| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
-Mediated Innate Signal Amplification and STAT1 Phosphorylation in Resident Murine Alveolar Macrophages1
,
,
* Pulmonary and Critical Care Medicine Section, and Research Service, Department of Veterans Affairs Medical Center, Ann Arbor, MI 48105; and
Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, and
Graduate Program in Immunology, University of Michigan Health System, Ann Arbor, MI 48109
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) TLR4 or TLR3 by pathogen-associated molecular patterns (PAMPs) typically induces type I IFN-
, leading to autocrine activation of the transcription factor STAT1. Because it is unknown whether STAT1 plays a similar role in the lungs, we studied the response of resident alveolar macrophages (AM) or control PM from normal C57BL/6 mice to stimulation by PAMPs derived from viruses (polyriboinosinic:polyribocytidylic acid, specific for TLR3) or bacteria (Pam3Cys, specific for TLR2, and repurified LPS, specific for TLR4). AM did not activate STAT1 by tyrosine phosphorylation on Y701 following stimulation of any of these three TLRs, but readily did so in response to exogenous IFN-. This unique AM response was not due to altered TLR expression, or defective immediate-early gene response, as measured by expression of TNF-
and three chemokines. Instead, AM differed from PM in not producing bioactive IFN-, as confirmed by ELISA and by the failure of supernatants from TLR-stimulated AM to induce STAT1 phosphorylation in PM. Consequently, AM did not produce the microbicidal effector molecule NO following TLR4 or TLR3 stimulation unless exogenous IFN- was also added. Thus, murine AM respond to bacterial or viral PAMPs by producing inflammatory cytokines and chemokines, but because they lack the feed-forward amplification typically mediated by autocrine IFN- secretion and STAT1 activation, require exogenous IFN to mount a second phase of host defense. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Alveolar macrophages (AM)3 are the principal phagocytes at the lung mucosal surface and the likely initiators of local pulmonary innate immune responses. AM are believed to be central to the pathogenesis of chronic bronchitis and emphysema (2). We, and others, have shown that AM possess many unique characteristics relative to other tissue macrophages (M). AM avidly ingest a wide range of pathogens or inert particles, but largely eschew apoptotic cells (3, 4, 5), which could suppress their capacity to initiate immune responses (6). This difference in apoptotic cell ingestion relative to other M results from differences both in apoptotic cell adhesion and in expression of the essential PKC II isoform (7, 8, 9). In addition, murine AM differ from PM in constitutively expressing high levels of peroxisome proliferator-activated receptor-
(10), which could reduce their ability to induce inflammatory mediators. Furthermore, AM can migrate to regional lymph nodes (11), but due to their very reduced expression of costimulatory molecules, have limited ability to activate naive T cells (12, 13, 14). Finally, human AM have been found to regulate both Ref-1 and AP-1 DNA-binding activity uniquely when compared with monocytes (15). These properties imply that the AM phenotype is highly evolved to tackle the unique challenges of protecting the alveolar environment without inducing excessive inflammation. However, the specialized features of the AM response to pathogens have only begun to be investigated (16, 17).
The selectivity and specificity of the M response to pathogens depends on innate immune receptors such as TLRs that recognize pathogen-associated molecular patterns (PAMPs) unique to microorganisms (18, 19). TLR triggering recruits adaptor molecules, such as MyD88, which contain a Toll-IL-1R-resistance (TIR) domain (19, 20). Recruitment of specific adaptors ultimately leads to increased expression and activation of host defense molecules (20). Type I IFN- is among the most pivotal of such defense molecules (21, 22). IFN- is an essential cofactor for the induction of IFN- in response to Gram-negative bacteria (23), and is required for the maturation of dendritic cells induced by dsRNA or viral infection in vitro (24). IFN- acts in an autocrine/paracrine fashion through its cognate receptor and the receptor-associated kinases Jak1 and Tyk2 to induce tyrosine phosphorylation of the transcription factor STAT1 (25). Phosphorylation of STAT1 at tyrosine 701 (Y701) alone is sufficient to generate STAT dimers that have DNA transcriptional activity, although maximal trans-activating efficiency requires additional phosphorylation at serine residues (25). Activated STAT1 induces a host of antimicrobial genes, including IFN- itself. STAT1 also regulates inducible NO synthase (iNOS), which catalyzes the production of the potent antiviral and antimicrobial effector molecule NO (26, 27). The degree to which effective antiviral and antibacterial responses depend on homodimerized STAT1 is amply demonstrated by the immunocompromise seen in STAT1-deficient animals or humans (28, 29, 30, 31).
Given the central role of STAT1 in the innate immune response to diverse pathogens, the purpose of this study was to determine whether this pathway is operative and functional in resident murine AM. To this purpose, we used purified ligands to stimulate TLRs involved in bacterial (TLR4 or TLR2) or viral (TLR3) recognition. Results indicate that, unlike control resident peritoneal M (PM), resident murine AM do not activate STAT1 in response to any of these stimuli due to absence of autocrine/paracrine production of IFN-. This unique response by murine AM does not result from abnormalities in expression of STAT1 or individual TLRs, signaling through the MyD88-dependent or MyD88-independent pathways, or functional integrity of the IFN- receptor complex. Consequently, AM are incapable of producing NO in response to TLR4 or TLR3 stimulation, unless costimulated by exogenous IFN-.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Specific pathogen-free female C57BL/6, CD-1, and C3H/HeN mice were purchased from Charles River Laboratories (Wilmington, MA), and C3H/HeJ mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were obtained at 7–8 wk of age and used at 8–14 wk of age. Mice were housed in the Animal Care Facility at the Ann Arbor Veterans Affairs Medical Center, which is fully accredited by the American Association for Accreditation of Laboratory Animal Care. Mice were fed standard chow (5008 Formulab Diet; PMI Nutrition International, Brentwood, MO) and chlorinated water ad libitum. This study followed a protocol approved by the Animal Care Committee of the local institutional review board, and complied with the latest version of the Guide for the Care and Use of Laboratory Animals (National Academy of Sciences; www.nap.edu/readingroom/books/labrats/).
Isolation and culture of M
Mice were euthanized by asphyxia in a high CO2 environment or in some experiments with a high dose of i.p. sodium pentobarbital. Resident AM and PM were harvested and cultured as previously described (32). M were cultured in complete culture medium (RPMI 1640 containing 10% heat-inactivated FBS, 25 mM HEPES, 2 mM L-glutamine, 1 mM pyruvate, 100 U/ml penicillin/streptomycin (Invitrogen Life Technologies, Carlsbad, CA), and 55 µM 2-ME (Sigma-Aldrich, St. Louis, MO)) at 8 x 105 cells/well in 24-well tissue culture plates (Costar, Corning, NY) for Western blot or RT-PCR analysis, or at 4 x 104 cells/well in 96-well tissue culture plates (Costar) for ELISA. M were stimulated for the indicated times either with LPS (Escherichia coli 0111:B4, Sigma-Aldrich), with the synthetic bacterial lipoprotein (LP) analog Pam3-Cys-Ser-Lys-Lys-Lys-Lys-OH (Pam3Cys; EMC Microcollections, Tubingen, Germany), or with polyriboinosinic:polyribocytidylic acid (poly(I:C); Amersham Biosciences, Piscataway, NJ). The LPS preparation had been repurified before use by means of phenol re-extraction (33) to remove protein contaminants; the adequacy of this technique was verified in control experiments by ablation of cytokine production by PM of C3H/HeJ mice (data not shown). In some experiments, recombinant murine IFN- or IFN- (both from R&D Systems, Minneapolis, MN) were added to M cultures at the indicated doses.
Immunostaining and flow cytometry
Freshly isolated M were used to analyze expression of TLR4 or TLR2 receptors. TLR4 was identified by staining with mAb MTS510, which preferentially reacts with TLR4 in physical association with MD-2 (34), and TLR2 by staining with the mAb 6C2 (both from eBioscience, San Diego, CA). M were washed twice in staining buffer (Difco, Detroit, MI), resuspended in 100 µl of staining buffer, and incubated for 30 min at 4°C with saturating amounts of mAbs as previously described (4). FcR was blocked using anti-CD16/32 and peritoneal B cells were excluded based on staining with FITC-labeled CD19. Appropriate isotype-matched controls were used in all experiments. After incubation, cells were washed twice and analyzed immediately using a FACScan cytometer (BD Biosciences, Mountain View, CA) running CellQuest software on a PowerPC computer (Apple, Cupertino, CA) for data analysis, as previously described (32). A minimum of 10,000 viable cells was analyzed to determine cell surface receptor expression.
Cytokine/chemokine ELISA
M cultures were stimulated for 6 h with the specified reagents at the indicated doses, and the concentrations of TNF-, RANTES (CCL5), MIP-1 (CCL3), and MIP-1 (CCL4) in the supernatants were determined by ELISA, using Duo Set Development Systems (R&D Systems). The lower-detection limit of these assays was 30 pg/ml for TNF-, 30 pg/ml for RANTES, 10 pg/ml for MIP-1, and 15 pg/ml for MIP-1. IFN- was measured by a custom-designed ELISA as originally described (35) with few modifications. Briefly, Maxi-Sorp 96-well plates (Nalge Nunc International, Rochester NY) were coated overnight at 4°C with 100 µl of a 1 µg/ml solution of rat anti-mouse IFN- mAb 7F-D3 (Seikagaku America, Falmouth, MA). The wells were then washed and blocked in PBS containing 1% BSA, 5% sucrose, and 0.05% NaN3 (all from Sigma-Aldrich) for 2 h at room temperature. After washing, 100 µl of culture supernatant from 105 M or recombinant murine IFN- standard were added overnight at 4°C. Plates were then washed, and 100 µl of rabbit anti-mouse IFN- polyclonal Ab (400 neutralizing U/ml; R&D Systems) were added to each well overnight at 4°C. Plates were then washed, and 100 µl of a 1/2000 dilution of goat anti-rabbit IgG-HRP (Pierce, Rockford, IL) were added to each well for 2 h at room temperature. Plates were then washed and 100 µl of ImmunoPure TMB substrate (Pierce) were added to each well, and the color was developed for 20 min. The reaction was terminated by the addition of 100 µl/well of 1 N H2SO4, and the plate was read at 450 nm. The amount of IFN- in the supernatant was determined by interpolation from a standard curve. The lower limit of detection of this assay was 2.5 U/ml.
RNA preparation and RT-PCR analysis
Total RNA was isolated from adherent AM and PM using TRIzol (Invitrogen Life Technologies). Contaminant genomic DNA was removed by DNase treatment (DNA-free; Ambion, Austin, TX). RT-PCR were performed using a kit from Invitrogen Life Technologies. The primer sets used were the following: for mouse TLR3, forward, GAGGGCTGGAGGATCTCTTTT, and reverse, CCGTTCTTTCTGAACTGGCCA; for mouse IFN-, forward, CCATCATGAACAACAGGTGGA, and reverse, CAGGTCTTCAGTTTTGGAAGT; for the mouse housekeeping gene cyclophilin, forward, CGCAATATGAAGGTGCTC, and reverse, CTCTCTACTCCTTGGCAA. The expected PCR products were analyzed on a 2% agarose gel and stained as previously described (9).
Real-time PCR and comparative quantitation analysis
For real-time analysis, total RNA was prepared from control and stimulated cells using Absolutely RNA RT-PCR miniprep kit (Stratagene, La Jolla, CA) following the manufacturer’s instructions. DNase-treated, total RNA was converted to cDNA and subsequently to specific PCR products using Brilliant SYBR Green QRT-PCR master mix kit, 1 step (Stratagene), as per manufacturer’s instructions. cDNA conversion, amplification, and data analysis were performed using a Mx3000P real-time PCR system computerized cycler from Stratagene. We used the following primers, designed using software available at http://labtools.stratagene.com (Stratagene) and synthesized and HPLC-purified by Invitrogen Life Technologies: IFN-, sense, ACTAGAGGAAAAGCAAGAGGA, and antisense, CTGGTAAGTCTTCGAATGATG; and GAPDH, sense, TATGTCGTGGAGTCTACTGGT, and antisense, GAGTTGTCATATTTCTCGTGG. Primers were used at 75 nM each in 25-µl reactions. Cycle parameters were as follows: 40 min at 55°C for the reverse transcription step, followed by a denaturation step at 95°C for 10 min, and 40 cycles composed of 30-s denaturation at 95°C, 1-min annealing at 56°C, and 30-s polymerization at 72°C. Control wells containing no template were used to exclude the presence of contaminating template molecules and to identify potential primer-dimer products from the dissociation curve analysis. Total RNA from each sample was analyzed in triplicate for IFN- and GAPDH mRNA in separate wells. For analysis, the fluorescence values of the threshold cycles were collected at the end of the annealing step from each reaction (36). The threshold cycle values obtained from GAPDH amplification were used to normalize IFN- mRNA quantification (36). Data are expressed as relative increase of specific mRNA in the treated samples compared with the untreated control sample, which was used as calibrator for IFN- expression. To correct for possible volume differences, transparency of the caps, or other well-to-well differences, the passive reference dye 5(6)-carboxy-X-rhodamine-C5-maleimide (also known as ROX; Stratagene) was used in all reactions. A dissociation curve analysis was included in the experiments to verify the absence of nonspecific products such as primer-dimers. Finally, the inclusion during the assay of a standard curve for each mRNA sampled (IFN- and GAPDH) allowed for correction of the results during the analysis steps using the amplification efficiencies of each reaction.
Cell extracts and Western blot analysis
Cells were lysed in lysis buffer (1% Triton X-100, 150 mM NaCl, 25 mM Tris (pH 7.8), 1 mM EDTA, 2 mM EGTA, 10 mM -glycerophosphate, 1 mM sodium orthovanadate, 50 mM sodium fluoride, and a protease inhibitor mixture (P8340; Sigma-Aldrich)). For Western blotting, the cell extract was centrifuged at 10,000 x g, and the supernatant containing the cytosolic extract was run onto a 12% SDS-PAGE under reducing and denaturing conditions. Proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA) using 10 mM 3-cyclohexylamino-1-propanesulfonic acid (pH 10.0; Calbiochem-Novabiochem, San Diego, CA) and 5% methanol as transfer buffer, as previously described (32). After incubating membranes in blocking buffer (5% low-fat milk in 100 mM Tris-HCl (pH 7.5), NaCl (145 mM), and 0.05% Tween 20; TBST), primary Abs were added, and membranes were incubated overnight at 4°C with gentle rocking. The Abs used were anti-STAT1, which recognizes both the 91- and 84-kDa forms of the protein; anti-phospho-STAT1, which detects both isoforms only when activated by phosphorylation at tyrosine 701; and anti-phospho-NF-
B p65 (all from Cell Signaling Technology, Beverly, MA). Membranes, washed twice in TBST, were incubated with the appropriate HRP-conjugated secondary Ab (Pierce). Chemiluminescence was developed by adding a peroxidase/luminol-based substrate (SuperSignal West Femto Maximum Sensitivity; Pierce). Signals were detected using radiographic film (X-Omat AR; Kodak, Rochester, NY). For reprobing, blots were incubated at 55°C for 40 min in Restore Western Blot stripping buffer (Pierce).
Supernatant exchange experiments
As a specific bioassay for murine IFN-, we measured the ability of supernatants of stimulated M to induce STAT1 phosphorylation in a second group of unstimulated responder M, as previously reported (26). Briefly, adherent PM were cultured at 8 x 105 cells/well in 24-well tissue culture plates, rinsed twice with warm complete culture medium, and covered with 350 µl of fresh medium. To stimulate IFN- production, LPS or poly(I:C) were added at the indicated doses to some wells. After 3 h, the supernatants were collected and incubated in the presence of 10 µg/ml polymixin B (Sigma-Aldrich) either with or without the addition of 5 x 103 neutralization U/well rabbit anti-mouse IFN- (R&D Systems) for 30 min at room temperature. At the end of this treatment, the supernatants were layered on top of unstimulated resident AM or PM (responder cells). Lysates from the responder cells were harvested after 30 min and subjected to Western blot analysis as specified above to assess STAT1 phosphorylation. In the reciprocal form of the experiment, supernatant from AM treated in the same fashion were added to unstimulated resident PM as described above.
Nitrite assay
NO synthesis was measured as nitrite accumulation in cell culture supernatants using the Griess reagent as previously described (37). M were plated in complete culture medium at 1 x 105 cells/well in 96-well tissue culture plates (Costar), and nitrite content was assessed after 72 h of stimulation. Specific absorbance at 550 nM was detected using a µQuant KC4 plate reader (Bio-Tek Instruments, Highland Park, VT). Sodium nitrite dissolved in complete culture medium was used to generate a standard concentration curve.
Statistical analysis
Data were expressed as the mean ± SEM. Samples were compared by an unpaired two-tailed Student t test analysis. Statistical calculations were performed using Statview, version 5.0, and Super ANOVA, version 1.11 (SAS Institute, Cary, NC), on a Macintosh PowerPC G4 computer. Significant differences were defined as p < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
do not activate STAT1 in response to TLR4 or TLR3 stimulation, but do so in response to exogenous IFNs
Development of a robust and sustained antibacterial or antiviral defense program by M depends crucially on tyrosine phosphorylation of the transcription factor STAT1 (25). Accordingly, we first sought to determine whether resident AM responded to TLR4, TLR2, or TLR3 stimulation by phosphorylating STAT1 at Y701. PM responded by 2.5 h to stimulation via TLR4 or TLR3 with tyrosine phosphorylation of STAT1 (Fig. 1A, top panel). However, PM did not phosphorylate STAT1 in response to stimulation via TLR2. This result agrees with previous studies showing that TLR2 does not induce IFN- production (38, 39). Importantly, by contrast, resident AM did not show STAT1 phosphorylation in response to stimulation of any of the three TLRs (Fig. 1B, top panel). Reprobing of the same Western blots showed that this lack of tyrosine phosphorylation did not result from absence of STAT1, which was abundant in AM (Fig. 1B, bottom panel). Experiments using AM and PM from C3H/HeN mice showed similar results (not shown), confirming that our results were not unique to the C57BL/6 strain.
|
have a defect at or distal to the IFN-R (i.e., absence or dysfunction of IFN-Rs or of the Jak1/Tyk2 kinases associated with them) that prevented their response to autocrine IFN- production. To test the integrity of this signaling pathway, murine M were exposed to 100 U/ml IFN- or 10,000 U/ml IFN- for 15 or 45 min, and then the cell extracts were analyzed by Western blot for STAT1 tyrosine phosphorylation. As expected, PM responded promptly to both exogenous IFN- (Fig. 1C, top panel, lanes IFN-) and IFN- (lanes IFN-). The response of AM was similar (Fig. 1D, top panel), although in both cases somewhat less vigorously sustained. These results indicate that resident murine AM possess both functional IFN-Rs (and IFN-Rs) and functional Jak1/Jak2/Tyk2 kinases.
To exclude the possibility that STAT1 activation might be more rapid in AM than in PM, and thus missed in the experiments shown in Fig. 1B, we also examined the effect of TLR4 stimulation of these cells for 15 or 45 min. Once again, no STAT1 activation could be observed at any time point in AM (Fig. 1D, top panel, lanes LPS), whereas PM phosphorylated STAT1 at 120 min (Fig. 1C, top panel, lanes LPS). Finally, the uniqueness of the lack of STAT1 response is underscored by the fact that AM did increase the amount of the phosphorylated form of the p65 subunit of NF-B (Fig. 1D, bottom panel, lanes LPS) (as well as of the activated forms of MAPK p38, JNK, and ERK; not shown) in response to TLR4 stimulation in a manner very similar to PM (Fig. 1C, bottom panel, lanes LPS).
TLR expression and both MyD88-dependent and -independent signaling pathways are functional in resident AM
Another potential alternative explanation for the observed results was that AM differ in expression of TLRs, or in the proximal signaling pathways that they activate. Because neither of these factors has been described previously in murine AM, we next measured expression of TLR4, TLR2, and TLR3. AM expressed TLR4 and TLR2 as evidenced by flow cytometry (Fig. 2A) and Western blotting (not shown). Expression of TLR3 protein could not be tested, because no Ab against this mouse molecule is available. RT-PCR showed that AM abundantly expressed mRNA for TLR3 (Fig. 2B), as well as for TLR4 and TLR2 (not shown).
|
, we measured the products of several immediate-early genes that they activate. We found that both AM and control PM produced substantial amounts of TNF- when stimulated via TLR2 (using the lipopetide Pam3Cys (LP) (40, 41)) (Fig. 3A). Because TNF- is produced in response to TLR2 stimulation only through the MyD88-dependent pathway (40), these data indicate that this pathway is intact in AM. Additionally, both types of M produced substantial amounts of TNF- when stimulated via TLR4 (using purified LPS), or TLR3 (using poly(I:C)) (Fig. 3A). These latter TLRs are known to signal via both MyD88-dependent and -independent mechanisms (19, 42, 43).
|
chemokine RANTES (CCL5) (40, 41). RANTES induction requires activation of the transcription factor IFN-regulatory factor 3 (IRF-3) via the MyD88-independent pathway, either through the adaptor molecule TIR domain-containing adaptor inducing IFN- (also known as TRIF) (in the case of TLR3 or TLR4 stimulation) or through TIR domain-containing adaptor inducing IFN--related adaptor molecule (also known as TRAM) (in the case of TLR4 stimulation) (19, 42, 43). We detected RANTES secretion following stimulation via either TLR4 or TLR3, both in PM (as anticipated) and in AM (Fig. 3B). By contrast, RANTES secretion was absent on stimulation of either PM or AM via TLR2, which does not activate the MyD88-independent pathway (38, 40). Collectively, these data show that murine AM respond to stimulation by bacterial and viral PAMPs through both the MyD88-dependent and -independent pathways with an immediate inflammatory program that is comparable to the response of PM.
Two other chemokines, MIP-1 (CCL3) and MIP-1 (CCL4), have recently been shown to modulate mucosal adaptive immunity in the same way as RANTES (44, 45). Consequently, it was of particular interest to us to test whether MIP-1 and MIP-1 would also be secreted by resident murine AM upon stimulation of TLR4 or TLR3, but not TLR2, as RANTES is. Surprisingly, in both types of tissue M, MIP-1 production was observed with stimulation of all three TLRs (Fig. 3C), whereas MIP-1 production was seen only on stimulation via TLR4 or TLR3, but not TLR2 (D). This last point implies that MIP-1 production is stimulated by the MyD88-independent pathway. Because RANTES production depends on binding of the transcription factor IRF-3 to cis-elements termed IFN-stimulated response elements (also known as ISRE) in the 5' regulatory region of the RANTES gene (38, 46), we examined the promoter regions of the other two murine chemokines (GenBank accession nos. X53372 and S61348) for the presence of an IFN-stimulated response element sequence, using TESS promoter analysis software (www.cbil.upenn.edu/tess/). A matching consensus sequence was identified in the promoter of murine MIP-1 (AGAAACTGAAGT), but not in the murine MIP-1 promoter region. These results demonstrate the capacity of individual TLRs to induce distinctive patterns of chemokine secretion from tissue M.
Defective production of IFN- by AM in response to TLR4 or TLR3 stimulants
To define why murine AM did not activate STAT1 following stimulation with bacterial or viral PAMPs, we next investigated IFN- production. We first used STAT1 phosphorylation without or together with neutralizing Abs as a bioassay for IFN- production (26). We reasoned that, if the autocrine/paracrine IFN- pathway was intact, the cytokine present in the supernatant of stimulated AM should induce STAT1 phosphorylation in unstimulated PM (which possess functional IFN-Rs (Fig. 1C)), even in the absence of additional stimulation via TLRs. We found that AM supernatant did not induce detectable STAT1 phosphorylation in PM (Fig. 4A, top panel), implying that AM did not produce bioactive IFN-. By contrast, AM themselves readily phosphorylated STAT1 in response to supernatant of stimulated PM (Fig. 4B, top panel, lanes 2 and 4), and the response was markedly reduced by Ab against IFN- (lanes 3 and 5). These results are further evidence that murine AM have intact IFN-Rs associated with functional Jak1/Tyk2 kinases. As anticipated, naive PM did respond with STAT1 phosphorylation when treated with supernatant from LPS- or poly(I:C)-stimulated PM (Fig. 4C, top panel). These experiments suggested that resident murine AM were unable to transcribe, translate, and/or secrete IFN- upon TLR4 or TLR3 stimulation.
|
mRNA concentrations using RT-PCR. This analysis showed that PM were devoid of IFN- mRNA at baseline, and strongly up-regulated expression in response to stimulation via TLR4 or TLR3, but not TLR2 (Fig. 5A, top panel), in agreement with previously published data (39, 41). By the same logic reported above for the chemokines, these results imply that the IFN- gene is under transcriptional regulation in PM and is activated by the MyD88-independent pathway. By contrast, AM reproducibly expressed detectable basal levels of IFN- mRNA (Fig. 5B, top panel) and appeared to strongly up-regulate IFN- mRNA expression upon stimulation via TLR4 or TLR3 and slightly with TLR2 (Fig. 5B, top panel). To better quantify the levels of mRNA expression upon stimulation, we used real-time quantitative PCR (see Materials and Methods). These experiments confirmed the results obtained with the traditional PCR, and offered a more reliable analysis of the modulation of mRNAs (Fig. 5C). Collectively, these results show that, in AM, IFN- mRNA levels differ from what was observed in PM both in untreated cells and in response to TLR stimulation.
|
protein levels in the absence of commercially available ELISA kits for murine IFN-, we used a custom-made ELISA, as previously described by Weinstein et al. (35). Supernatant from AM that had been stimulated for 3 h with LPS, LP, or poly(I:C) failed to reveal any detectable presence of the cytokine, whereas PM promptly secreted IFN- following TLR4- or TLR3-triggering stimuli (Fig. 5D). Importantly, experiments performed using AM and PM from outbred CD-1 mice showed these same results (not shown), confirming that the lack of IFN- secretion upon TLR4 or TLR3 stimulation is unique to AM and is not dependent on the mouse strain used. Additionally, absence of IFN- secretion upon TLR4 or TLR3 stimulation was also observed in AM obtained from animals euthanized using i.p. sodium pentobarbital in place of carbon dioxide inhalation (not shown); this result confirmed that lung exposure to the gas was not the reason for the observed phenomenon. These results agree with those of the supernatant-swapping experiments (Fig. 4) and indicate that AM do not produce detectable IFN- following TLR4 or TLR3 stimulation.
AM secrete NO in response to exogenous administration of IFN- plus TLR4 or TLR3 stimulation
Upon PM stimulation by LPS, the activation of the autocrine/paracrine IFN- pathway is responsible for the induction of iNOS and production of NO (26). We reasoned that, in the absence of this pathway, AM would not be capable of responding to TLR4 or TLR3 stimulation with NO secretion. Indeed, when NO production was assessed by nitrite measurements in the supernatants of cell stimulated with LPS or poly(I:C), this was the case (Fig. 6A, lanes LPS – and I:C –). To test whether IFN- was the only factor needed to restore NO production, we then supplemented LPS- or poly(I:C)-stimulated cells with 1,000 U or 10,000 U of the recombinant cytokine. AM responded to both doses with robust NO production (Fig. 6A, lanes LPS, 1 and 10, and I:C, 1 and 10). By contrast, PM responded to stimulation of either TLR4 or TLR3 alone with vigorous NO production (Fig. 6B), as previously published (26, 42). As expected, a neutralizing Ab against mouse IFN- strongly inhibited NO production by PM to either TLR4 or TLR3 stimulation (Fig. 6B, lanes ), confirming the dependence of PM production of NO on the autocrine/paracrine IFN- pathway. Collectively, these results confirm the essential role of IFN- (and STAT1 activation) for NO production in resident murine AM and PM.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
display a unique response to stimulation by viral or bacterial PAMPs that is prompt in its early phase, yet restrained in the later production of potentially damaging effector molecules (Fig. 7). AM abundantly produce the immediate-early gene products TNF-, RANTES, MIP-1, and MIP-1 following TLR stimulation (Figs. 7, no. 3, and 3), allowing for the initiation of inflammation and cellular recruitment in response to lung pathogens. However, AM do not autonomously proceed to autocrine/paracrine IFN- secretion and STAT-1 activation (Figs. 7, no. 4, and 4–6), thus differing from previously described PM or M cell lines. As a consequence, AM do not activate the late inflammatory gene iNOS (Figs. 7, nos. 5–7, and 6), nor presumably other STAT1-dependent genes. We further show that this absence of IFN--mediated signal amplification is not due to defects in TLR expression or proximal signaling, deficient STAT1 expression, or a dysfunctional IFN-R complex. These novel findings form the basis for defining the contribution of resident AM function in pneumonias, chronic bronchitis, and occupational exposures.
|
, distinctive regulation of autocrine loops, permits the innate immune system to tailor local responses with exquisite refinement.
The distinctive characteristics of the resident AM response to pathogens that our data delineate would be predicted to be of considerable evolutionary value. On one hand, this judicious response minimizes the risk of excessive pulmonary inflammation to small quantities of LPS on inhaled fomites (49), or to modest microbial challenges that AM can handle without assistance. Because up-regulation of costimulatory molecules has recently been shown to depend on IFN- production (50), this resident AM phenotype also safeguards against inappropriate T cell stimulation to inhaled Ags. We would predict that only when a certain threshold is exceeded (i.e., in the presence of critical viral or bacterial loads) would there be sufficient production of IFN- or IFN- by alveolar epithelial cells, recruited monocytes, or other inflammatory cells to induce paracrine activation of resident AM. Alteration in the AM threshold level, due to genetic predisposition or to acquired aberration, may explain increased susceptibility to infections in some individuals, and excessive responses that damage the lungs of others.
Conversely, because we show that AM are fully capable of responding to exogenous IFN- or IFN-, it is very likely that AM participate actively in the inflammatory response, once these cytokines are produced by other cell types. Together with our finding that AM possess intact TLR expression and promptly express inflammatory cytokines and chemokines in response to their ligation by PAMPs, these data support the long-standing belief that AM are key cells in host defense of the lungs. Although resident AM from normal mice cannot themselves produce these IFNs, their inflammatory cytokines and chemokines can recruit or activate cell types that do so. Hence, the AM phenotype provides a basal level of restraint that can be elegantly overridden in the presence of serious infection.
Nevertheless, the inability of resident AM from several strains of normal mice to activate STAT1 in response to diverse PAMPs may have important implications for the pathogenesis of chronic bronchitis and other respiratory infections in humans. Given the central role of this transcription factor in host defense against pathogens (28, 29, 30, 31), it is likely that some stealthy species of microorganisms are able to exploit this peculiarity of the AM to initiate chronic lung infections. Relatively defective NO production associated with impaired STAT1 activation by airway epithelial cells from patients with cystic fibrosis has recently been shown to induce susceptibility to infection with human parainfluenza virus 3 in vitro (27). Our data also provide a mechanistic explanation for the recent observation that STAT1 DNA-binding activity was not induced by exposure of resident human AM to M. tuberculosis in vitro, nor was it present in BAL cells from patients with tuberculosis, but that it could be induced in both cases by exogenous rIFN- (51). It is possible that failure of STAT1 activation in this case results from a specific and currently unknown defect induced by the pathogen. However, a more likely explanation is that human resident AM show the same defect in IFN--mediated innate signal amplification that we show in mice, a possibility we are testing. Significantly, treatment of 11 patients infected with M. tuberculosis with aerosolized rIFN-, in combination with antituberculosis drugs, was associated with strikingly improved clinical outcomes (although there was no control group in this arm of the study) and, in the five individuals coinfected with HIV, with decreased viral loads (51). That study showed that exogenous IFN- can induce activation of STAT1 DNA-binding activity, as would be anticipated from the results of our experiments using exogenous IFN. Beneficial effects have also been seen using inhaled IFN- as adjunctive therapy in patients with pulmonary tuberculosis (52). Our results suggest that inhalational therapy using rIFNs merits study as a means of augmenting antimicrobial response of AM in a broader range of clinical situations, e.g., in the prevention of nosocomial pneumonias in the high-risk perioperative period (53).
Our results identified both transcriptional and posttranscriptional differences in the IFN- response of murine AM, relative to other M. In this regard, AM express IFN- mRNA at baseline, and thus differ from resident murine PM, which have been shown by nuclear runoff assays to transcribe IFN- constantly at very low levels, but to accumulate IFN- mRNA rapidly and translate it efficiently following LPS stimulation (54). Indeed our real-time PCR results confirmed a strong up-regulation of IFN- mRNA in AM upon TLR4 or TLR3 stimulation and a very modest, but reproducible increase upon TLR2 stimulation. The latter finding again emphasizes the differences between resident murine AM and PM. The reason for this difference remains to be investigated, but due to the absence of any effect on PM (Fig. 5A, top panel), cannot be attributed to LPS contamination of our LP preparation.
Regulation of IFN- transcription is complex, requiring formation of an enhanceosome that comprises the transcription factors NF-B, IRF-3, and AP-1 (ATF-2-c-Jun) (55, 56). Previous results reported a defective AP-1 binding activity in resident human AM secondary to the low amounts of the redox active protein Ref-1 (15). Because murine AM have intact activation both of NF-B (shown by production of TNF-) and of IRF-3 (shown by the production of RANTES), it is possible that AM have a similar AP-1/Ref-1 defect. However, murine AM do not show defective amounts of the Ref-1 protein compared with PM (not shown). A well-known mechanism used to control mRNAs expression relies on the presence of A+U-rich elements in the 3' untranslated region of the mRNA (57). It has been shown recently that, in human AM, PI3K uses these elements in the 3'-untranslated region of the COX2 gene to destabilize LPS induction of this mRNA (58). Although the murine IFN- mRNA contains several A+U-rich elements in its 3'-untranslated region, when we analyzed the levels of IFN- mRNA in LPS-treated resident murine AM by real-time PCR after a time-course actinomycin D treatment, no significant difference was observed compared with untreated controls up to 1 h after treatment (>85% mRNA remaining; not shown). This latter result appears to exclude mRNA instability as the main reason for the observed absence of IFN- production and points toward a possible active translational block operating in AM. Because a posttranscriptional role for PI3K in IFN- production has been recently hypothesized by Rhee et al. (59), we also tested the effect of the PI3K inhibitor LY294002 (60) on M stimulated by TLR4 or TLR3 agonists. Pretreatment of resident PM with 25 µM LY294002 completely abolished IFN- production in response to these agonists (not shown), extending to resident PM what was previously described for the murine PM cell line RAW264.7 (35) and consistent with a positive regulatory role for PI3K in IFN- production in this cell type. However, AM did not release any IFN- in the same experimental conditions (not shown). Because LY294002 is also an inhibitor of mammalian target of rapamycin (also known as mTOR) (61), our data also exclude a role for mammalian target of rapamycin in the regulation of TLR-mediated IFN- production in AM (35). Considerable additional studies will be needed to fully define the molecular mechanisms regulating the IFN- production in AM.
In summary, we demonstrate that resident murine AM have markedly reduced autocrine/paracrine IFN- production in response to TLR stimuli, leading to failure of STAT1 activation and resultant impaired NO production. Thus, the normal response of resident murine AM to viral and bacterial PAMPs, at once prompt yet restrained, is ideally suited to the unique challenges of defending the alveolar environment while preserving gas-exchanging areas. It will be of considerable interest to determine how the AM phenotype is altered during chronic inflammation, such as that induced by tobacco smoke. Our findings underscore the importance of analyzing the unique features of immune regulation in the pulmonary alveolar environment. Additionally, these results contribute to the theoretic basis for studying the adjuvant use of cytokines to treat or prevent clinically challenging lung infections.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Antonello Punturieri, Research Service (11R), Department of Veterans Affairs Medical Center, 2215 Fuller Road, Ann Arbor, MI 48105-2303. E-mail address: pantonel{at}umich.edu
3 Abbreviations used in this paper: AM, alveolar macrophage; M, macrophage; PM, peritoneal macrophage; PAMP, pathogen-associated molecular pattern; TIR, Toll-IL-1R resistance; iNOS, inducible NO synthase; LP, lipoprotein; poly(I:C), polyriboinosinic:polyribocytidylic acid; IRF-3, IFN-regulatory factor 3.
Received for publication March 4, 2004. Accepted for publication May 14, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, PGE2, and PAF. J. Clin. Invest. 101:890.[Medline]
II by the stereo-specific phosphatidylserine receptor is required for phagocytosis of apoptotic thymocytes by resident murine tissue macrophages. J. Biol. Chem. 277:35906. ligands. Am. J. Physiol. 286:L613.
plays a central role in activation of the p42/44 mitogen-activated protein kinase by endotoxin in alveolar macrophages. J. Immunol. 165:4632., a cofactor in the interferon- production induced by Gram-negative bacteria in mice. J. Exp. Med. 181:953./ signaling to the maturation of dendritic cells induced by double-stranded RNA or viral infection. Proc. Natl. Acad. Sci. USA 100:10872. mediates the lipopolysaccharide-induced activation of transcription factor Stat1 in mouse macrophages: pivotal role of Stat1 in induction of the inducible nitric oxide synthase gene. J. Immunol. 161:4803./ and lethal viral disease in human STAT1 deficiency. Nat. Genet. 33:388.[Medline]
. J. Leukocyte Biol. 67:405.[Abstract]
-induced STAT1/-dependent gene expression in macrophages. Nat. Immunol. 3:392.[Medline]
(TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-B and IFN-regulatory factor-3, in the Toll-like receptor signaling. J. Immunol. 171:4304.B involves the Toll adapters TRAM and TRIF: the Toll-IL-1 receptor adaptor family grows to five members. J. Exp. Med. 198:1043., MIP-1, RANTES, and ATAC/lymphotactin function together with IFN- as type 1 cytokines. Proc. Natl. Acad. Sci. USA 99:6181. and MIP-1 differentially mediate mucosal and systemic adaptive immunity. Blood 101:807.-interferon stimulates signal transduction and gene expression in alveolar macrophages in vitro and in tuberculosis patients. Infect. Immun. 71:2058. in patients with pulmonary tuberculosis. Am. J. Respir. Crit. Care Med. 158:1156. enhanceosome. Cold Spring Harbor Symp. Quant. Biol. 63:609.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. P. Mendez, S. B. Morris, S. Wilcoxen, M. Du, Y. K. Monroy, H. Remmer, H. Murphy, P. J. Christensen, and R. Paine III Disparate mechanisms of sICAM-1 production in the peripheral lung: contrast between alveolar epithelial cells and pulmonary microvascular endothelial cells Am J Physiol Lung Cell Mol Physiol, April 1, 2008; 294(4): L807 - L814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Gaschler, C. C. J. Zavitz, C. M. T. Bauer, M. Skrtic, M. Lindahl, C. S. Robbins, B. Chen, and M. R. Stampfli Cigarette Smoke Exposure Attenuates Cytokine Production by Mouse Alveolar Macrophages Am. J. Respir. Cell Mol. Biol., February 1, 2008; 38(2): 218 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Curtis, C. M. Freeman, and J. C. Hogg The Immunopathogenesis of Chronic Obstructive Pulmonary Disease: Insights from Recent Research Proceedings of the ATS, October 1, 2007; 4(7): 512 - 521. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Sabroe, L. C. Parker, D. H. Dockrell, D. E. Davies, S. K. Dower, and M. K. B. Whyte Targeting the Networks that Underpin Contiguous Immunity in Asthma and Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., February 15, 2007; 175(4): 306 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bagchi, E. A. Herrup, H. S. Warren, J. Trigilio, H.-S. Shin, C. Valentine, and J. Hellman MyD88-Dependent and MyD88-Independent Pathways in Synergy, Priming, and Tolerance between TLR Agonists J. Immunol., January 15, 2007; 178(2): 1164 - 1171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Mahieu and C. Libert Should We Inhibit Type I Interferons in Sepsis? Infect. Immun., January 1, 2007; 75(1): 22 - 29. [Full Text] [PDF]
|
|
|
|
|
|
S. J. Skerrett, C. B. Wilson, H. D. Liggitt, and A. M. Hajjar Redundant Toll-like receptor signaling in the pulmonary host response to Pseudomonas aeruginosa Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L312 - L322. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Loving, S. L. Brockmeier, W. Ma, J. A. Richt, and R. E. Sacco Innate Cytokine Responses in Porcine Macrophage Populations: Evidence for Differential Recognition of Double-Stranded RNA J. Immunol., December 15, 2006; 177(12): 8432 - 8439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. O. Baleeiro, P. J. Christensen, S. B. Morris, M. P. Mendez, S. E. Wilcoxen, and R. Paine III GM-CSF and the impaired pulmonary innate immune response following hyperoxic stress Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1246 - L1255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Shoenfelt and M. J. Fenton TLR2- and TLR4-dependent activation of STAT1 serine phosphorylation in murine macrophages is protein kinase C-{delta}-independent Innate Immunity, August 1, 2006; 12(4): 231 - 240. [Abstract] [PDF]
|
|
|
|
|
|
M. M. Monick, L. S. Powers, T. J. Gross, D. M. Flaherty, C. W. Barrett, and G. W. Hunninghake Active ERK Contributes to Protein Translation by Preventing JNK-Dependent Inhibition of Protein Phosphatase 1 J. Immunol., August 1, 2006; 177(3): 1636 - 1645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Punturieri, P. Copper, T. Polak, P. J. Christensen, and J. L. Curtis Conserved Nontypeable Haemophilus influenzae-Derived TLR2-Binding Lipopeptides Synergize with IFN-beta to Increase Cytokine Production by Resident Murine and Human Alveolar Macrophages J. Immunol., July 1, 2006; 177(1): 673 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-M. Cavaillon and D. Annane Invited review: Compartmentalization of the inflammatory response in sepsis and SIRS Innate Immunity, June 1, 2006; 12(3): 151 - 170. [Abstract] [PDF]
|
|
|
|
|
|
J. L. Curtis Cell-mediated Adaptive Immune Defense of the Lungs Proceedings of the ATS, December 1, 2005; 2(5): 412 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. M. Nagarajan, D. M. Ojcius, L. Stahl, R. G. Rank, and T. Darville Chlamydia trachomatis Induces Expression of IFN-{gamma}-Inducible Protein 10 and IFN-{beta} Independent of TLR2 and TLR4, but Largely Dependent on MyD88 J. Immunol., July 1, 2005; 175(1): 450 - 460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rivieccio, G. R. John, X. Song, H.-S. Suh, Y. Zhao, S. C. Lee, and C. F. Brosnan The Cytokine IL-1{beta} Activates IFN Response Factor 3 in Human Fetal Astrocytes in Culture J. Immunol., March 15, 2005; 174(6): 3719 - 3726. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and PM
) from normal C57BL/6 mice were cultured in the presence of the indicated stimuli for 6 h, and the supernatant was collected and processed by ELISA for TNF-
