on Syk-tyrosine phosphorylation (F), JNK activation (G), p 38 MAPK phosphorylation (H) and p44/p42 MAPK-phosphorylation (I) in JCaM1/lck cells. IP, Immunoprecipitation.

 
Besides Syk protein, JCaM1 cells have been shown to lack lck protein (Fig. 3A). To exclude the role of lck in TNF signaling, we used JCaM1 cells reconstituted with lck protein (Fig. 3A). The treatment of lck-reconstituted cells with TNF failed to activate Syk (Fig. 3F), JNK (Fig. 3G), p38 MAPK (Fig. 3H), or p44/p42 MAPK (Fig. 3I). These results indicate that lck plays no role in TNF signaling.

TNF-induced NF-{kappa}B activation is also mediated through Syk activation

TNF is one of the most potent activators of NF-{kappa}B. Whether Syk is also involved in TNF-induced NF-{kappa}B activation was investigated. As shown in Fig. 4A (left), TNF activated NF-{kappa}B in a time-dependent manner, and this correlated with I{kappa}B{alpha} (an inhibitor of NF-{kappa}B) phosphorylation and degradation. Pretreatment of cells with piceatannol suppressed the TNF-induced NF-{kappa}B activation, I{kappa}B{alpha} phosphorylation, and I{kappa}B{alpha} degradation (Fig. 4A, right).



View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 4. TNF-induced NF-{kappa}B activation is mediated through Syk activation. A, Jurkat cells were incubated with 20 µM piceatannol and then treated with 0.1 nM TNF for the indicated times. After these treatments, nuclear and cytoplasmic extracts were prepared. Nuclear extracts were assayed for NF-{kappa}B activation by EMSA. Thirty micrograms of each cytoplasmic extract were fractionated on 10% SDS-PAGE and electrotransferred. Western blot analysis used phospho-specific anti-I{kappa}B{alpha} and anti-I{kappa}B{alpha} Abs. B, Cells were treated with 0.1 nM TNF for the indicated times, and then nuclear and cytoplasmic extracts were prepared. Nuclear extracts were assayed for NF-{kappa}B activation by EMSA. Thirty micrograms of each cytoplasmic extract were fractionated on 10% SDS-PAGE and electrotransferred. Western blot analysis used phospho-specific anti-I{kappa}B{alpha} and anti-I{kappa}B{alpha} Abs.

 
We then examined the Syk-deficient JCaM1 and JCaM1/lck cells for TNF-induced NF-{kappa}B activation. As shown in Fig. 4B, TNF activated NF-{kappa}B in JCaM1 and JCaM1/lck cells, but the maximum activation was ~61 and 54% of that of Jurkat cells, respectively. TNF also induced I{kappa}B{alpha} phosphorylation and degradation in JCaM1 and JCaM1/lck cells (Fig. 4B, bottom). Fig. 4B shows that JCaM1 cells that lack both Syk and lck (Fig. 4B, left) or lack only Syk (reconstituted with lck; Fig. 4B, right) have decreased NF-{kappa}B activation. These results indicate that Syk plays a role in TNF-induced NF-{kappa}B activation, as it does for MAPKs. The level of TNF-induced NF-{kappa}B activation in JCaM1 cells found here and that reported previously (33) appears to vary perhaps due to the metabolic state of the cells.

Overexpression of Syk enhances TNF-induced NF-{kappa}B activation

To further confirm the role of Syk protein-tyrosine kinase in TNF-induced NF-{kappa}B activation, we transiently transfected the Jurkat cells with the wild-type Syk-cDNA-containing expression plasmid. As shown in Fig. 5, these cells showed an increase in expression of Syk protein (Fig. 5A), in parallel with enhanced TNF-induced NF-{kappa}B activation (Fig. 5B). Thus, these results suggest that Syk protein-tyrosine kinase may play a role in also TNF-induced NF-{kappa}B activation.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. Overexpression of Syk enhances and reduction of Syk by siRNA-Syk inhibits TNF-induced NF-{kappa}B activation. A, Jurkat cells were transfected with wild-type Syk-cDNA (Syk-Wt), and whole cell extracts were prepared and then subjected to SDS-PAGE for protein expression using anti-Syk Ab. B, Syk-Wt-transfected cells were treated with 0.1 nM TNF for 30 min and then analyzed for NF-{kappa}B activation by EMSA. C, Jurkat cells were transfected with siRNA-Syk, and whole cell extracts were prepared and then subjected to SDS-PAGE for protein expression using anti-Syk Ab. D, siRNA-Syk-transfected cells were treated with 0.1 nM TNF for 30 min and then analyzed for NF-{kappa}B activation.

 
Reduction of Syk protein by siRNA-Syk inhibits TNF-induced NF-{kappa}B activation

We also used siRNA to suppress Syk protein expression (41). For this, we transiently transfected siRNA-Syk into Jurkat cells. siRNA-Syk suppressed the expression of Syk protein (Fig. 5C) and diminished the TNF-induced NF-{kappa}B activation (Fig. 5D). These results again suggest that Syk plays an important role in NF-{kappa}B activation induced by TNF.

Overexpression of Syk inhibits and reduction of Syk protein enhances TNF-induced apoptosis

Activation of NF-{kappa}B inhibits and suppression of NF-{kappa}B stimulates TNF-induced apoptosis (42, 43, 44, 45). Whether increased activation of NF-{kappa}B by overexpression of Syk or reduction of NF-{kappa}B by down-regulation of Syk protein expression affects TNF-induced apoptosis was investigated. As shown in Fig. 6A, Jurkat cells were sensitive to TNF-induced cytotoxicity, and overexpression of Syk protein by Syk-cDNA in these cells suppressed the TNF-induced cytotoxicity (Fig. 6A). Similarly, the suppression of Syk protein by siRNA-Syk potentiated the TNF-induced cytotoxicity (Fig. 6A). These results were further confirmed by using piceatannol. As shown in Fig. 6B, pretreatment of cells with piceatannol enhanced the TNF-induced cytotoxicity. We also examined the effect of Syk on TNF-induced apoptosis by annexin V staining (Fig. 6, C and D), TUNEL assay (Fig. 6E), and PARP cleavage (Fig. 6F). All these results indicated that overexpression of Syk protein by Syk-Wt cDNA decreases TNF-induced apoptosis and reduction of Syk protein by siRNA increases the TNF-induced apoptosis. JCaM1 that lack Syk are also more sensitive than wild-type or Syk-transfected cells to TNF-induced apoptosis (Fig. 6D). Thus, whereas TNF-induced NF-{kappa}B activation paralleled Syk protein expression (Fig. 5), the TNF-induced apoptosis showed a reciprocal relationship.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 6. Overexpression of Syk inhibits and reduction of Syk protein enhances TNF-induced apoptosis. A, Jurkat cells were transfected with wild-type Syk-cDNA (Syk-Wt) or siRNA-Syk, exposed to various concentrations of TNF for 72 h, and then the cell viability was measured by MTT assay. B, Jurkat cells were treated with 10 µM piceatannol for 1 h and then exposed to various concentrations of TNF for 72 h. Cell viability was determined by MTT assay. C, Jurkat cells were transfected with Syk-Wt or siRNA-Syk and then treated with 1 nM TNF for 16 h. Cells were stained with FITC-conjugated anti-annexin V Ab and detected by a FACSCalibur flow. D, Jurkat cells were transfected with Syk-Wt or siRNA-Syk and then treated with 1 nM TNF for 16 h. Cells were fixed and incubated with reaction mixture (In Situ Cell Death Detection reagent) for 60 min in 37°C. Stained cells were mounted and analyzed under a fluorescence microscope. E, Jurkat cells were transfected with Syk-Wt or siRNA-Syk and treated with various concentrations of TNF for 24 h. Whole cell extracts were prepared and fractionated on 7.5% SDS-PAGE. Western blot analysis was performed using anti-PARP Ab. F, Jurkat-, JCaM1-, and Syk-Wt-transfected JCaM1 cells were treated with 1 nM TNF for 16 h and then TNF-induced apoptosis was examined by annexin V staining.

 
Overexpression of Syk up-regulates and silencing of Syk expression down-regulates TNF-induced p38 MAPK and JNK activation

Whether TNF-induced JNK and p38 MAPK are affected by modulation of Syk expression was also investigated. Results in Fig. 7A show that TNF induced JNK activation in Jurkat cells; this activation was enhanced by overexpression of Syk and decreased by transfection of cells with Syk siRNA. Similarly, results in Fig. 7B show that TNF induced p38 MAPK activation in Jurkat cells; this activation was enhanced by overexpression of Syk and decreased by transfection of cells with Syk siRNA. Thus, these results demonstrate that Syk can also regulate the TNF-induced JNK and p38 MAPK activation pathway.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 7. Role of Syk in TNF-induced activation of JNK, p38 MAPK and apoptosis. A, Jurkat cells were transfected with wild-type Syk-cDNA (Syk-Wt) or siRNA-Syk plasmid, treated with TNF for 15 min, and then JNK activation assay and Western blot analysis using anti-phospho-specific p38 MAPK, anti-p38 MAPK, or anti-JNK1 Abs were performed. B, Jurkat cells were transfected with Syk-Wt plasmid; pretreated with p38 MAPK inhibitor SB205380, or JNK inhibitor SP 600125 for 1 h; and treated with 1 nM TNF for 16 h. Then TNF-induced apoptosis was examined by annexin V staining.

 
Inhibition of p38 MAPK or JNK enhances TNF-induced apoptosis

Whether p38 MAPK or JNK play a role in TNF-induced apoptosis was also investigated by using SP600125, a specific JNK inhibitor, and SB205380, a specific p38 MAPK inhibitor. Annexin V staining results showed that TNF induced apoptosis in wild-type Jurkat cells, and syk overexpression inhibited the apoptosis (Fig. 7C). Pretreatment of cells with JNK inhibitor or p38 MAPK inhibitor enhanced the TNF-induced apoptosis indicating the antiapoptotic role of these kinases.

TNF-dependent recruitment of Syk protein in the TNF receptor complex

How Syk is activated by TNF and modulates TNF signaling was further investigated. It is possible that the Syk protein physically interacts with TNF receptor or receptor-associated proteins. To explore this possibility, Jurkat cells were treated with 1 nM TNF for different times. Whole cell extracts were immunoprecipitated with anti-Syk Ab and then analyzed by Western blotting anti-TNFR1 or anti-TNFR2 Abs. The results show that TNF induced the association of Syk protein with TNFR1 (Fig. 8A1) and with TNFR2 (Fig. 8A2). No association was noted in the absence of TNF. The maximum signal appeared at 60 s after the ligand treatment with TNFR1 and 30 s after that with TNFR2. These results suggest that Syk protein does associate with the TNFR in a ligand-dependent manner.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 8. TNF-dependent recruitment of Syk protein in the TNF receptor complex. A, Jurkat cells were treated with 1 nM TNF for the indicated times. Whole cell extracts were prepared, and 500 µg of protein were incubated with anti-Syk Ab overnight. The immunocomplex was precipitated using protein A/G-Sepharose beads and then fractionated on 7.5% SDS-PAGE. Western blot (WB) analysis was performed using anti-TNFR1 (A1) or anti-TNFR2 (A2) Abs. Fifty micrograms of whole cell proteins were fractionated on 7.5% SDS-PAGE. Western blot analysis was performed using anti-TNFR1 (A1) or anti-TNFR2 (A2) Abs. B, Whole cell extracts were incubated with anti-TNFR1 (B1) or TNFR2 (B2), and then Western blot analysis was performed using anti-Syk Ab. C, Cells were transfected with wild-type Syk-cDNA (Syk-Wt), and whole cell extracts were prepared, precipitated with anti-TNFR1 or anti-TNFR2 Abs, and then subjected to SDS-PAGE. Western blot analysis was performed using anti-Syk Ab (C1). Cells were transfected with siRNA-Syk, whole cell extracts were prepared, precipitated with anti-TNFR1 or anti-TNFR2 Abs, and then subjected to SDS-PAGE. Western blot analysis was using anti-Syk Ab (C2). IP, Immunoprecipitation.

 
To confirm this association, we performed a reciprocal experiment in which TNF-treated whole cell extracts were immunoprecipitated with anti-TNFR1 or TNFR2 Abs and then blotted with anti-Syk Ab. These results also show that Syk protein associates both with TNFR1 (Fig. 8B1) and TNFR2 (Fig. 8B2).

To further confirm the recruitment of Syk protein-tyrosine kinase into the TNF receptor complex, we transiently transfected the Jurkat cells with the wild-type Syk-cDNA expression plasmid. As shown in Fig. 8C1, these cells showed a TNF-induced recruitment of Syk into TNF receptor complex (Fig. 8C1, top and middle), in parallel with enhanced expression of Syk protein (Fig. 8C1, bottom). We also used siRNA to suppress Syk protein expression (41). For this, we transiently transfected siRNA-Syk into Jurkat cells. siRNA-Syk suppressed the expression of Syk protein (Fig. 8C2, bottom) and diminished the TNF-induced recruitment of Syk into TNF receptor complex (Fig. 8C2, top and middle). Thus, these results strongly suggest that Syk protein-tyrosine kinase is recruited into the TNF receptor complex in a ligand-dependent manner.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we investigated the role of Syk protein tyrosine kinase in TNF-induced signaling. We present from four different lines of evidence indicating that TNF can activate Syk in a wide variety of cells and that this activation modulates TNF-induced activation of JNK, p38 MAPK, p44/p42 MAPK, NF-{kappa}B activation, and apoptosis. The four different approaches were the use of metabolic inhibitors, Syk-deleted cells, overexpression of Syk protein by Syk-cDNA transfection, and down-regulation of Syk protein expression by siRNA-Syk. We also present evidence that Syk protein interacts with the TNF receptors.

Previously, we have shown that piceatannol can block TNF-induced NF-{kappa}B activation in both Syk-expressing as well as Syk-deleted JCaM-1 cells (54). Although other investigators have reported that piceatannol is a specific inhibitor of Syk, studies based on piceatannol alone are not sufficient to implicate Syk in cytokine signaling (Oliver et al., Ref. 39). Therefore, we have used other approaches including Syk-deleted cells, Syk-overexpressing cells, Syk siRNA, and activation of Syk activity by TNF to implicate Syk in the TNF signaling leading to NF-{kappa}B activation.

TNF activated Syk in three different cell lines. Although TNF has been shown to activate protein-tyrosine kinase, c-Src (21, 22, 23), p53/p56 lyn (20), Etk/Bmx (46), and PyK2 (18, 19, 24), this is the first report to indicate that TNF can activate a protein-tyrosine kinase, Syk, in different cells. TNF did not activate ZAP70, another T cell-specific kinase homologous to Syk. How TNF activates Syk is not clear. Because TNFR1 can recruit PI3K (47) and inhibition of PI3K by wortmannin blocks the activation of Syk and Syk-associated kinase Pyk2 (19), it is possible that TNF-induced activation of Syk is through PI3K. Because TNF-induced PI3K activation could be seen only after 15 min of TNF treatment (47) and TNF-induced Syk activation occurred within 30 s, it is unlikely that PI3K activation preceded Syk activation. The role of Pyk2 in NF-{kappa}B activation has been established (55). Whether TNF activates NF-{kappa}B through sequential activation of Pyk2 and Syk is not clear.

How Syk activation mediates TNF-induced activation of JNK and other MAPKs is not clear. TNF has been shown to activate the Syk-associated kinase Pyk2, which has been linked with JNK activation (24). It has been shown that Src and adapter proteins Grb2, crk, and p130Cas are downstream mediators of Pyk2 leading to the activation of p44/p42 MAPK and JNK (48). The association of Grb2 directly with TNFR1 has been reported (49). Thus, it is possible that TNF-induced Syk activation recruits Pyk2, which in turn recruits Grb2, leading to MAPK activation. TNF has also been shown to activate c-Raf-1 kinase (50, 51). The sequential interaction of TNFR1, Syk, Grb2, SOS, Ras, and Raf-1 kinase can lead to MAPK activation. It has been shown that Raf-1 leads to only p44/p42 MAPK activation and that JNK activation is initiated by mitogen-activated protein kinase kinase kinase (52). MKK7 and MKK3 have been implicated in TNF-induced JNK and p38 MAPK activation, respectively. Our results indicate that Syk lies upstream of all three major MAPKs activated by TNF.

Our results indicate that Syk activation also plays a role in TNF-induced NF-{kappa}B activation. The role of c-Src in TNF-induced NF-{kappa}B activation has been demonstrated (21, 23). It has been shown that c-Src causes the tyrosine phosphorylation of I{kappa}B kinase-{beta} needed for TNF-induced NF-{kappa}B activation (23). Whether TNF-induced Syk can also directly induce the phosphorylation of I{kappa}B{alpha} directly or through activation of c-Src is not clear at present. Abu-Amer et al. (53) showed that c-Src could directly phosphorylate tyrosine 42 in I{kappa}B{alpha}. It is unlikely that tyrosine 42 phosphorylation of I{kappa}B{alpha} by Syk could enhance TNF-induced NF-{kappa}B activation, because this phosphorylation has been implicated in suppression of TNF-induced NF-{kappa}B activation.

We showed that an increase in expression of Syk enhanced TNF-induced NF-{kappa}B activation, and this correlated with suppression of TNF-induced cytotoxicity. These results are consistent with previous reports showing that NF-{kappa}B activation negatively regulates TNF-induced apoptosis (42, 43, 44, 45). Our results also demonstrate that down-regulating Syk expression decreased NF-{kappa}B activation and enhanced TNF-induced cytotoxicity.

We also show that Syk interacted with both TNFR1 and TNFR2, which was enhanced by up-regulation of Syk using Syk-cDNA and suppressed by down-regulation of Syk using siRNA-Syk. Whether TNFR interacts with Syk protein directly or indirectly through some intermediate is very difficult to demonstrate at the whole cell level, especially when the association between TNFR and Syk is TNF dependent. The increase in Syk expression with Syk cDNA and decrease with Syk siRNA showed proportionately increase or decrease in the recruitment of the TNF receptor. These results, although not proof, do suggest that the interaction between TNFR and Syk is direct. This interaction was, however, dependent on TNF. Protein-tyrosine kinase and Etk/Bmx have been shown to associate with TNFR2 in endothelial cells (46). This interaction, however, was found to be TNF independent. Thus, overall our results indicate that a Syk can be activated by TNF and that this activation positively regulates TNF-induced activation of MAPKs and NF-{kappa}B and negatively regulates TNF-induced apoptosis.


    Footnotes
 
1 This work was supported partially by the Clayton Foundation for Research (to B.B.A.), Department of Defense United States Army Breast Cancer Research Program Grant BC010610 (to B.B.A.), PO1 Grant CA91844 from the National Institutes of Health on Lung Cancer Chemoprevention (to B.B.A.), and a P50 Head and Neck SPORE Grant from the National Institutes of Health (to B.B.A.). Back

2 Address correspondence and reprint requests to Dr. Bharat B. Aggarwal, Cytokine Research Laboratory, Department of Bioimmunotherapy, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 143, Houston, TX 77030-4095. E-mail address: aggarwal{at}mdanderson.org Back

3 Abbreviations used in this paper: Pyk2, proline-rich tyrosine kinase; Syk, spleen tyrosine kinase; Lck, lymphocyte-specific protein-tyrosine kinase; ALLN, N-acetylleucylleucylnorleucinal; siRNA, small interfering RNA; TRADD, TNFR-associated death domain protein; MKK, MAPK kinase. Back

Received for publication December 12, 2003. Accepted for publication April 22, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aggarwal, B. B.. 2000. Tumour necrosis factors receptor associated signalling molecules and their role in activation of apoptosis, JNK and NF-{kappa}B. Ann. Rheum. Dis. 59:(Suppl. 1):i6.[Abstract/Free Full Text]
  2. Schall, T. J., M. Lewis, K. J. Koller, A. Lee, G. C. Rice, G. H. Wong, T. Gatanaga, G. A. Granger, R. Lentz, H. Raab, et al 1990. Molecular cloning and expression of a receptor for human tumor necrosis factor. Cell 61:361.[Medline]
  3. Loetscher, H., Y. C. Pan, H. W. Lahm, R. Gentz, M. Brockhaus, H. Tabuchi, W. Lesslauer. 1990. Molecular cloning and expression of the human 55 kd tumor necrosis factor receptor. Cell 61:351.[Medline]
  4. Smith, C. A., T. Davis, D. Anderson, L. Solam, M. P. Beckmann, R. Jerzy, S. K. Dower, D. Cosman, R. G. Goodwin. 1990. A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248:1019.[Abstract/Free Full Text]
  5. Mukhopadhyay, A., J. Suttles, R. D. Stout, B. B. Aggarwal. 2001. Genetic deletion of the tumor necrosis factor receptor p60 or p80 abrogates ligand-mediated activation of nuclear factor-{kappa}B and of mitogen-activated protein kinases in macrophages. J. Biol. Chem. 276:31906.[Abstract/Free Full Text]
  6. Takada, Y., B. B. Aggarwal. 2003. Genetic deletion of the tumor necrosis receptor p60 or p80 sensitizes macrophages to lipopolysaccharide-induced nuclear factor-{kappa}B, mitogen-activated protein kinases, and apoptosis. J. Biol. Chem. 278:23390.[Abstract/Free Full Text]
  7. Liu, Z. G., H. Hsu, D. V. Goeddel, M. Karin. 1996. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-{kappa}B activation prevents cell death. Cell 87:565.[Medline]
  8. Davis, R. J.. 1993. The mitogen-activated protein kinase signal transduction pathway. J. Biol. Chem. 268:14553.[Free Full Text]
  9. Yuasa, T., S. Ohno, J. H. Kehrl, J. M. Kyriakis. 1998. Tumor necrosis factor signaling to stress-activated protein kinase (SAPK)/Jun NH2-terminal kinase (JNK) and p38: germinal center kinase couples TRAF2 to mitogen-activated protein kinase/ERK kinase kinase 1 and SAPK while receptor interacting protein associates with a mitogen-activated protein kinase kinase kinase upstream of MKK6 and p38. J. Biol. Chem. 273:22681.[Abstract/Free Full Text]
  10. Rath, P. C., B. B. Aggarwal. 1999. TNF-induced signaling in apoptosis. J. Clin. Immunol. 19:350.[Medline]
  11. Hsu, H., J. Xiong, D. V. Goeddel. 1995. The TNF receptor 1-associated potein TRADD signals cell death and NF-{kappa}B activation. Cell 81:495.[Medline]
  12. Hsu, H., H. B. Shu, M. G. Pan, D. V. Goeddel. 1996. TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell 84:299.[Medline]
  13. Hsu, H., J. Huang, H. B. Shu, V. Baichwal, D. V. Goeddel. 1996. TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 4:387.[Medline]
  14. Takeuchi, M., M. Rothe, D. V. Goeddel. 1996. Anatomy of TRAF2: distinct domains for nuclear factor-{kappa}B activation and association with tumor necrosis factor signaling proteins. J. Biol. Chem. 271:19935.[Abstract/Free Full Text]
  15. Chinnaiyan, A. M., K. O’Rourke, M. Tewari, V. M. Dixit. 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81:505.[Medline]
  16. Muzio, M., A. M. Chinnaiyan, F. C. Kischkel, K. O’Rourke, A. Shevchenko, J. Ni, C. Scaffidi, J. D. Bretz, M. Zhang, R. Gentz, et al 1996. FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 85:817.[Medline]
  17. Moriguchi, T., F. Toyoshima, N. Masuyama, H. Hanafusa, Y. Gotoh, E. Nishida. 1997. A novel SAPK/JNK kinase, MKK7, stimulated by TNF{alpha} and cellular stresses. EMBO J. 16:7045.[Medline]
  18. Fuortes, M., M. Melchior, H. Han, G. J. Lyon, C. Nathan. 1999. Role of the tyrosine kinase pyk2 in the integrin-dependent activation of human neutrophils by TNF. J. Clin. Invest. 104:327.[Medline]
  19. Han, H., M. Fuortes, C. Nathan. 2003. Critical role of the carboxyl terminus of proline-rich tyrosine kinase (Pyk2) in the activation of human neutrophils by tumor necrosis factor: separation of signals for the respiratory burst and degranulation. J. Exp. Med. 197:63.[Abstract/Free Full Text]
  20. Yan, S. R., M. J. Novak. 1999. Src-family kinase-p53/Lyn p56 plays an important role in TNF-{alpha}-stimulated production of O2 by human neutrophils adherent to fibrinogen. Inflammation 23:167.[Medline]
  21. Abu-Amer, Y., F. P. Ross, K. P. McHugh, A. Livolsi, J. F. Peyron, S. L. Teitelbaum. 1998. Tumor necrosis factor-{alpha} activation of nuclear transcription factor-{kappa}B in marrow macrophages is mediated by c-Src tyrosine phosphorylation of I{kappa}B{alpha}. J. Biol. Chem. 273:29417.[Abstract/Free Full Text]
  22. Huang, W. C., J. J. Chen, H. Inoue, C. C. Chen. 2003. Tyrosine phosphorylation of I-{kappa}B kinase {alpha}{beta} by protein kinase C-dependent c-Src activation is involved in TNF-{alpha}-induced cyclooxygenase-2 expression. J. Immunol. 170:4767.[Abstract/Free Full Text]
  23. Huang, W. C., J. J. Chen, C. C. Chen. 2003. c-Src-dependent tyrosine phosphorylation of IKK{beta} is involved in tumor necrosis factor-{alpha}-induced intercellular adhesion molecule-1 expression. J. Biol. Chem. 278:9944.[Abstract/Free Full Text]
  24. Tokiwa, G., I. Dikic, S. Lev, J. Schlessinger. 1996. Activation of Pyk2 by stress signals and coupling with JNK signaling pathway. Science 273:792.[Abstract]
  25. Yan, S. R., M. Huang, G. Berton. 1997. Signaling by adhesion in human neutrophils: activation of the p72syk tyrosine kinase and formation of protein complexes containing p72syk and Src family kinases in neutrophils spreading over fibrinogen. J. Immunol. 158:1902.[Abstract]
  26. Bolen, J. B., J. S. Brugge. 1997. Leukocyte protein tyrosine kinases: potential targets for drug discovery. Annu. Rev. Immunol. 15:371.[Medline]
  27. Turner, M., E. Schweighoffer, F. Colucci, J. P. Di Santo, V. L. Tybulewicz. 2000. Tyrosine kinase SYK: essential functions for immunoreceptor signalling. Immunol. Today 21:148.[Medline]
  28. Jiang, A., A. Craxton, T. Kurosaki, E. A. Clark. 1998. Different protein tyrosine kinases are required for B cell antigen receptor-mediated activation of extracellular signal-regulated kinase, c-Jun NH2-terminal kinase 1, and p38 mitogen-activated protein kinase. J. Exp. Med. 188:1297.[Abstract/Free Full Text]
  29. Craxton, A., A. Jiang, T. Kurosaki, E. A. Clark. 1999. Syk and Bruton’s tyrosine kinase are required for B cell antigen receptor-mediated activation of the kinase Akt. J. Biol. Chem. 274:30644.[Abstract/Free Full Text]
  30. Tsuchida, S., S. Yanagi, R. Inatome, J. Ding, P. Hermann, T. Tsujimura, N. Matsui, H. Yamamura. 2000. Purification of a 72-kDa protein-tyrosine kinase from rat liver and its identification as Syk: involvement of Syk in signaling events of hepatocytes. J. Biochem. 127:321.[Abstract/Free Full Text]
  31. Okamura, S., C. C. Ng, K. Koyama, Y. Takei, H. Arakawa, M. Monden, Y. Nakamura. 1999. Identification of seven genes regulated by wild-type p53 in a colon cancer cell line carrying a well-controlled wild-type p53 expression system. Oncol. Res. 11:281.[Medline]
  32. Coopman, P. J., M. T. Do, M. Barth, E. T. Bowden, A. J. Hayes, E. Basyuk, J. K. Blancato, P. R. Vezza, S. W. McLeskey, P. H. Mangeat, S. C. Mueller. 2000. The Syk tyrosine kinase suppresses malignant growth of human breast cancer cells. Nature 406:742.[Medline]
  33. Takada, Y., A. Mukhopadhyay, G. C. Kundu, G. H. Mahabeleshwar, S. Singh, B. B. Aggarwal. 2003. Hydrogen peroxide activates NF-{kappa}B through tyrosine phosphorylation of I{kappa}B{alpha} and serine phosphorylation of p65: evidence for the involvement of I{kappa}B{alpha} kinase and Syk protein-tyrosine kinase. J. Biol. Chem. 278:24233.[Abstract/Free Full Text]
  34. Straus, D. B., A. Weiss. 1992. Genetic evidence for the involvement of the lck tyrosine kinase in signal transduction through the T cell antigen receptor. Cell 70:585.[Medline]
  35. Majumdar, S., B. B. Aggarwal. 2001. Methotrexate suppresses NF-{kappa}B activation through inhibition of I{kappa}B{alpha} phosphorylation and degradation. J. Immunol. 167:2911.[Abstract/Free Full Text]
  36. Manna, S. K., A. Mukhopadhyay, B. B. Aggarwal. 2000. IFN-{alpha} suppresses activation of nuclear transcription factors NF-{kappa}B and activator protein 1 and potentiates TNF-induced apoptosis. J. Immunol. 165:4927.[Abstract/Free Full Text]
  37. Chaturvedi, M. M., A. Mukhopadhyay, B. B. Aggarwal. 2000. Assay for redox-sensitive transcription factor. Methods Enzymol. 319:585.[Medline]
  38. Chan, A. C., M. Iwashima, C. W. Turck, A. Weiss. 1992. ZAP-70: a 70 kd protein-tyrosine kinase that associates with the TCR{zeta} chain. Cell 71:649.[Medline]
  39. Oliver, J. M., D. L. Burg, B. S. Wilson, J. L. McLaughlin, R. L. Geahlen. 1994. Inhibition of mast cell Fc{epsilon}R1-mediated signaling and effector function by the Syk-selective inhibitor, piceatannol. J. Biol. Chem. 269:29697.[Abstract/Free Full Text]
  40. Livolsi, A., V. Busuttil, V. Imbert, R. T. Abraham, J. F. Peyron. 2001. Tyrosine phosphorylation-dependent activation of NF-{kappa}B: requirement for p56 LCK and ZAP-70 protein tyrosine kinases. Eur J. Biochem. 268:1508.[Medline]
  41. Tuschl, T.. 2002. Expanding small RNA interference. Nat. Biotechnol. 20:446.[Medline]
  42. Giri, D. K., B. B. Aggarwal. 1998. Constitutive activation of NF-{kappa}B causes resistance to apoptosis in human cutaneous T cell lymphoma HuT-78 cells: autocrine role of tumor necrosis factor and reactive oxygen intermediates. J. Biol. Chem. 273:14008.[Abstract/Free Full Text]
  43. Verma, I. M., J. Stevenson. 1997. I{kappa}B kinase: beginning, not the end. Proc. Natl. Acad. Sci. USA 94:11758.[Free Full Text]
  44. Mayo, M. W., C. Y. Wang, P. C. Cogswell, K. S. Rogers-Graham, S. W. Lowe, C. J. Der, A. S. Baldwin, Jr. 1997. Requirement of NF-{kappa}B activation to suppress p53-independent apoptosis induced by oncogenic Ras. Science 278:1812.[Abstract/Free Full Text]
  45. Pomerantz, J. L., D. Baltimore. 2000. Signal transduction: a cellular rescue team. Nature 406:26.[Medline]
  46. Pan, S., P. An, R. Zhang, X. He, G. Yin, W. Min. 2002. Etk/Bmx as a tumor necrosis factor receptor type 2-specific kinase: role in endothelial cell migration and angiogenesis. Mol. Cell. Biol. 22:7512.[Abstract/Free Full Text]
  47. Korchak, H. M., L. E. Kilpatrick. 2001. TNF{alpha} elicits association of PI 3-kinase with the p60TNFR and activation of PI 3-kinase in adherent neutrophils. Biochem. Biophys. Res. Commun. 281:651.[Medline]
  48. Blaukat, A., I. Ivankovic-Dikic, E. Gronroos, F. Dolfi, G. Tokiwa, K. Vuori, I. Dikic. 1999. Adaptor proteins Grb2 and Crk couple Pyk2 with activation of specific mitogen-activated protein kinase cascades. J. Biol. Chem. 274:14893.[Abstract/Free Full Text]
  49. Hildt, E., S. Oess. 1999. Identification of Grb2 as a novel binding partner of tumor necrosis factor (TNF) receptor I. J. Exp. Med. 189:1707.[Abstract/Free Full Text]
  50. Belka, C., K. Wiegmann, D. Adam, R. Holland, M. Neuloh, F. Herrmann, M. Kronke, M. A. Brach. 1995. Tumor necrosis factor (TNF)-{alpha} activates c-raf-1 kinase via the p55 TNF receptor engaging neutral sphingomyelinase. EMBO J. 14:1156.[Medline]
  51. Muller, G., P. Storz, S. Bourteele, H. Doppler, K. Pfizenmaier, H. Mischak, A. Philipp, C. Kaiser, W. Kolch. 1998. Regulation of Raf-1 kinase by TNF via its second messenger ceramide and cross-talk with mitogenic signalling. EMBO J. 17:732.[Medline]
  52. Minden, A., A. Lin, M. McMahon, C. Lange-Carter, B. Derijard, R. J. Davis, G. L. Johnson, M. Karin. 1994. Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science 266:1719.[Abstract/Free Full Text]
  53. Singh, S., B. G. Darnay, B. B. Aggarwal. 1996. Site-specific tyrosine phosphorylation of I{kappa}B{alpha} negatively regulates its inducible phosphorylation and degradation. J. Biol. Chem. 271:31049.[Abstract/Free Full Text]
  54. Ashikawa, K., S. Majumdar, S. Banerjee, A. C. Bharti, S. Shishodia, B. B. Aggarwal. 2002. Piceatannol inhibits TNF-induced NF-{kappa}B activation and NF-{kappa}B-mediated gene expression through suppression of I{kappa}B{alpha} kinase and p65 phosphorylation. J. Immunol. 169:6490.[Abstract/Free Full Text]
  55. Shi, C. S., J. H. Kehrl. 2001. PYK2 links Gq{alpha} and G13{alpha} signaling to NF-{kappa}B activation. J. Biol. Chem. 276:31845.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. Ding, N. C. Kirkiles-Smith, and J. S. Pober
FOXO3a Regulates Oxygen-responsive Expression of Tumor Necrosis Factor Receptor 2 in Human Dermal Microvascular Endothelial Cells
J. Biol. Chem., July 17, 2009; 284(29): 19331 - 19339.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Pincheira, A. F. Castro, O. N. Ozes, P. S. Idumalla, and D. B. Donner
Type 1 TNF Receptor Forms a Complex with and Uses Jak2 and c-Src to Selectively Engage Signaling Pathways That Regulate Transcription Factor Activity
J. Immunol., July 15, 2008; 181(2): 1288 - 1298.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. Bijli, F. Fazal, M. Minhajuddin, and A. Rahman
Activation of Syk by Protein Kinase C-{delta} Regulates Thrombin-induced Intercellular Adhesion Molecule-1 Expression in Endothelial Cells via Tyrosine Phosphorylation of RelA/p65
J. Biol. Chem., May 23, 2008; 283(21): 14674 - 14684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. A. Yaghini, F. Li, and K. U. Malik
Expression and Mechanism of Spleen Tyrosine Kinase Activation by Angiotensin II and Its Implication in Protein Synthesis in Rat Vascular Smooth Muscle Cells
J. Biol. Chem., June 8, 2007; 282(23): 16878 - 16890.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
M. Ulanova, S. Asfaha, G. Stenton, A. Lint, D. Gilbertson, A. Schreiber, and D. Befus
Involvement of Syk protein tyrosine kinase in LPS-induced responses in macrophages
Innate Immunity, April 1, 2007; 13(2): 117 - 125.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
C.-K. Lee, H. M. Lee, H. J. Kim, H.-J. Park, K.-J. Won, H. Y. Roh, W. S. Choi, B. H. Jeon, T.-K. Park, and B. Kim
Syk contributes to PDGF-BB-mediated migration of rat aortic smooth muscle cells via MAPK pathways
Cardiovasc Res, April 1, 2007; 74(1): 159 - 168.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gururajan, T. Dasu, S. Shahidain, C. D. Jennings, D. A. Robertson, V. M. Rangnekar, and S. Bondada
Spleen Tyrosine Kinase (Syk), a Novel Target of Curcumin, Is Required for B Lymphoma Growth
J. Immunol., January 1, 2007; 178(1): 111 - 121.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. S. Ahn, G. Sethi, and B. B. Aggarwal
Embelin, an Inhibitor of X Chromosome-Linked Inhibitor-of-Apoptosis Protein, Blocks Nuclear Factor-{kappa}B (NF-{kappa}B) Signaling Pathway Leading to Suppression of NF-{kappa}B-Regulated Antiapoptotic and Metastatic Gene Products
Mol. Pharmacol., January 1, 2007; 71(1): 209 - 219.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Schymeinsky, A. Sindrilaru, D. Frommhold, M. Sperandio, R. Gerstl, C. Then, A. Mocsai, K. Scharffetter-Kochanek, and B. Walzog
The Vav binding site of the non-receptor tyrosine kinase Syk at Tyr 348 is critical for beta2 integrin (CD11/CD18)-mediated neutrophil migration
Blood, December 1, 2006; 108(12): 3919 - 3927.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Wang, C. Lau, S. Wiehler, A. Pow, T. Mazzulli, C. Gutierrez, D. Proud, and C.-W. Chow
Syk Is Downstream of Intercellular Adhesion Molecule-1 and Mediates Human Rhinovirus Activation of p38 MAPK in Airway Epithelial Cells
J. Immunol., November 15, 2006; 177(10): 6859 - 6870.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gururajan, C. D. Jennings, and S. Bondada
Cutting Edge: Constitutive B Cell Receptor Signaling Is Critical for Basal Growth of B Lymphoma
J. Immunol., May 15, 2006; 176(10): 5715 - 5719.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H.-S. Cha, D. L. Boyle, T. Inoue, R. Schoot, P. P. Tak, P. Pine, and G. S. Firestein
A Novel Spleen Tyrosine Kinase Inhibitor Blocks c-Jun N-Terminal Kinase-Mediated Gene Expression in Synoviocytes
J. Pharmacol. Exp. Ther., May 1, 2006; 317(2): 571 - 578.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. G. Eliopoulos, S. Das, and P. N. Tsichlis
The Tyrosine Kinase Syk Regulates TPL2 Activation Signals
J. Biol. Chem., January 20, 2006; 281(3): 1371 - 1380.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takada, Y.
Right arrow Articles by Aggarwal, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takada, Y.
Right arrow Articles by Aggarwal, B. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS