The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fuentes-Pananá, E. M.
Right arrow Articles by Monroe, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fuentes-Pananá, E. M.
Right arrow Articles by Monroe, J. G.
The Journal of Immunology, 2004, 173: 1000-1011.
Copyright © 2004 by The American Association of Immunologists

Basal Ig{alpha}/Ig{beta} Signals Trigger the Coordinated Initiation of Pre-B Cell Antigen Receptor-Dependent Processes1

Ezequiel M. Fuentes-Pananá*, Gregory Bannish*, Neelima Shah{dagger} and John G. Monroe2,*

* Department of Pathology and Laboratory Medicine, and {dagger} Biomedical Imaging Core Facility, University of Pennsylvania School of Medicine, Philadelphia, PA 19104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The pro-B to pre-B transition during B cell development is dependent upon surface expression of a signaling competent pre-B cell Ag receptor (pre-BCR). Although the mature form of the BCR requires ligand-induced aggregation to trigger responses, the requirement for ligand-induced pre-BCR aggregation in promoting B cell development remains a matter of significant debate. In this study, we used transmission electron microscopy on murine primary pro-B cells and pre-B cells to analyze the aggregation state of the pre-BCR. Although aggregation can be induced and visualized following cross-linking by Abs to the pre-BCR complex, our analyses indicate that the pre-BCR is expressed on the surface of resting cells primarily in a nonaggregated state. To evaluate the degree to which basal signals mediated through nonaggregated pre-BCR complexes can promote pre-BCR-dependent processes, we used a surrogate pre-BCR consisting of the cytoplasmic regions of Ig{alpha}/Ig{beta} that is targeted to the inner leaflet of the plasma membrane of primary pro-B cells. We observed enhanced proliferation in the presence of low IL-7, suppression of VH(D)JH recombination, and induced {kappa} light (L) chain recombination and cytoplasmic {kappa} L chain protein expression. Interestingly, Ig{alpha}/Ig{beta}-mediated allelic exclusion was restricted to the B cell lineage as we observed normal TCR{alpha}{beta} expression on CD8-expressing splenocytes. This study directly demonstrates that basal signaling initiated through Ig{alpha}/Ig{beta}-containing complexes facilitates the coordinated control of differentiation events that are associated with the pre-BCR-dependent transition through the pro-B to pre-B checkpoint. Furthermore, these results argue that pre-BCR aggregation is not a requirement for pre-BCR function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B cell development relies on mechanisms for identifying and selecting cells that express a functional BCR with appropriate specificity. This selection process not only serves to promote development of BCR-expressing cells (positive selection) but also provides a mechanism for eliminating clones that respond to self-Ags (negative selection). The mature form of the BCR consists of two functional units: the Ag-recognition unit formed by the IgH and IgL, and the signaling unit formed by a heterodimer of the proteins Ig{alpha} (CD79a) and Ig{beta} (CD79b). The ordered expression and assembly of these BCR components define the different stages of B cell development and provide the permissive and/or directive signals that allows B cells to progress through maturation. For instance, B cells that fail to express a competent pre-BCR are unable to transit through the pro-B to pre-B checkpoint and instead undergo programmed cell death. Consistently, recombinant knockout mice unable to express signaling proteins that participate in the BCR signaling cascade, such as Syk, B cell linker, and PI3K, are either arrested or their B cell development proceeds very inefficiently after the pro-B stage. Together, these data illustrate the tight regulation exerted on pro-B cells and clearly indicate that signaling from the BCR is tightly associated with developmental progression (1, 2).

The first components of the BCR to be expressed developmentally are Ig{alpha} and Ig{beta}, transmembrane proteins with extended cytoplasmic tails containing signaling motifs called ITAMs (3). Tyrosine residues present in the ITAMs become phosphorylated upon receptor activation and serve as docking sites in which a signaling complex is assembled. Next, the IgH gene locus, organized as DNA gene segments, is recombined in a series of ordered and tightly regulated steps, collectively referred to as VH(D)JH recombination (4, 5). VH(D)JH recombination is initiated at the IgH locus during the pro-B stage. D to JH fragments are joined first, followed by VH to DJH joining (6, 7). During the pro-B stage, before IgH expression, Ig{alpha} and Ig{beta} have been reported to be expressed at the cell surface in association with the endoplasmic reticulum chaperone, calnexin (8). This complex, known as the pro-BCR, was originally postulated to mediate IgH expression and pre-BCR assembly, although its existence and true function still remain somewhat controversial (9). Once expressed, the IgH protein assembles with Ig{alpha} and Ig{beta} and the surrogate light (L) chains {lambda}5 and Vpre-B to form the pre-BCR (1, 2, 10). PreBCR expression and signaling trigger progression to the pre-B stage and down-regulate expression of the recombination proteins RAG1 and RAG2, abrogating further recombination at the IgH locus (11, 12, 13, 14). The events that operate to restrict further VH(D)JH recombination are collectively referred to as allelic exclusion. However, arrest in the recombination process is selective, as transition into the pre-B window is accompanied by re-expression of RAG1 and RAG2 proteins and accessibility of the IgL loci for IgL recombination (15, 16, 17). Although it is well established that pre-BCR signals are necessary for transition to the pre-B stage, it is not clear if those signals directly affect IgL recombination (8, 12, 18, 19, 20, 21).

Considering all these processes, a complex picture emerges in regard to the developmental regulation of the pro-B and pre-B stages. First, as noted, the role of the pro-BCR in VH(D)JH recombination and assembly of the pre-BCR is uncertain. Second, pre-BCR function extends beyond generating signals required for survival and positive selection at the pro-B to pre-B checkpoint, promoting specific events that are associated with this transition, such as IgH allelic exclusion, IgL recombination, and proliferation of pre-B cells (12, 18, 19, 22, 23, 24). Lastly, V(D)J recombination, BCR assembly, and development itself are processes that appear to be coordinately regulated and exhibit a high degree of mutual dependence. An important but still unanswered question is how the receptor signal is integrated into these multiple processes, allowing their ordered execution according to the developmental program.

An assessment of pro-BCR and pre-BCR function is complicated by the controversial role that ligand binding plays in promoting signal transduction through these complexes. It is well established that there is an absolute requirement for ligand binding for triggering BCR-dependent apoptosis and activation of immature and mature B cells, respectively (6, 25, 26, 27, 28, 29). However, the putative pro-BCR and the pre-BCR do not contain the Ag binding site of the mature BCR that is formed when the IgH is paired with the IgL. Moreover, pre-BCR complexes that lack most of their ectodomains are able to support B cell development (30, 31). Therefore, it has been proposed that B cell development probably relies on the coexistence of ligand-dependent and -independent activities of the BCR complexes (24, 31, 32). The integration of both ligand-independent and -dependent signaling processes associated with BCR complexes and the relative importance of each for many of the specific events that are associated with B cell development are not known. The current study was designed to understand mechanistically the nature of the signals that regulate the biological processes dependent upon pre-BCR expression and function. Specifically, we evaluated whether or not receptor aggregation is required for pre-BCR function and assessed the contribution of basal signaling to the ordered execution of the specific events that are associated with transition through the pro-B to pre-B cell developmental checkpoint.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids and cell lines

Long-term pro-B cell cultures were derived from IgH3H9/+ (33) and RAG2–/– (Taconic Farms, Germantown, NY) mice and maintained in Iscove’s complete medium (Invitrogen Life Technologies, Grand Island, NY) supplemented with 10% FCS, 1% nonessential amino acids mix (Invitrogen Life Technologies), 1% oxaloacetate/pyruvate/bovine insulin (OPI) mix (Invitrogen Life Technologies), 50 µM 2-ME, and 5% supernatant obtained from IL-7-producing J558L cells. After plating in IL-7 containing medium, cells were daily analyzed by FACS for surface marker expression. By day 6 of culture, >99% of the cells were pro-B cells (B220+CD43+BP1+CD22CD25HSAmed) (34) and cells remained in this phenotype for the length of this study. These pro-B cultures have been maintained at 0.5–2.5 million cells/ml medium. At this density we only observe <1% of CD22+ pre-B cells and we have not been able to detect immature B cells as the cultures remain L chain-negative and BP-1-positive. Pro-B cells derived from RAG2–/– mice were then transduced with retroviral vectors and sorted to obtain pure GFP-expressing populations. The studies depicted in this report were performed with pro-B cells that have been maintained in IL-7 for less than a year. The construction of MAHB and its ITAM mutant variant and cloning into the MIGR1 retroviral vector has been previously described (35).

Retroviral infection of progenitor-enriched cultures and adoptive transfers

These techniques have been previously described (36). Briefly, bone marrow cells from 5-FU treated 6- to 8-wk-old female wild-type BALB/c or µMT mice (The Jackson Laboratory, Bar Harbor, ME) were spin-infected with the MIGR1 retroviruses. Infections were conducted on days 2 and 3 after harvest in medium containing IL-3 (6 ng/ml), IL-6 (10 ng/ml), stem cell factor (100 ng/ml) (R&D Systems, Minneapolis, MN), and 5% WEHI3B-conditioned supernatant. A total of 1 x 106 cells/mouse were injected into lethally irradiated (950 rad) syngeneic mice. Mice were sacrificed 4–6 wk posttransfer, and bone marrows and spleens were analyzed (37).

Abs and flow cytometry analysis

Flow cytometric analysis was used to measure the expression of developmental markers of erythrocyte-depleted cell suspensions. Cells were stained with fluorescent Abs against the following proteins: B220-allophycocyanin, CD25-PE, BP1-PE, CD24-PE, IgM-PE, CD43-PE, CD22-PE, CD23-PE, Ig{kappa}- and Ig{lambda}-biotin (BD Pharmingen, San Diego, CA). After staining with biotin-conjugated Abs, cells were treated with Streptavidin-Red670 (Invitrogen Life Technologies) and then fixed in 1% paraformaldehyde. When measuring intracellular L chain expression, cells were first fixed, then permeabilized with a 0.2% Tween 20 solution and stained.

PCR analysis of V(D)JH and VJK recombination products

MAHB+ spleens derived from three independent adoptive-transfer experiments were analyzed for IgH and IgL{kappa} recombination products. In each experiment, the spleens of the MAHB-recipient mice were combined and stained with Abs B220-allophycocyanin and CD23-PE to identify transitional immature and mature B cells. GFP+ B cells were then sorted and lysed at 200 cells/µl in lyses buffer as described by Schlissel et al. (37). PCR amplification (35 cycles) was conducted on DNA representing 800 cells. For control reactions, splenocytes from BALB/c or RAG2–/– mice were used. V region primers were used to detect all members of the VH7183, VH558, and VHQ52 families (37). These V primers were used together with a JH3 primer to detect VH to DJH rearrangements, and DHL and J3 primers were used to detect DH to JH rearrangements. {kappa} L chain rearrangements were analyzed as described using J{kappa}L and degenerate V-region primers (38). For internal controls, primers were designed to amplify a 671-bp band from the BX548004 locus. The 5' primer used consisted of the sequence CCTAAGGCCAACCGTGAAAAG, and the 3' primer was TCTTCATGGTGCTAGGAGCCA.

Analysis of ProB cells in culture

RAG2–/– pro-B cell cultures were spin-infected with the retroviral vectors, as previously described (35). For analyses of developmental progression, cells were depleted of IL-7 for 3 days and then stained for FACS analysis using Abs against stage-specific differentiation markers, as well as TOPRO-3 (Molecular Probes, Eugene, OR) to identify dead cells. For proliferation assays, 2 x 105 pro-B cells/ml (200 µl total volume/well in a 96-well plate) were seeded in medium containing different concentrations of IL-7. Recombinant murine IL-7 from R&D Systems was used for proliferation assays. After 3 days in culture cells were pulsed for 16 h with 1 µCi/well [3H]thymidine. At the time of pulsing, fresh medium was added containing the appropriate concentration of rIL-7. Cells were harvested using a PHD cell harvester (Cambridge Technology, Cambridge, MA) and counted using a 1209 RACKBETA liquid scintillation counter (PerkinElmer, Wellesley, MA).

Electron microscopic analysis of primary pro-B cells

IgH3H9/+ and MAHB+ pro-B cells that were maintained in IL-7 were fixed with 4% paraformaldehyde plus 0.2% glutaraldehyde in 0.1 M sodium cacodylate buffer for 4 h. To mimic ligand-induced aggregation, one sample of the IgH3H9/+ cells was first incubated at 37°C for 2 min with an anti-IgM (B76) Ab and then fixed. After alcohol dehydration, embedding and curing at 58°C for 18 h, 90-nm-thick sections were cut using a Diatome Diamond Knife and a Leica ultracut S microtome. Sections were picked up on 200 mesh nickel grids and nonspecific binding was blocked with 1% OVA plus 0.2% cold water fish skin gelatin in PBS at room temperature for 60 min and then incubated overnight at 4°C with either anti-mouse IgM (B76 for untreated IgH3H9/+ samples) or anti-hemagglutinin (HA)3 (for MAHB+ samples, 12CA5; Boehringer Mannheim, Indianapolis, IN) Abs followed by incubation for 60 min with the anti-rat goat Ab coupled to 10 nm gold particles. After washing and staining with 2% uranyl acetate for 3 min, the sections were observed with a JEOL JEM 1010 transmission electron microscope and images were captured and analyzed using a Hamamatsu CCD camera and AMT 12-h imaging software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pro-B to pre-B transition in IL-7-dependent primary B cells in the absence of spontaneous or ligand-induced pre-BCR aggregation

BCR aggregation mediated by ligand binding is thought to be a prerequisite for signal transduction leading to activation of mature B cells (39, 40). Aggregation is proposed to initiate and stabilize BCR signals as a consequence of concentrating BCR-associated Src family tyrosine kinases to promote their trans-phosphorylation and activation (39, 40) and to promote localization of the BCR complex into liquid-ordered, cholesterol/glycosphingolipid-enriched compartments of the plasma membrane known as membrane rafts that contain high local concentrations of many of the positive regulators of the signaling cascade (41, 42, 43, 44, 45, 46). However, if pre-BCR signaling does drive B cell development in a ligand-independent fashion, it would suggest that pre-BCR signaling occurs independently of receptor aggregation.

We have established primary pro-B cell lines from bone marrow cells derived from either wild-type BALB/c, transgenic IgH3H9/+, or RAG2–/– mice. Bone marrow cells were cultured in the presence of IL-7, which allows for the enrichment and continuous proliferation of pro-B cells. Because throughout most of our study we used primary B cell lines that have either a defective recombinant machinery (RAG2–/–) or an already rearranged H chain (IgH3H9/+) we used the Hardy’s nomenclature, based in the differential expression of cellular markers, to monitor the developmental stage of these primary cell lines. Thus, in this study we defined a pro-B cell as B220+CD43+BP1+CD22CD25HSAmed, which represents Hardy’s fraction C or C' (34). One characteristic of the IL-7 cultures is that developmental progression to the pre-B stage can be induced by the removal of IL-7 from the cultures (47). Transition to the pre-B stage is tightly associated to down-regulation of CD43 expression and up-regulation of CD22 and CD25 and therefore can be monitored in these in vitro cultures. Because CD22 up-regulation allows us to score a positive outcome and because of simplicity we only show expression of CD22 to evaluate the transition to the pre-B stage, but we routinely used both CD43 down-regulation and CD22 up-regulation. The correlation between CD22 expression and transition to the pre-B stage has been previously described and used to developmentally map B cells (31, 48).

To analyze the aggregation state of the resting pre-BCR we used the pro-B cells derived from the transgenic mouse expressing IgH3H9/+. We preferred this genetic background because IL-7 culturing maintains pro-B cells independently of pre-BCR expression, and therefore wild-type pro-B cells (e.g., BALB/c derived pro-B cells) tend to accumulate unsuccessful IgH rearrangements. This problem is overcome by using pro-B cells that constitutively expressed an IgH transgene. We evaluated the ability of the IgH3H9/+ pro-B cell cultures to transit to the pre-B stage as an indication for surface expression of a competent receptor. The RAG2–/– pro-B cell line unable to mediate V(D)J recombination processes and therefore unable to express a pre-BCR and progress to the pre-B cell stage was used as a negative control. IL-7 was removed from the cultures, and 2 to 3 days later cells were stained for expression of developmental markers and analyzed by flow cytometry. This analysis shows that only after IL-7 depletion cells accumulate in more advanced developmental stages (Fig. 1A). After removal of IL-7 we observed that 40% of the IgH transgenic cells have progress beyond the CD22 pro-B stage (Fig. 1A, top left panel) and that actually 16% are positive to surface L chain expression, which is characteristic of the immature stage (Fig. 1A, bottom right panel). The number of CD22+ cells present at the beginning and end of the experiment is also shown. As expected, RAG2–/– pro-B cells are arrested at the CD22 pro-B stage (Fig. 1A, top right panel).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 1. Function and distribution of conventional pre-BCR on primary IL-7 dependent pro/pre B cells. Pro-B cell cultures were obtained after culturing IgH3H9/+ or RAG2–/– bone marrow-derived cells in the presence of IL-7. A, Analysis of pro-B-pre-B progression comparing pre-BCR+ with RAG2–/– pro-B cells. Pro-B cell cultures were deprived of IL-7 for 2–3 days and then cells were stained for subsequent flow cytometric analysis. Surface expression of CD22 and L chain is used as an indicator of progression beyond the pro-B checkpoint. A mix of anti-{kappa} and anti-{lambda} Abs was used to reveal the presence of L chain. Shown are FACS plots of CD22 vs B220 and µ H chain L chain expression, with the frequency of cells able to transit to the pre-B or immature stages indicated in the upper right corner of the quadrant. Actual cell numbers are given in the table at the bottom. B, Transmission electron microscopic analysis of pre-BCR expression in IgH3H9/+ and RAG2–/– primary pro-B cells. IgH3H9/+ cells are shown in top left (unmanipulated cells) and top right (cells treated with aggregating anti-IgM Ab). The bottom right panel is similar to the top right but with a higher magnification. The distribution of pre-BCR structures is highlighted by arrowheads. The bottom left panel represents background for these analyses using pre-BCR pro-B cells from Rag2–/– mouse bone marrow.

 
The ability of IgH3H9/+ cells to transit to the pre-B stage indicates that a competent receptor, able to transport the Ig{alpha}/Ig{beta} signaling unit, is expressed on the cellular surface. This function is mostly provided by the pre-BCR at this transition. To determine whether pre-BCR signaling is associated with constitutive aggregation of the pre-BCR, IgH3H9/+ pro-B cells were analyzed by transmission electron microscopy (Fig. 1B). Cells were analyzed under two conditions: resting (Fig. 1B, upper left panel) and after induced receptor aggregation by treatment with an anti-IgM Ab (Ab B76; Fig. 1B, upper and lower right panels). Using gold-labeled anti-mouse reactive Abs, we mainly detect single gold particles at the plasma membrane of resting pro-B cells. Under these conditions, we do not observe particles associated with RAG2–/– pro-B cells that lack pre-BCR expression (lower left panel). When receptor-aggregation is enforced using the B76 anti-IgM Ab, complexes of two to six gold particles are detected. These data reveal that we can clearly distinguish nonaggregated pre-BCR complexes from complexes that have been forced to undergo ligand-induced aggregation. Because the pro-B to pre-B cell transition occurs efficiently in cultures that were not forced to undergo ligand-induced aggregation, these results suggest that nonaggregated pre-BCR complexes are sufficient to transduce the signals required for this transition in vitro. Although it is possible to have an immature B cell population contaminating the pro-B cell cultures, we do not believe that the conclusions from this analysis are based in BCR detection rather than pre-BCR. We do not observe >1% of CD22+CD43 pre-B cells when cultures are maintained in the developmental inhibitor IL-7, and the receptor detected in our analysis is present in ~100% of the cells. We have calculated that there is approximately one receptor every micrometer of cellular membrane surface. Furthermore, we have no detected L chain expression in these cultures by FACS analysis.

We have previously developed an experimental model to study aggregation-independent BCR signaling (35). This model involves the fusion of the cytoplasmic domains of signaling proteins Ig{alpha} and Ig{beta}. This fusion protein is targeted to the inner leaflet of the plasma membrane by N-terminal positioning of the Lck myristoylation/palmitoylation motif (murine Lck aa 1–10). The resulting chimera, termed MAHB, lacks the transmembrane or ectodomains that are necessary for initiating signals in response to extracellular ligands. We have previously described the ability of MAHB-mediated signaling to induce development through the transitional-2 immature B cell stage in µMT mice (35). To address the role of basal signaling for the coordinated processes happening at the pro-B to pre-B transition, the primary RAG2–/– pro-B cell line was transduced with retroviral vectors (MIGR1) containing parental and MAHB variants. As the MIGR1 vector drives expression of a bicistronic mRNA consisting of the fusion protein and GFP separated by an internal ribosomal entry site, transduce pro-B cells can be monitored by following GFP expression.

To support the nonaggregated status of the conventional pre-BCR, we analyzed the aggregation state of the MAHB protein in primary pro-B cells by transmission electron microscopy. Although the lack of extracellular domains on the MAHB chimera clearly indicates that MAHB signaling is independent of ligand-induced signaling, it remained possible that constitutive aggregation played a role in this process. MAHB contains an epitope tag from the influenza HA protein and an anti-HA Ab was used for detection in these analyses. Fig. 2A shows a representative panel of a MAHB+ RAG2–/– pro-B cell. As exemplified in this cell, we found no evidence to support spontaneous aggregation of MAHB. Therefore, MAHB seems to be a bona fide model to study aggregation-independent signaling through Ig{alpha}/Ig{beta} containing structures.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. Distribution and function of the pre-BCR surrogate, MAHB, in IL-7 dependent primary pro-B and pre-B cells. Rag2–/– pro-B cells were transduced with the MAHB, ITAM mutant, or MIGR1 retroviral vectors and sorted for GFP+ cells. A, Transmission electron microscopic analysis of MAHB distribution in transduced IL-7 dependent primary pro-B cells using anti-HA-conjugated to 10 nm gold beads. Arrows indicate the position of MAHB at the plasma membrane. B, Analysis of pro-B to pre-B transition of sorted MAHB+, ITAMmut+, and MIGR1+ pro-B cells after IL-7 depletion in vitro. FACS analysis of CD22 vs GFP expression to determine the frequency of B220+ cells progressing to the CD22+ pre-B stage (upper right quadrant) is shown. Cell numbers are given in the table at bottom. C, IL-7-dependent pre-BCR-expressing BALB/c pro-B cells, pro-B cells from Rag2–/– bone marrow, or Rag2–/– pro-B cells expressing either MAHB or empty vector (MIGR) were seeded at different concentrations of IL-7 for 3 days to allow transition to the pre-B stage. [3H]Thymidine was added for the last 16 h of culture. Shown is the dose response of [3H]thymidine incorporation to IL-7.

 
To confirm that our in vitro system recapitulated our previous in vivo analysis (35), we tested the ability of MAHB to induce the developmental progression of pro-B cells. Transduced RAG2–/– pro-B cells were removed from IL-7 and cells were analyzed by flow cytometry. For these experiments, we included an MAHB variant, the ITAM mutant variant, in which both tyrosines from the Ig{alpha} and Ig{beta} ITAM domains were changed to phenylalanine (Y182–193 and Y195–206 of Ig{alpha} and Ig{beta}, respectively) to assess the importance of the ITAM signaling domain for the generation of the aggregation-independent signal. We found that similar to RAG2–/– parental pro-B cells, cells transduced with the empty vector and the ITAM mutant variant are arrested at the pro-B stage (Fig. 2B, middle and right panels), and only pro-B cells receiving a MAHB-derived signal are able to overcome the developmental block (Fig. 2B, left panel). Importantly, the differential ability of MAHB and the ITAM mutant variant to trigger development is not due to different protein concentrations, as both proteins exhibit similar levels of expression (35). We observe similar efficiencies between the wild-type pre-BCR and MAHB in their ability to trigger development beyond the pro-B stage checkpoint, supporting the conclusion that a pre-BCR aggregation-independent signaling mechanism operates and is sufficient for pro-B to pre-B transition in vitro. Importantly, the aggregation-independent signal still requires the integrity of the ITAM domains.

Another B cell process associated with the transition to the pre-B stage is the clonal expansion of pre-BCR+ cells (22, 24, 32). This clonal expansion of pre-B cells can be distinguished from the normal proliferation of pro-B cells because it occurs at lower concentrations of IL-7 (22, 49, 50). Thus, although pro-B cells proliferate only at concentrations in the nanogram per milliliter range of IL-7, pre-B cells can also proliferate at concentrations in the picogram per milliliter range (50). We therefore set out to determine whether MAHB signaling could, like the pre-BCR, drive cell proliferation in the presence of low concentrations of IL-7. Fig. 2C compares the ability of wild-type vs RAG2–/– and MAHB+ vs MIGR1+ pro-B and pre-B cells to proliferate at different concentrations of IL-7. For this analysis, cells were seeded in different concentrations of IL-7 for 3 days and then pulsed for 16 h with [3H]thymidine. Both wild-type and RAG2–/– cells were able to proliferate equivalently at high IL-7 concentrations (Fig. 2C, left panel), but only wild-type cells capable of expressing a pre-BCR maintained this level of proliferation at low levels of IL-7. Similarly, MAHB+ cells but not MIGRI expressing pro-B and pre-B cells were able to proliferate effectively at low concentrations of IL-7 (right panel). These data indicate that, in addition to triggering mechanisms for positive selection, the pre-BCR-dependent ligand-independent basal signal is responsible for proliferation of pre-B cells. Notably the ITAM mutant variant was unable to proliferate at low concentrations of IL-7 (data not shown).

Aggregation-independent basal signaling processes generated through BCR complexes can mediate allelic exclusion at the VH locus

Pre-BCR expression and signaling are also associated with allelic exclusion of the un-rearranged H chain allele. We hypothesized that whether ligand-independent basal signaling functions of the pre-BCR were sufficient for the initiation and maintenance of IgH allelic exclusion, then expression of MAHB in B cell progenitors should provide the necessary signals for restriction of VH(D)JH recombination and pre-BCR expression in the pro-B cell. To test this hypothesis, MAHB was expressed using the MIGR1 retroviral transfer system (36) in bone marrow-derived hemopoietic progenitors isolated from normal BALB/c mice. Four weeks after transfer into lethally irradiated BALB/c mice, erythrocyte-depleted splenocytes from the recipient mice were assessed for cell surface phenotype by flow cytometry. Fig. 3A depicts splenocytes gated on the B220+CD23+ population. Lymphocytes within this population comprise the transitional-2 and mature B2 B cells of the spleen (25, 28). In a normal wild-type mouse, nearly 100% of the cells in this population are IgM+, as shown in the nontransduced B cell population from BALB/c mice (Fig. 3A, left panel). Consistent with the normal wild-type cells, analysis of the GFP+ and GFP MIGR1-transduced B cell populations indicated that virtually all of the B cells were positive for surface IgM expression. Thus, V(D)JH and VJ{kappa}{lambda} recombination proceeds regardless of whether or not the progenitors are transduced with the MIGR1 retrovirus. In contrast, GFP+ B cells expressing MAHB (Fig. 3A, right panel, note square gate) lacked detectable expression of surface IgM, whereas MAHB B cells (GFP) expressed surface IgM at levels comparable with wild-type BALB/c and MIGR1 expressing controls. The lack of surface IgM expression on B cells expressing high levels of MAHB suggests that signaling through this chimeric protein is sufficient to induce allelic exclusion by abrogating V(D)JH recombination.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3. Development of IgM peripheral transitional–2/mature B cells from MAHB expressing BALB/c cells. Bone marrow progenitor cells from BALB/c mice were transduced either with retroviral empty vector MIGR1, MAHB, or the ITAM mutant variant. Transduced progenitors were used to reconstitute lethally irradiated syngeneic BALB/c mice, and 4 wk postreconstitution spleens were analyzed by flow cytometry. Splenocytes were stained for surface expression of IgM, CD23, and the pan B cell marker B220 to identify the transitional–2/mature B population. Transduced cells were identified by GFP expression produced from the bicistronic MIGR1 message. A, Cells were gated on the B220+CD23+ population, which represents the transitional-2/mature B cell population, and then analyzed for surface IgM and GFP expression by FACS. The area designated by the box in the lower right quadrant identifies IgM transitional–2/mature B cells. B, Histogram plots of the distribution of IgM+ and IgM cells within the immature to mature B cell population. IgM expression (top) on CD23+ B cells from wild-type BALB/c spleen as a positive control (dark peak) as well as the isotype negative control (shown throughout as open peak). MIGR1- and MAHB-expressing B220+CD23+GFP+ cells were analyzed for surface IgM expression (gray filled). C, IgM expression is compared between splenic B220+GFP+ B cells transduced with MAHB and the ITAM mutant. The designated area in the lower right quadrant highlights those transitional–2/mature splenic B cells (CD23+) that lack surface IgM expression.

 
Importantly, through the use of the ITAM mutant MAHB variant, we demonstrate that the MAHB-dependent induction of allelic exclusion is dependent upon an ITAM-mediated signaling event. Fig. 3C compares IgM expression in the GFP+CD23+ B cell splenic population of ITAM-mutant and MAHB-transduced cells. No BCR B cells were observed in spleens from mice transduced with the ITAM-mutant variant, providing further evidence that, like signaling through ligand-engaged receptors, the basal signals also depend on the integrity of the ITAM domain.

Finally, it is notable that the GFPint population in the MAHB-transduced cells contains a mix of IgM and IgM+ B cells. The distribution of allelically excluded and included B cells within this population suggests the presence of a basal signaling threshold that sets the trigger-point for suppression of VH->DJH recombination. B cells with quantitatively higher signals overcame this threshold and preferentially underwent allelic exclusion. Conversely, B cells with signals near this threshold may or may not be excluded, resulting in the existence of the mixed population observed. The effect of MAHB expression on surface IgM levels is depicted graphically in Fig. 3B. In this panel, histograms of IgM expression within the GFPCD23+B220+ (wild-type BALB/c panel) or GFP+CD23+B220+ (MAHB and ITAM mutant BALB/c panels) splenic population are presented. Although a detectable number IgM+ cells are present in the MAHB-expressing population, the clear majority of the B cells were IgM. This pattern of expression differed markedly from wild-type BALB/c or MIGR1-expressing B cells, in which there are few if any IgM B cells. Together, the data in Figs. 3, A and B, indicate that the expression of the endogenous receptor is suppressed in the presence of a ligand-independent basal signal generated through MAHB.

We have previously shown that MAHB is able to signal for positive selection and drive maturation to the peripheral transitional immature/mature stage in the absence of BCR expression (35). Therefore, it is possible that MAHB+ B cells that are BCR appear as a consequence of nonproductive IgH rearrangements rather than suppressed V(D)JH recombination. To address this point, V(D)J rearrangements in the H chain locus were assessed using the PCR method developed by Schlissel et al. (37). The principle of this method is to use degenerate primers that identify all recombination events involving the most common VH families (7183, 558, and Q52). Successful recombination events are evidenced by the presence of three bands of 358, 741, and 1058 bp corresponding to events using JH1, 2, or 3, respectively (see arrows in Fig. 4A). Because B cells in the spleen of adoptively transferred BALB/c mice are a mixture of nontransduced and transduced cells (see Fig. 3A), we performed adoptive transfer studies for this analysis in the µMT mouse. µMT mice have a competent VH(D)JH recombination machinery, but are unable to assemble a pre-BCR at the plasma membrane due to the deletion of the exon encoding the transmembrane portion of the IgH. Therefore, B cell development is arrested at the pro-B stage in µMT mice and, at the time of harvesting (day 30–40), the B cells present in the µMT recipient spleen are solely comprised of cells that have been positively selected by MAHB basal signaling.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 4. IgH gene rearrangements are suppressed in MAHB-expressing B cells. Splenocytes were isolated from µMT recipient mice reconstituted with MAHB-transduced progenitors. Cells were stained for flow cytometric analysis and FACS-sorted to obtain MAHB+CD23+B220+ transitional-2/mature B cell populations. Each isolated population was verified for purity and DNA from 800 B cells was subjected to PCR analysis to detect IgH gene rearrangements. The products of the PCR amplifications were analyzed on 1% agarose gels. B cells derived from spleens of unreconstituted BALB/c and pro-B cells derived from RAG2–/– mice were used as positive and negative controls. A, Schematic representation of the germline IgH locus depicting the V, D, and J fragments is shown. Arrows indicate the position of the PCR primers. Note that D to J and V to DJ rearrangements will result in three amplification products depending on whether the J1, J2, or J3 segment was involved in the recombination event involving VH segments from the three most prevalent V region gene families. B, Analysis of V to DJ products. Arrows indicate the size of predicted PCR products when VH to DJH recombination has occurred. C, Analysis of D to J rearrangements and PCR products from the BX548004 locus served as an internal control for DNA integrity and amount of DNA in each reaction (arrow right panel). Arrows indicate the expected PCR amplification products. M.W. markers from phage PhiX174 digested with the HaeIII restriction enzyme are depicted throughout.

 
Bone marrow progenitors from µMT mice were transduced with MAHB or the empty vector MIGR1 and transferred into lethally irradiated µMT mice. MAHB+CD23+B220+ B cells were sorted from the spleens of the recipient mice. Isolated B cells from wild-type BALB/c mice and primary Rag2–/– pro-B cells were used as positive and negative controls, respectively. As expected, VH to DJH recombination products are present in wild-type B cells, but not Rag2–/– pro-B cells. Importantly, no VH to DJH rearrangements were detected in the MAHB+ population, supporting the conclusion that allelic exclusion can be mediated by basal pre-BCR signaling (Fig. 4B). The lack of any observed VH to DJH recombination PCR products was not due to a lack of DNA or an inability to amplify products as DH to JH products were observed in both the MAHB+ µMT and BALB/c B cells (expected bands of 1033, 716, and 333 bp, Fig. 4C). The DH to JH rearrangement is not tightly regulated during V(D)J recombination and it can occur before the commitment to the B cell lineage (5, 9). The ability to detect equivalent DH to JH signals in each sample verifies the integrity of the DNA and equivalent levels of template for each.

L chain recombination is restricted to the pre-B stage, even in the premature presence of Ig{alpha}/Ig{beta} basal signaling

We proceeded to evaluate whether the pre-BCR-modeled basal signaling triggers L chain recombination or if L chain recombination was also excluded. We used wild-type BALB/c mice for this analysis because they allow for comparison of {kappa} L chain expression within the H chain excluded and included populations. Thus, bone marrow B cells from BALB/c recipient mice reconstituted with MAHB+ or MIGR1+ progenitor cells were analyzed for expression of {kappa} L chain. Because MAHB+ B cells do not express H chains and therefore cannot express L chain on the surface, we tested for the presence of intracellular L chain. Fig. 5A compares {kappa} L chain expression among the GFP+ and GFP B cell populations. We observed {kappa} L chain in all populations analyzed, indicating that L chain recombination is not excluded by the presence of the basal signal (see IgM and IgM+ populations, Fig. 5A, upper right panel). The higher level of {kappa} expression in BCR+ relative to the MAHB-expressing BCR cells is likely due to the contribution of both surface and cytoplasmic L chain pools.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 5. {kappa} L chain expression by IgH-negative B cells. Spleens and bone marrows were isolated from lethally irradiated mice reconstituted with syngeneic MAHB- or MIGR1-transduced bone marrow progenitors and assessed by flow cytometry for the expression of B220, µ H chain, GFP, and {kappa} L chain (after permeablization). A, {kappa} L chain vs IgM expression within the GFP and GFP+ bone marrow B cell populations (B220+ gate). Numbers in the right-hand corner indicate the frequency of {kappa} expressing cells. B, PCR analysis of {kappa} L chain rearrangements. Cells were isolated from MAHB+ µMT, BALB/c or RAG2–/– mice as described for Fig. 4. Representation of the {kappa} locus (top) in its germline configuration is shown, where arrows indicate the position of the Vseg and J{kappa}2 primers. PCR amplification resulted in predicted bands of 540- and 190-bp lengths in those populations in which V{kappa} to J{kappa} has occurred.

 
The absence of IgL{kappa} locus allelic exclusion was confirmed by PCR amplification of L chain rearrangements using a degenerate V{kappa} probe (Vseg) that is homologous to 80% of the murine V{kappa} genes and a J{kappa}2 primer. The same DNA (MAHB+ µMT splenocytes and controls) used for testing VH to DJH recombination were used to address L chain recombination. Fig. 5B shows a representation of the {kappa} L chain locus with the sites for primer recognition indicated by arrows (Fig. 5B, top) and the results of the PCR amplifications of VK to JK recombination events (Fig. 5B, bottom panel). PCR amplification products (540 and 190 bp) are expected depending on whether J{kappa}1 or J{kappa}2 fragments were the targets for recombination. No differences were detected in the frequency of L chain rearrangement signals between the BCR+ wild-type cells and the MAHB+ B cells. Thus, the flow cytometry and PCR analyses are consistent in establishing the existence of VK to JK recombination in the presence of MAHB expression.

The experiments as described suggest that L chain recombination can occur in the presence of MAHB signal transduction. We next wondered whether the expression of MAHB in pro-B cells might lead to the premature induction of LC recombination. CD43 down-regulation is a hallmark of the pro-B to pre-B transition, and therefore, CD43 expression can be used to distinguish pro-B from subsequent stages of B cell development. Fig. 6B compares {kappa} expression among the CD43+ (pro-B) and CD43 (pre-B and beyond) bone marrow GFP+ B cell population. The GFP+ gate is shown in Fig. 6A. At this level of MAHB expression, most of the B cells are BCR (Fig. 3B). We found that only CD43 B cells express {kappa} L chain. These data indicate that L chain recombination and expression is restricted to the CD43 pre-B stage, despite the premature expression and basal signaling of an Ig{alpha}/Ig{beta} complex on a less mature B cell progenitor population. Fig. 6B also shows that 100% of MHC class II+ B cells (immature and mature populations) were positive for {kappa} L chain expression. The fact that IgL{kappa} is not detected until the pre-B stage suggests that the receptor signal is either modified according to the developmental stage and/or other signals control accessibility of the IgL{kappa} locus.



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 6. L chain recombination is restricted to the pre-B stage in surrogate pre-BCR MAHB-expressing B cells. Spleens and bone marrows were isolated from recipient mice reconstituted with MAHB or MIGR1 transduced progenitors. Cells were assessed by flow cytometry for the expression of B220, µ H chain, GFP, and {kappa} L chain (after permeabilization). A, Shown are the relative levels of surface IgM vs GFP expression in splenic populations. MAHB-expressing (GFP+) B220+ B cells populations differ from MIGR-transduced GFP+B220+ cells in that there is a population of IgM cells (lower right quandrant) in which VH to DJH recombination is suppressed, as a result of allelic exclusion (see Fig. 4). B, GFP+ cells from spleen and bone marrow of recipient mice reconstituted with either MAHB or MIGR1 transduced progenitors (dot blot populations in dotted box in A) were analyzed for {kappa} L chain and CD43 (top) or class II expression (bottom) to evaluate the expression of {kappa} L chain protein by pro-B cells (CD43+) and immature to mature B cells (class II+), respectively.

 
Expression of the TCR{alpha}/{beta} receptor is not excluded in MAHB-expressing T cell progenitors.

The MIGR1 retrovirus is expressed in a wide variety of tissues and allows for the detection of GFP expression in all hemopoietic cells, including T cells. Therefore, we next tested whether the signal transduced by Ig{alpha} and Ig{beta} was competent to induce allelic exclusion of the TCR {alpha} or {beta} locus. Similar to what occurs in B cells, successful recombination of one of the TCR{beta} alleles excludes expression of the second allele in developing T cells through an ITAM-dependent pre-TCR-induced signal. Fig. 7 depicts analyses of CD8+ T cells that are also analyzed for TCR{alpha}{beta} expression. TCR{alpha}{beta} expression was observed on CD8+ T cells that arose from progenitors transduced with MAHB (GFP+) or not transduced (GFP), at levels identical with MIGR1-transduced progenitors and wild-type BALB/c T cells. Therefore, although TCR function is dependent on the signaling activity of the CD3-associated ITAMs, the Ig{alpha}/Ig{beta} signal differs qualitatively and/or quantitatively from CD3 with regards to its ability to signal allelic exclusion during {alpha}{beta} T cell development.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. TCR{alpha}{beta} expression is not suppressed in MAHB+ T cells. Spleens were taken from BALB/c recipient mice that were reconstituted with MAHB and MIGR1 transduced progenitors or from an untreated control BALB/c mouse. Cells were analyzed for TCR{alpha}{beta}, CD8, and Thy1.2 expression by flow cytometry. Shown are cells gated on the Thy1.2+CD8+ population and then analyzed for TCR{alpha}{beta} expression levels vs GFP levels. Expression levels on nontransduced normal wild-type BALB/c splenic Thy1.2+, CD8+ T cells are shown for comparison.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Signals generated through Ig{alpha}/Ig{beta}-containing receptor complexes are necessary and in some cases sufficient to direct B cells to execute a highly regulated series of ordered events that exhibit a very complex level of interdependence. However, in most cases, it is not well understood how the receptor-mediated signal is initiated and translated into specific B cell fates. Receptor oligomerization induced after Ag binding is thought to be a required step for generating signals leading to responses such as negative selection and activation (17, 39). However, it is becoming increasingly apparent that both the BCR and the pre-BCR on developing B cells are capable of generating signals independently of ligand (Ag) binding (24, 31, 32, 35, 51, 52). Despite several reports that implicate ligand-independent BCR signaling in B cell development, neither it’s regulation nor its linkage to specific events in B cell biology have been carefully studied. Moreover, it remains a matter of speculation whether or not ligand-independent as well as ligand-dependent signaling pathways operate in parallel throughout B cell development and activation, or alternatively, whether one or the other is restricted to specific stages and coupled to specific biological processes.

To understand more mechanistically the nature of the pre-BCR-mediated signals, the aggregation status of the pre-B receptor was analyzed in primary pro-B cells expressing either a transgenic IgH or the chimeric protein MAHB. We found that both the pre-BCR and MAHB were detected as single particles similarly distributed on the cellular membrane of resting pro-B cells. These single receptors were however competent to signal developmental progression and proliferation at low concentrations of IL-7. These observations further validate the use of MAHB as a model to study pre-BCR functions. Importantly, this analysis was able to distinguish between "resting" receptors from those receptors that have been intentionally cross-linked by ligand and that were observed as aggregates of two to six complexes. Ab-induced receptor aggregation has largely being used to study ligand-dependent signals. Therefore, these results suggest that the type of aggregated complex needed to trigger the activating signal, is not required for the pro-B to pre-B transition and the developmental processes associated to this transition. Although with a very low frequency, dimeric receptor complexes were also observed during the transmission electron microscopic analysis and we cannot unequivocally rule out that these particular complexes are responsible for the competent signal. It is also possible that multimers of resting receptors do not expose the epitopes recognized by the anti-IgM Ab and therefore remained undetected. However, the ability to visualize the aggregated receptor and the detection of the fusion protein MAHB also as single particles support that higher order aggregates, similar to the ones observed after ligand-induced aggregation, are not necessary to generate and transduce developmentally competent signals.

Overall, these data support a model whereby the expression of Ig{alpha}/Ig{beta}-containing complexes at the plasma membrane is sufficient to generate a ligand-independent basal level of signaling. Because these signals do not appear to require ligand binding and, therefore, are unlikely to be regulated by receptor aggregation, the mechanism(s) for their initiation is uncertain. Perhaps random interactions between the receptor and positive regulators of the signaling complex are at least partly responsible, as has been recently suggested for the TCR (53). Consistent with this hypothesis, membrane targeting of the signaling domains of Ig{alpha}/Ig{beta} to regions normally occupied by the resting BCR and pre-BCR (35, 54) has allowed us to isolate this basal constitutive signal and then to study its role in the B cell biology. We have focused on the role for this basal signal generated by MAHB in the multiple and sometimes parallel pre-BCR-dependent processes occurring at the pro-B to pre-B transition. We have found that expression of MAHB is sufficient to initiate the major cellular processes that are associated with pre-BCR-dependent signaling.

B cell-stromal cells interactions via the pre-BCR extracellular domains have also been proposed to trigger receptor functions (55, 56, 57). Gauthier et al. (57) have identified the S-type selectin, galectin-1, as a pre-BCR ligand in bone marrow stromal cells. This group reported that galectin-1 interactions with the pre-BCR, throughout the surrogate L chain, promote the formation of an immunological synapse between the pre-B and the stromal cell in which protein tyrosine kinase activity is detected. However, whether this signaling is responsible for promoting the normal functional responses generated through the pre-BCR at the pro-B to pre-B transition remains unknown. Moreover, because B cells can be generated from pro-B progenitors in vitro in the absence of stromal cells (24, 32), and sorted individual pro-B cells progress through development by the sole depletion of IL-7 (32, 50), it seems that galectin-1/pre-BCR interactions are not essential for promoting B cell development. A study has described an inherent self-aggregating capability of the pre-BCR (58). This study has proposed that self-aggregated pre-BCR is signaling competent and therefore responsible for the ligand-independent pro-B to pre-B transition.

A caveat to each of the previously mentioned studies is that they target the surrogate L chain proteins {lambda}5 and Vpre-B as the structures responsible for the pre-BCR-stromal cell interactions or receptor self-aggregating capacity. Because pre-B cells can be generated in genetic knockouts of the surrogate L chain proteins, receptor aggregation, if needed is not essential for pre-BCR signaling and developmental progression (59, 60). However, no studies to date exclude the possibility that both ligand-dependent, mediated through surrogate L chain proteins, and -independent signals play an integrated role during B cell maturation. Competition studies in which surrogate L chain-containing pre-BCR are compared with B cells exclusively dependent upon basal signaling should be designed to definitively resolve this issue.

We have previously reported that Ig{alpha}/Ig{beta} basal signals are sufficient to drive pre-BCR-deficient B cells to the peripheral transitional-2 (T2) immature or mature stages (35). This result is confirmed and extended in the present study. We show in this study that normal BALB/c progenitors are able to proceed to the later stages of development, despite the lack of surface BCR expression resulting from MAHB-induced IgH allelic exclusion. Considering that a ligand-independent signal is sufficient to recapitulate the pre-B stage-associated processes as well as to dictate positive selection into the peripheral transitional immature 2 stage, these observations suggest that ligand-dependent mechanisms are not required until the B cell has reached at least the T2 stage.

Recent studies have indicated that ligand-dependent signals may be involved in driving progression beyond the T2 stage of B cell development (61, 62, 63, 64). Furthermore, peripheral mature B cells that express BCR complexes that are incapable of binding conventional Ag compete poorly with ligand-binding sufficient B cells (65, 66). This distinction may reflect the ability of Ag "tickled" B cells to more effectively compete for B cell-activating factor of the TNF family (BAFF) or other survival factors, as has been suggested by others (28, 29, 67, 68). Taken together, these data support a model in which a basal signaling process is sufficient to mediate positive selection through to the terminal stages of B cell maturation and in which ligand-dependent processes are necessary for further progression and/or for continued survival of fully mature immunocompetent B cells. Teleologically, the argument may have some merit for the efficient function of the immune system and for the survival of the host. By selectively placing B cell progenitors that have successfully traversed the initial clonal editing processes of positive and then negative selection, the emerging pool will be at a survival disadvantage unless they are reactive to ligands existing in the peripheral compartments.

In this study, targeting of Ig{alpha}/Ig{beta} to the plasma membrane was sufficient to generate the signals required for IgH locus silencing and allelic exclusion. These results argue that it is the signals generated as a consequence of the surrogate L chain-IgH association to the Ig{alpha}/Ig{beta} unit rather than the surrogate L chain-IgH protein itself that initiate IgH locus silencing. Previous studies have indicated that although surrogate L chain proteins {lambda}5 and Vpre-B are necessary for assembly and surface expression of the IgH containing pre-BCR complex, they are each replaceable for mediating the allelic exclusion functions of this receptor (60, 69, 70). By eliminating the IgH and surrogate L chain as a critical mediator of IgH allelic exclusion the present studies reported extend these previous studies in a very important way. Rather, it would appear that each of these components of the pre-BCR function in concert to allow assembly and membrane expression of Ig{alpha}-Ig{beta} complexes. An Ig{alpha}-Ig{beta} chaperone function for the pre-BCR and other BCR complexes would be consistent with these and previous studies that have observed IgH allelic exclusion resulting from targeting ITAM-containing complexes to the pre-B cell surface. For example, membrane expression of the EBV latent membrane protein 2A is also able to mediate allelic exclusion resulting in BCR-negative peripheral B cells similar to those described in this report (71). Furthermore, the cytoplasmic domains of either Ig{alpha} or Ig{beta} when fused to the µ IgH can independently signal for allelic exclusion (72, 73). Taken together these data argue that plasma membrane expression of ITAM containing complexes provides the minimal context for the generation of signals for allelic exclusion.

The apparent promiscuity in ITAM requirements for B cell IgH locus exclusion exemplified by our results and those previously described, prompted us to consider whether MAHB would lead to allelic exclusion at the TCR{beta}-chain locus. However, MAHB was unable to achieve allelic exclusion for the TCR during thymocyte development in wild-type BALB/c mice. Moreover, MAHB was unable to signal positive selection and developmental progression of Rag2–/– thymocytes beyond the double-negative stage (data not shown). These results may suggest that despite their high degree of sequence homology, there is some specificity of particular ITAMs for specific tissue-restricted events. Alternatively, non-ITAM-associated motifs may be necessary for generating CD3-dependent signals for allelic exclusion in thymocytes. There are examples of non-ITAM motifs needed for proper function of the Ig{alpha} protein (3, 74), and analogous motifs may exist for one or more of the CD3 components. Also, these results are consistent with the conclusion that quantitative differences exist to generate signals sufficient for allelic exclusion in B vs T cells. The difference in the total number of ITAMs in the Ig{alpha}-Ig{beta} (two) vs the CD3 (ten) complexes may determine the basal level of signaling and thereby account for any potential quantitative differences in signaling via these different ITAM-containing complexes.

This current study supports a model in which different patterns of gene expression are associated with different developmental stages to provide a context whereby a common signal is translated into different B cell processes. One example is the stage-specific targeting of the IgH and L chain loci by the recombinase machinery during the pro-B and pre-B stages. Although the pre-BCR-dependent signal for L chain recombination is present prematurely in the MAHB-expressing B cell progenitors, L chain expression was nevertheless not detected until the pre-B stage. This observation suggests that IgL locus recombination is hardwired to the pre-B stage, and it is in agreement with studies indicating that additional processes operate at the pro-B and pre-B stages to control locus accessibility and RAG1 and RAG2 targeting (4, 75, 76, 77). In addition to the basal pre-BCR signal, these processes may help to establish the temporal order of BCR assembly. For example, developmentally regulated epigenetic differences are more likely to control locus accessibility to the recombinase machinery than are a unique set of signals elicited by pre-BCR-BCR complexes. In this scenario, the H chain locus would only be accessible for recombination at the pro-B stage, and therefore, progression beyond this stage excludes further recombination events in this locus (4, 75, 76, 77). Cytokines, like IL-7 or the tachykinin hemokinin-1 that specifically act on pro-B and pre-B cells, respectively, may help to create the particular cellular environments in which signals are differentially translated into specific H chain and L chain gene recombination processes (78, 79, 80, 81).

The existing paradigm for the mechanism of BCR triggered processes proposes that ligand binding promotes receptor aggregation and facilitates cross-interactions between signaling proteins associated with the resting receptor. The signal is initiated when Src kinases are activated to phosphorylate the Ig{alpha}/Ig{beta} ITAMs. A logical explanation for the initiation of basal signaling is constitutive receptor aggregation. However, electron microscopy analysis of primary cells did not find any evidence of self-aggregation in our model of ligand-independent signaling. Importantly, the nonaggregated receptor was competent to trigger the pro-B to pre-B progression and proliferation of the primary pre-B cell, suggesting that oligomerization is not a prerequisite for initiation or transduction of basal signals.

Independence of aggregation for the generation of MAHB-triggered signals is unlikely an artifact of retroviral-mediated over-expression. Both functional and quantitative studies support the conclusion that expression levels at the plasma membrane approximate those of the conventional pre-BCR. Furthermore, activation marker expression and phosphotyrosine levels are consistent with activity normally associated with a resting BCR (35, 54). It has also been proposed that aggregation promotes rapid receptor translocation into the lipid raft compartment, a subspecialized membrane domain that may function to concentrate the signaling effectors associated with BCR signaling. Consequently, it is postulated that the receptor signal is originated and propagated once the receptor localizes into the lipid raft compartment. We have recently targeted MAHB selectively inside or outside lipid rafts and found that MAHB localization to either compartment is sufficient to induce developmental progression (E. M. Fuentes-Pananá, G. Bannish, N. Shah, and J. G. Monroe, manuscript in preparation). Therefore, it is possible that the difference between a signal originated outside lipid raft and the one resulting from receptor aggregation and consequent lipid raft localization is the difference found between transient and persistent signals. In this scenario, the ability of the receptor to localize into the lipid raft compartment may provide the basis of the difference between basal signals for survival and developmental progression and those involved in triggering B cells effector functions.


    Acknowledgments
 
We thank Justina Stadanlick for editorial assistance in the preparation of this manuscript. We also thank Drs. David Allman, Leslie King, Isabel Latorre, and Kris Frese for their comments in the preparation of this report.


    Footnotes
 
1 This work was supported by funding from the National Cancer Institute and National Institute of Allergy and Infectious Diseases (to J.G.M.), and from the Cancer Research Institute (to E.F.-P.). Back

2 Address correspondence and reprint requests to Dr. John G. Monroe, Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Room 311 Biomedical Research Building II/III, 421 Curie Blvd, Philadelphia, PA 19104. E-mail address: monroej{at}mail.med.upenn.edu Back

3 Abbreviation used in this paper: HA, hemagglutinin Back

Received for publication January 7, 2004. Accepted for publication May 13, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Benschop, R. J., J. C. Cambier. 1999. B cell development: signal transduction by antigen receptors and their surrogates. Curr. Opin. Immunol. 11:143.[Medline]
  2. Karasuyama, H., A. Kudo, F. Melchers. 1990. The proteins encoded by the Vpre-B and {lambda}5 pre-B cell-specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172:969.[Abstract/Free Full Text]
  3. Clark, M. R., S. A. Johnson, J. C. Cambier. 1994. Analysis of Ig{alpha}-tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig{alpha} stimulation of Fyn activity. EMBO J. 13:1911.[Medline]
  4. Desiderio, S., J. Lee. 2000. Signaling pathways that control V(D)J recombination. Curr. Top. Microbiol. Immunol. 245:31.[Medline]
  5. Lewis, S. M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27.[Medline]
  6. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature 381:751.[Medline]
  7. Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature 302:575.[Medline]
  8. Nagata, K., T. Nakamura, F. Kitamura, S. Kuramochi, S. Taki, K. S. Campbell, H. Karasuyama. 1997. The Ig{alpha}/Ig{beta} heterodimer on µ-negative pro-B cells is competent for transducing signals to induce early B cell differentiation. Immunity 7:559.[Medline]
  9. Gong, S., M. C. Nussenzweig. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Ig{beta}. Science 272:411.[Abstract]
  10. Tsubata, T., M. Reth. 1990. The products of pre-B cell-specific genes ({lambda}5 and Vpre-B) and the immunoglobulin µ chain form a complex that is transported onto the cell surface. J. Exp. Med. 172:973.[Abstract/Free Full Text]
  11. Grawunder, U., T. M. Leu, D. G. Schatz, A. Werner, A. G. Rolink, F. Melchers, T. H. Winkler. 1995. Down-regulation of RAG1 and RAG2 gene expression in pre-B cells after functional immunoglobulin heavy chain rearrangement. Immunity 3:601.[Medline]
  12. Kitamura, D., K. Rajewsky. 1992. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion. Nature 356:154.[Medline]
  13. Manz, J., K. Denis, O. Witte, R. Brinster, U. Storb. 1988. Feedback inhibition of immunoglobulin gene rearrangement by membrane µ, but not by secreted µ heavy chains. J. Exp. Med. 168:1363.[Abstract/Free Full Text]
  14. Taki, S., M. Meiering, K. Rajewsky. 1993. Targeted insertion of a variable region gene into the immunoglobulin heavy chain locus. Science 262:1268.[Abstract/Free Full Text]
  15. Ehlich, A., S. Schaal, H. Gu, D. Kitamura, W. Muller, K. Rajewsky. 1993. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development. Cell 72:695.[Medline]
  16. Iglesias, A., M. Kopf, G. S. Williams, B. Buhler, G. Kohler. 1991. Molecular requirements for the µ-induced light chain gene rearrangement in pre-B cells. EMBO J. 10:2147.[Medline]
  17. Reth, M., E. Petrac, P. Wiese, L. Lobel, F. W. Alt. 1987. Activation of V{kappa} gene rearrangement in pre-B cells follows the expression of membrane-bound immunoglobulin heavy chains. EMBO J. 6:3299.[Medline]
  18. Kitamura, D., J. Roes, R. Kuhn, K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423.[Medline]
  19. Spanopoulou, E., C. A. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, D. Baltimore. 1994. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice. Genes Dev. 8:1030.[Abstract/Free Full Text]
  20. Tsubata, T., R. Tsubata, M. Reth. 1992. Crosslinking of the cell surface immunoglobulin (µ-surrogate light chains complex) on pre-B cells induces activation of V gene rearrangements at the immunoglobulin {kappa} locus. Int. Immunol. 4:637.[Abstract/Free Full Text]
  21. Turner, M., P. J. Mee, P. S. Costello, O. Williams, A. A. Price, L. P. Duddy, M. T. Furlong, R. L. Geahlen, V. L. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378:298.[Medline]
  22. Hess, J., A. Werner, T. Wirth, F. Melchers, H. M. Jack, T. H. Winkler. 2001. Induction of pre-B cell proliferation after de novo synthesis of the pre-B cell receptor. Proc. Natl. Acad. Sci. USA 98:1745.[Abstract/Free Full Text]
  23. Loffert, D., A. Ehlich, W. Muller, K. Rajewsky. 1996. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development. Immunity 4:133.[Medline]
  24. Rolink, A. G., T. Winkler, F. Melchers, J. Andersson. 2000. Precursor B cell receptor-dependent B cell proliferation and differentiation does not require the bone marrow or fetal liver environment. J. Exp. Med. 191:23.[Abstract/Free Full Text]
  25. Allman, D., R. C. Lindsley, W. DeMuth, K. Rudd, S. A. Shinton, R. R. Hardy. 2001. Resolution of three nonproliferative immature splenic B cell subsets reveals multiple selection points during peripheral B cell maturation. J. Immunol. 167:6834.[Abstract/Free Full Text]
  26. Carsetti, R., G. Kohler, M. C. Lamers. 1995. Transitional B cells are the target of negative selection in the B cell compartment. J. Exp. Med. 181:2129.[Abstract/Free Full Text]
  27. Healy, J. I., C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 16:645.[Medline]
  28. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J. Exp. Med. 190:75.[Abstract/Free Full Text]
  29. Su, T. T., D. J. Rawlings. 2002. Transitional B lymphocyte subsets operate as distinct checkpoints in murine splenic B cell development. J. Immunol. 168:2101.[Abstract/Free Full Text]
  30. Muljo, S. A., M. S. Schlissel. 2002. The variable, CH1, CH2 and CH3 domains of Ig heavy chain are dispensable for pre-BCR function in transgenic mice. Int. Immunol. 14:577.[Abstract/Free Full Text]
  31. Shaffer, A. L., M. S. Schlissel. 1997. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J. Immunol. 159:1265.[Abstract]
  32. Ray, R. J., A. Stoddart, J. L. Pennycook, H. O. Huner, C. Furlonger, G. E. Wu, C. J. Paige. 1998. Stromal cell-independent maturation of IL-7-responsive pro-B cells. J. Immunol. 160:5886.[Abstract/Free Full Text]
  33. Casellas, R., T. A. Shih, M. Kleinewietfeld, J. Rakonjac, D. Nemazee, K. Rajewsky, M. C. Nussenzweig. 2001. Contribution of receptor editing to the antibody repertoire. Science 291:1541.[Abstract/Free Full Text]
  34. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  35. Bannish, G., E. M. Fuentes-Panana, J. C. Cambier, W. S. Pear, J. G. Monroe. 2001. Ligand-independent signaling functions for the B lymphocyte antigen receptor and their role in positive selection during B lymphopoiesis. J. Exp. Med. 194:1583.[Abstract/Free Full Text]
  36. Pui, J. C., D. Allman, L. Xu, S. DeRocco, F. G. Karnell, S. Bakkour, J. Y. Lee, T. Kadesch, R. R. Hardy, J. C. Aster, W. S. Pear. 1999. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11:299.[Medline]
  37. Schlissel, M. S., L. M. Corcoran, D. Baltimore. 1991. Virus-transformed pre-B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription. J. Exp. Med. 173:711.[Abstract/Free Full Text]
  38. Prak, E. L., M. Weigert. 1995. Light chain replacement: a new model for antibody gene rearrangement. J. Exp. Med. 182:541.[Abstract/Free Full Text]
  39. Reth, M., J. Wienands. 1997. Initiation and processing of signals from the B cell antigen receptor. Annu. Rev. Immunol. 15:453.[Medline]
  40. Reth, M., J. Wienands, W. W. Schamel. 2000. An unsolved problem of the clonal selection theory and the model of an oligomeric B-cell antigen receptor. Immunol. Rev. 176:10.[Medline]
  41. Brown, D. A., E. London. 1998. Functions of lipid rafts in biological membranes. Annu. Rev. Cell. Dev. Biol. 14:111.[Medline]
  42. Casey, P. J.. 1995. Protein lipidation in cell signaling. Science 268:221.[Abstract/Free Full Text]
  43. Cheng, P. C., M. L. Dykstra, R. N. Mitchell, S. K. Pierce. 1999. A role for lipid rafts in B cell antigen receptor signaling and antigen targeting. J. Exp. Med. 190:1549.[Abstract/Free Full Text]
  44. Cheng, P. C., B. K. Brown, W. Song, S. K. Pierce. 2001. Translocation of the B cell antigen receptor into lipid rafts reveals a novel step in signaling. J. Immunol. 166:3693.[Abstract/Free Full Text]
  45. Pierce, S. K.. 2002. Lipid rafts and B-cell activation. Nat. Rev. Immunol. 2:96.[Medline]
  46. Weintraub, B. C., J. E. Jun, A. C. Bishop, K. M. Shokat, M. L. Thomas, C. C. Goodnow. 2000. Entry of B cell receptor into signaling domains is inhibited in tolerant B cells. J. Exp. Med. 191:1443.[Abstract/Free Full Text]
  47. Rolink, A., A. Kudo, H. Karasuyama, Y. Kikuchi, F. Melchers. 1991. Long-term proliferating early pre B cell lines and clones with the potential to develop to surface Ig-positive, mitogen reactive B cells in vitro and in vivo. EMBO J. 10:327.[Medline]
  48. Nitschke, L., R. Carsetti, B. Ocker, G. Kohler, M. C. Lamers. 1997. CD22 is a negative regulator of B-cell receptor signalling. Curr. Biol. 7:133.[Medline]
  49. Fleming, H. E., C. J. Paige. 2001. Pre-B cell receptor signaling mediates selective response to IL-7 at the pro-B to pre-B cell transition via an ERK/MAP kinase-dependent pathway. Immunity 15:521.[Medline]
  50. Marshall, A. J., H. E. Fleming, G. E. Wu, C. J. Paige. 1998. Modulation of the IL-7 dose-response threshold during pro-B cell differentiation is dependent on pre-B cell receptor expression. J. Immunol. 161:6038.[Abstract/Free Full Text]
  51. Aoki, Y., K. J. Isselbacher, B. J. Cherayil, S. Pillai. 1994. Tyrosine phosphorylation of Blk and Fyn Src homology 2 domain-binding proteins occurs in response to antigen-receptor ligation in B cells and constitutively in pre-B cells. Proc. Natl. Acad. Sci. USA 91:4204.[Abstract/Free Full Text]
  52. Aoki, Y., K. J. Isselbacher, S. Pillai. 1994. Bruton tyrosine kinase is tyrosine phosphorylated and activated in pre-B lymphocytes and receptor-ligated B cells. Proc. Natl. Acad. Sci. USA 91:10606.[Abstract/Free Full Text]
  53. Roose, J. P., M. Diehn, M. G. Tomlinson, J. Lin, A. A. Alizadeh, D. Botstein, P. O. Brown, A. Weiss. 2003. T cell receptor-independent basal signaling via Erk and Abl kinases suppresses RAG gene expression. PLoS Biol. 1:E53.[Medline]
  54. Fuentes-Panana, E. M., G. Bannish, J. G. Monroe. 2004. Basal B-cell receptor signaling in B lymphocytes: mechanisms of regulation and role in positive selection, differentiation, and peripheral survival. Immunol. Rev. 197:26.[Medline]
  55. Bradl, H., H. M. Jack. 2001. Surrogate light chain-mediated interaction of a soluble pre-B cell receptor with adherent cell lines. J. Immunol. 167:6403.[Abstract/Free Full Text]
  56. Bradl, H., J. Wittmann, D. Milius, C. Vettermann, H. M. Jack. 2003. Interaction of murine precursor B cell receptor with stroma cells is controlled by the unique tail of {lambda}5 and stroma cell-associated heparan sulfate. J. Immunol. 171:2338.[Abstract/Free Full Text]
  57. Gauthier, L., B. Rossi, F. Roux, E. Termine, C. Schiff. 2002. Galectin-1 is a stromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse formation between pre-B and stromal cells and in pre-BCR triggering. Proc. Natl. Acad. Sci. USA 99:13014.[Abstract/Free Full Text]
  58. Ohnishi, K., F. Melchers. 2003. The nonimmunoglobulin portion of {lambda}5 mediates cell-autonomous pre-B cell receptor signaling. Nat. Immunol. 4:849.[Medline]
  59. Rolink, A., H. Karasuyama, U. Grawunder, D. Haasner, A. Kudo, F. Melchers. 1993. B cell development in mice with a defective {lambda}5 gene. Eur. J. Immunol. 23:1284.[Medline]
  60. Shimizu, T., C. Mundt, S. Licence, F. Melchers, I. L. Martensson. 2002. Vpre-B1/Vpre-B2/{lambda}5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J. Immunol. 168:6286.[Abstract/Free Full Text]
  61. Batten, M., J. Groom, T. G. Cachero, F. Qian, P. Schneider, J. Tschopp, J. L. Browning, F. Mackay. 2000. BAFF mediates survival of peripheral immature B lymphocytes. J. Exp. Med. 192:1453.[Abstract/Free Full Text]
  62. Gross, J. A., S. R. Dillon, S. Mudri, J. Johnston, A. Littau, R. Roque, M. Rixon, O. Schou, K. P. Foley, H. Haugen, et al 2001. TACI-Ig neutralizes molecules critical for B cell development and autoimmune disease: impaired B cell maturation in mice lacking BLyS. Immunity 15:289.[Medline]
  63. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, M. L. Scott. 2001. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293:2111.[Abstract/Free Full Text]
  64. Schneider, P., H. Takatsuka, A. Wilson, F. Mackay, A. Tardivel, S. Lens, T. G. Cachero, D. Finke, F. Beermann, J. Tschopp. 2001. Maturation of marginal zone and follicular B cells requires B cell activating factor of the tumor necrosis factor family and is independent of B cell maturation antigen. J. Exp. Med. 194:1691.[Abstract/Free Full Text]
  65. Freitas, A. A., B. Rocha. 2000. Population biology of lymphocytes: the flight for survival. Annu. Rev. Immunol. 18:83.[Medline]
  66. Rosado, M. M., A. A. Freitas. 1998. The role of the B cell receptor V region in peripheral B cell survival. Eur. J. Immunol. 28:2685.[Medline]
  67. Hayakawa, K., M. Asano, S. A. Shinton, M. Gui, D. Allman, C. L. Stewart, J. Silver, R. R. Hardy. 1999. Positive selection of natural autoreactive B cells. Science 285:113.[Abstract/Free Full Text]
  68. Su, T. T., B. Guo, Y. Kawakami, K. Sommer, K. Chae, L. A. Humphries, R. M. Kato, S. Kang, L. Patrone, R. Wall, et al 2002. PKC-{beta} controls I{kappa}B kinase lipid raft recruitment and activation in response to BCR signaling. Nat. Immunol. 3:780.[Medline]
  69. Mundt, C., S. Licence, T. Shimizu, F. Melchers, I. L. Martensson. 2001. Loss of precursor B cell expansion but not allelic exclusion in Vpre-B1/Vpre-B2 double-deficient mice. J. Exp. Med. 193:435.[Abstract/Free Full Text]
  70. ten Boekel, E., F. Melchers, A. G. Rolink. 1998. Precursor B cells showing H chain allelic inclusion display allelic exclusion at the level of pre-B cell receptor surface expression. Immunity 8:199.[Medline]
  71. Caldwell, R. G., J. B. Wilson, S. J. Anderson, R. Longnecker. 1998. Epstein-Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9:405.[Medline]
  72. Papavasiliou, F., Z. Misulovin, H. Suh, M. C. Nussenzweig. 1995. The role of Ig{beta} in precursor B cell transition and allelic exclusion. Science 268:408.[Abstract/Free Full Text]
  73. Papavasiliou, F., M. Jankovic, H. Suh, M. C. Nussenzweig. 1995. The cytoplasmic domains of immunoglobulin (Ig){alpha} and Ig{beta} can independently induce the precursor B cell transition and allelic exclusion. J. Exp. Med. 182:1389.[Abstract/Free Full Text]
  74. Cassard, S., D. Choquet, W. H. Fridman, C. Bonnerot. 1996. Regulation of ITAM signaling by specific sequences in Ig{beta} B cell antigen receptor subunit. J. Biol. Chem. 271:23786.[Abstract/Free Full Text]
  75. Novobrantseva, T. I., V. M. Martin, R. Pelanda, W. Muller, K. Rajewsky, A. Ehlich. 1999. Rearrangement and expression of immunoglobulin light chain genes can precede heavy chain expression during normal B cell development in mice. J. Exp. Med. 189:75.[Abstract/Free Full Text]
  76. Skok, J. A., K. E. Brown, V. Azuara, M. L. Caparros, J. Baxter, K. Takacs, N. Dillon, D. Gray, R. P. Perry, M. Merkenschlager, A. G. Fisher. 2001. Nonequivalent nuclear location of immunoglobulin alleles in B lymphocytes. Nat. Immunol. 2:848.[Medline]
  77. Yancopoulos, G. D., F. W. Alt. 1985. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40:271.[Medline]
  78. Corcoran, A. E., F. M. Smart, R. J. Cowling, T. Crompton, M. J. Owen, A. R. Venkitaraman. 1996. The interleukin-7 receptor {alpha} chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 15:1924.[Medline]
  79. Grabstein, K. H., T. J. Waldschmidt, F. D. Finkelman, B. W. Hess, A. R. Alpert, N. E. Boiani, A. E. Namen, P. J. Morrissey. 1993. Inhibition of murine B and T lymphopoiesis in vivo by an anti-interleukin 7 monoclonal antibody. J. Exp. Med. 178:257.[Abstract/Free Full Text]
  80. von Freeden-Jeffry, U., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burdach, R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181:1519.[Abstract/Free Full Text]
  81. Zhang, Y., L. Lu, C. Furlonger, G. E. Wu, C. J. Paige. 2000. Hemokinin is a hematopoietic-specific tachykinin that regulates B lymphopoiesis. Nat. Immunol. 1:392.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
M. Espeli, S. J. C. Mancini, C. Breton, F. Poirier, and C. Schiff
Impaired B-cell development at the pre-BII-cell stage in galectin-1-deficient mice due to inefficient pre-BII/stromal cell interactions
Blood, June 4, 2009; 113(23): 5878 - 5886.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. J. Anderson and R. Longnecker
EBV LMP2A provides a surrogate pre-B cell receptor signal through constitutive activation of the ERK/MAPK pathway
J. Gen. Virol., July 1, 2008; 89(7): 1563 - 1568.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. D. Milne, S. A. Corfe, and C. J. Paige
Heparan Sulfate and Heparin Enhance ERK Phosphorylation and Mediate preBCR-Dependent Events during B Lymphopoiesis
J. Immunol., March 1, 2008; 180(5): 2839 - 2847.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. Fuentes-Panana, G. Bannish, F. G. Karnell, J. F. Treml, and J. G. Monroe
Analysis of the Individual Contributions of Ig{alpha} (CD79a)- and Igbeta (CD79b)-Mediated Tonic Signaling for Bone Marrow B Cell Development and Peripheral B Cell Maturation
J. Immunol., December 1, 2006; 177(11): 7913 - 7922.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. B. Guloglu and C. A. J. Roman
Precursor B Cell Receptor Signaling Activity Can Be Uncoupled from Surface Expression.
J. Immunol., June 1, 2006; 176(11): 6862 - 6872.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. B. Guloglu, E. Bajor, B. P. Smith, and C. A. J. Roman
The Unique Region of Surrogate Light Chain Component {lambda}5 Is a Heavy Chain-Specific Regulator of Precursor B Cell Receptor Signaling
J. Immunol., July 1, 2005; 175(1): 358 - 366.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Diamant, Z. Keren, and D. Melamed
CD19 regulates positive selection and maturation in B lymphopoiesis: lack of CD19 imposes developmental arrest of immature B cells and consequential stimulation of receptor editing
Blood, April 15, 2005; 105(8): 3247 - 3254.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Katz, M. H. Lareef, J. C. Rassa, S. M. Grande, L. B. King, J. Russo, S. R. Ross, and J. G. Monroe
MMTV Env encodes an ITAM responsible for transformation of mammary epithelial cells in three-dimensional culture
J. Exp. Med., February 7, 2005; 201(3): 431 - 439.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. Fuentes-Panana, G. Bannish, D. van der Voort, L. B. King, and J. G. Monroe
Ig{alpha}/Ig{beta} Complexes Generate Signals for B Cell Development Independent of Selective Plasma Membrane Compartmentalization
J. Immunol., February 1, 2005; 174(3): 1245 - 1252.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fuentes-Pananá, E. M.
Right arrow Articles by Monroe, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fuentes-Pananá, E. M.
Right arrow Articles by Monroe, J. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS