| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, MA 02115; and
Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN 38163
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IFN-
-inducible protein 10 (IP-10), IL-12p35, and IL-15, showed a very restricted pattern of induction. Thus, each TLR appears to possess a distinctive ability to activate DCs or PBMCs, suggesting that TLR-mediated responses cannot be simply cataloged as resembling either TLR2 (MyD88 dependent) or TLR4 (MyD88 independent) and that other signaling modalities may exist. The analysis of DC and PBMC activation by combinations of TLR agonists revealed that TLR2 agonists are able to block the induction of IP-10, IL-12p35, and IFN-, but not IL-15 and IFN-, by TLR3 and TLR4. TLR2 stimulation led to rapid release of IL-10 that is responsible for inhibition of IP-10 and IL-12p35 induction. Cross-talk between different TLRs may modify the primary responses of TLR to their agonist, adding a further level of complexity to the regulation of innate immunity. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TLRs belong to a family of pattern recognition receptors (PRRs) that are used to recognize microbial products derived from several classes of microbes, as well as endogenous ligands that represent "danger signal" (reviewed in Refs.4 and 5). Eleven TLRs have been identified in mammals and the agonists of most of them have been characterized.
TLRs are type I transmembrane proteins characterized by an extracellular leucine-rich portion that exhibits considerable divergence and is necessary for the recognition of different agonists. TLRs also contain a highly conserved cytoplasmic Toll-IL-1R (TIR) domain that, through the adaptor molecule MyD88, connects the receptor to the intracellular signaling machinery shared by IL-1 and IL-18. The high sequence homology among the cytoplasmic portions of TLR initially suggested that they could activate similar signaling pathways. Indeed, all TLRs are able to activate NF-
B and MAPKs. However, early studies using chimeric TLRs indicated that the intracellular portions of different TLRs are not equivalent (6). Moreover, analysis of MyD88-deficient mice revealed that the absence of this adaptor molecule completely abrogated signaling by TLR2, but not by TLR4, suggesting the existence of a MyD88-independent pathway activated by TLR4 and not TLR2 (7). This pathway has been recently demonstrated to rely on a different adaptor called TIR domain-containing adaptor inducing IFN- (TRIF)/TIR-containing adapter molecule (8, 9) that links TLR3 and TLR4 to the kinase complex inducible IB kinase 
/TANK-binding kinase-1, which in turn activates the transcription factor IFN regulatory factor 3 (IRF3) (10). IRF3 is responsible for the induction of a group of genes specific for TLR3/4 stimulation, such as IFN- and IFN--inducible protein 10 (IP-10) (11, 12).
The first evidence that cytokine gene expression is differentially regulated by various TLRs was obtained from studies using mouse macrophages (13) and human DCs (14). Our study (14) compared the cellular responses elicited by TLR2 and TLR4 agonists in immature human DCs. NF-B and MAPK family members were activated to the same extent and with similar kinetics by both TLR2 and TLR4 agonists in the DCs. TLR2 and TLR4 agonists were also equally capable of inducing DC maturation, as measured by the up-regulation of several cell surface markers such as CD40, CD86, HLA-DR, and CD83. However, striking differences were observed when the patterns of cytokines and chemokines induced by TLR2 and TLR4 agonists were compared. Among the several cytokines and chemokines that were analyzed, IL-12p70, IP-10, and IFN- expression were exclusively induced by the TLR4 agonist LPS and not by TLR2 agonists. In contrast, TLR2 agonists preferentially induced IL-8, IL-10, and IL-23p19. The pattern of cytokines induced by TLR2 and TLR4 agonists in mouse macrophages was found to resemble that induced in human DCs (11, 13). It is remarkable that the cytokines differentially induced by TLR2 and TLR4 are important factors for the establishment and maintenance of the Th1/Th2 balance, suggesting that TLRs differ in their ability to influence Th cell differentiation. This notion has been formally demonstrated in both mice and humans. Transgenic mice that were vaccinated with OVA and received Escherichia coli LPS as an adjuvant developed a Th1 type of response. Mice that were immunized using as adjuvant Porphyromonas gingivalis LPS, a TLR2 agonist, developed a Th2 response (15). Along the same line, it was demonstrated that TLR2 and TLR9 agonists bias the adaptive immune response in opposing directions. TLR2 stimulation promoted a Th2 phenotype and led to the aggravation of experimental asthma, raising the possibility of the involvement of TLRs in allergic disorders (16). The ability of TLR2 and TLR4 to induce distinct Th responses was confirmed in humans by in vitro Th cell differentiation experiments and was found to mirror the results obtained in mice, such that TLR2 agonists induced Th2 differentiation and TLR4 induced Th1 (17, 18, 19).
Although several studies analyzed the cellular responses to various TLR agonists, a systematic comparison of the cytokines induced by TLR stimulation in human DCs and PBMCs has not been performed. Although such analysis is useful to determine the contribution of each TLR to the shaping of innate and adaptive immunity, it may not faithfully reflect what happens in vivo, where host cells exposed to complex pathogens are simultaneously challenged by several microbial products. Thus, the overall immune response will be a sum of all of the TLRs and PRRs that a pathogen is able to stimulate.
The present study analyzed the responses of DCs and PBMCs stimulated with several TLR agonists, first individually and then in combination. Each TLR agonist was found to induce a distinct type of response. Remarkably, costimulation with TLR2 agonists was able to block the induction of some of the cytokine genes induced by TLR4 and TLR3 agonists. This effect was mediated by the autocrine action of IL-10, which is rapidly released by TLR2 stimulation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
LPS (E. coli K12 LCD25) was from List Biological Laboratories (Campbell, CA). It was purified from contaminant lipoproteins normally found in commercially available LPS preparations by double phenol extraction, exactly as described by Hirschfeld et al. (20). Staphylococcus aureus peptidoglycan (PGN) was from Fluka (Milwaukee, WI). Synthetic lipopeptide Pam3Cys was from Bachem (Torrance, CA). Poly(I:C) was from Calbiochem (La Jolla, CA). R848 was from Glsynthesis (Worcester, MA). Recombinant Listeria monocytogenes flagellin was expressed in BL21lpxM, a bacteria strain that produces nonmyristoylated LPS (21). The flagellin gene was PCR amplified using the primers GCGCGGATCCATGAAAGTAAATACTAATATC and GCGAGCGGCCGCGCTGTTAATTAATTGAGTTAAC and cloned in the BamHI-NotI sites of Pet 21a vector (Novagen, Madison, WI). The resulting protein carries a T7 tag at the N terminus and a His tag at the C terminus. Bacteria cells expressing the protein were lysed in 6 M guanidine and the protein was purified by nickel resin chromatography. The protein was renatured by dialysis in PBS. The flagellin preparation did not possess TLR4 or TLR2 agonist activity.
Recombinant human IFN- (rhIFN-), rhIFN-, rhIL-10, and anti-hIL-10 were from R&D Systems (Minneapolis, MN).
Dendritic cells
Human PBMCs were isolated from Leukopacks (courtesy of the Kraft Blood Donors Center, Boston, MA) by routine Ficoll-Hystopaque density gradient centrifugation. Monocytes were purified from human PBMCs using MACS CD14 microbeads (Miltenyi Biotec, Auburn, CA) according to the manufacturer’s recommendations. Purity was checked by staining with a FITC-conjugated anti-CD14 Ab (Sigma-Aldrich, St. Louis, MO) and FACScan analysis and was routinely found to be >94%. Immature DCs were obtained by incubating monocytes at 1 x 106/ml in RPMI 1640 supplemented with 10% FCS and rhGM-CSF (10 ng/ml) and rhIL-4 (10 ng/ml) (both from R&D Systems) for 8 days. Fresh complete medium was replaced every 4 days.
RNase protection assay
Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Grand Island, NY). RNase protection assay was performed using 2–3 µg of total RNA using the BD Pharmingen (San Diego, CA) Riboquant kit according to the manufacturer’s recommendations. The hCK-1, hCK-2b, hCK-3, and hCK5 multiprobe template sets were used.
ELISA
DCs were plated in RPMI 1640/10% FCS at a concentration of 2 x 106 cells/ml in 48-well plates and were stimulated as described in the figure legends. IL-10 and IP-10 were measured by ELISA using matched pairs Abs from R&D Systems according to the manufacturer’s recommendations.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A systematic comparison of the responses elicited in human DCs by several TLR agonists was performed. Immature DCs were stimulated with different TLR agonists and the induction of cytokine and chemokine genes was measured using RNase protection assay. PGN and synthethic Pam3Cys lipopeptide were used as TLR2 agonist, poly(I:C) as TLR3 agonist, LPS as TLR4 agonist, flagellin as TLR5 agonist, and R848 as TLR7 agonist (DCs are not responsive to CpG DNA, a TLR9 agonist). To rule out the possibility that any observed difference would be due to unequal cell activation, preliminary experiments (data not shown) were conducted as described in our earlier study (14) to determine the concentration of each agonist that resulted in comparable cell activation. HeLa cell lines that express each TLR were used to establish the specificity of each agonist and to determine the optimal agonist concentration by measuring NF-B activation by luciferase assay. Experiments were also conducted using human DCs to confirm that each agonist was used at a concentration that resulted in maximal activation of this cell type, as judged by NF-B activation (EMSA) and JNK and p38 MAPK activation. Differential induction of cytokines was consistently observed using DCs derived from several donors and was seen at different time points and for all of the effective doses of agonists tested. For example, induction of IP-10 or IFN- was observed even at the lowest effective dose of LPS (0.01 ng/ml), whereas these cytokines were never induced, even when supramaximal doses of PGN or R848 were used (50 and 10 µg/ml, respectively). PGN, LPS, and R848 appeared to be the most powerful agonists of DCs, strongly inducing several cytokine genes. PGN was used at 10 µg/ml, LPS at 1 ng/ml, and R848 at 1 µg/ml. Poly(I:C) was consistently less potent and, regardless of the dose used (up to 100 µg/ml), it never achieved a level of stimulation comparable with that of PGN, LPS, or R848. Flagellin appeared to be the weakest agonist of DCs even when used at a concentration 100-fold higher (10 µg/ml) than the concentration that elicited the maximum response in HeLa-TLR5. Expression of TLR5 messenger was barely detectable in DCs (data not shown), a possible explanation of their hyporesponsiveness to flagellin.
The cytokine genes that were induced by TLR stimulation can be divided into two groups, based on their pattern of induction. The first group of genes comprises cytokines that were induced by all agonists. These genes are presumably induced through the MyD88-dependent pathway. A few of the genes in this group were preferentially induced by some TLR agonists, regardless of the overall extent of cell stimulation. IL-8 and IL-10, for example, were induced more strongly by TLR2 agonists than by TLR4 or TLR7 agonists, although other cytokines were induced at a comparable level by all agonists in the same experiment. The second group includes four cytokine genes, IFN-, IP-10, IL-12p35, and IL-15, which were selectively induced only by some TLR agonists. The analysis of the induction of these genes is helpful to identify and dissect different patterns of gene induction.
Because only two signaling pathways are thought to be activated by TLRs, it was expected that each TLR would induce a pattern of cytokines that resembled either TLR2 or TLR4 stimulation (MyD88 dependent and MyD88 independent, respectively). Surprisingly, each TLR appeared to elicit a distinctive profile of gene induction, suggesting the existence of a more variegated signaling mode. For example, whereas TLR3 and TLR4 agonists were able to induce IP-10 (Fig. 1A) and IL-15 (Fig. 1D), only TLR4 agonist induced IFN- and IL-12p35 (Fig. 1, B and C). Thus, although both TLR3 and TLR4 are able to activate the MyD88-independent pathway, the patterns of cytokines they induced are not equivalent.
|
, IL-12p35, and IP-10 induction were never observed during stimulation with agonists of these TLRs. IL-15, in contrast, was induced by TLR7, but not TLR2 or TLR5 (Fig. 1D). Remarkably, when the cytokine induction was analyzed in PBMCs (Fig. 2) rather than in DCs, the differences between TLR2 and TLR7 stimulation were more obvious. In this experimental setting, TLR7, but not by TLR2 or TLR5 agonists, strongly induced IP-10 (Fig. 2A) and IFN- (data not shown) and to a lower degree IL-12p35 (Fig. 2C). In PBMCs, IL-12p35 and IFN- messages were also induced by poly(I:C), albeit to lower level. Although it is not clear which cell type is responsible for IP-10, IL-12p35, and IFN- induction in PBMCs, this experiment demonstrates that, depending on the cell type, TLR7 signaling shares features common to both TLR4 and TLR2, yet does not exactly resemble either. In contrast with DCs that are poorly stimulated by flagellin, PBMCs responded to the TLR5 agonist by inducing cytokine expression in a pattern similar to that in response to the TLR2 agonist.
|
The cytokines produced by DCs stimulated through TLR3 and TLR4 are suggestive of the ability of these receptors to promote Th1 differentiation, whereas those produced by TLR2 stimulation would be more supportive of Th2 polarization. This notion, which has been demonstrated in both mice and humans, is further supported by the finding that various TLR agonists induced different amounts of IFN- in PBMCs (Fig. 2B). TLR3 and TLR4 agonists were much more powerful IFN- inducers than were TLR2 and TLR5 agonists. IL-10, in contrast, was preferentially induced by TLR2 and TLR5 agonists. Again, TLR7 agonist appeared to induce a response characteristic of both TLR2 (high IL-10) and TLR3/4 (high IFN-). It is unclear at present whether the IFN- production is stimulated by direct action of TLR agonists on IFN--producing cells or if it is mediated through cytokines released by DCs/monocytes. Recently it has been reported that activated T cells (22) and NK cells (23) express some TLRs and respond to their agonists, raising the possibility that IFN- may be directly induced by TLR stimulation in these cell types.
Concomitant TLR2 stimulation blocks the induction of IP-10 and IL-12 by TLR3 and TLR4
The experiments just described characterize the response of DCs to stimulation with isolated TLR agonists. However, complex microorganisms such as bacteria possess several pathogen-associated molecular patterns that can stimulate more than one TLR, in addition to other PRRs. Thus, the outcome of the innate immune stimulation will be a sum of all of the TLRs (and PRRs) that a particular pathogen is able to simultaneously stimulate. This consideration prompted us to analyze the cytokine gene induction in DCs stimulated concomitantly by two TLR agonists.
In most cases, the cytokines induced by simultaneous stimulation with two TLR agonists appeared to be the sum of each single stimulation (data not shown). Costimulation in the presence of TLR2 agonists, however, gave a different result. TLR2 stimulation was able to silence some of the cytokine genes induced by TLR3 and TLR4 agonists (Fig. 3). Thus, the induction of IP-10 by LPS and poly(I:C) (Fig. 3A) and that of IL-12p35 by LPS (Fig. 3B) were blocked by coincubation with TLR2 agonist PGN (or synthetic lipopeptide Pam3Cys; data not shown). Induction of IL-15 and IFN- by LPS and poly(I:C), however, was not affected by costimulation with TLR2 agonists (Fig. 3, C and D), suggesting that TLR3 and TLR4 are still functional and that the mechanism responsible for this effect is not due to rapid desensitization of the receptors. The ability of TLR2 agonists to down-regulate IP-10 and IL-12p35 was more pronounced if TLR2 stimulation preceded by 60–90 min the stimulation with TLR3 and TLR4 agonists. Nevertheless, TLR2 stimulation that followed a prolonged stimulation (18 h) with LPS was still able to diminish the TLR4-induced IP-10 message (Fig. 4A). TLR2 costimulation also blocked IP-10 induction by IFN- (data not shown) and IFN- (Fig. 4B), again suggesting that the mechanism of inhibition is not at the level of TLRs, but rather is more proximal and restricted to the transcription of those genes. Preincubation with TLR3 and TLR5 agonists had no effect on IP-10 or IL-12p35 induction by LPS, and TLR7 agonist was only marginally able to inhibit TLR4 induction of IP-10 (Figs. 2A and 4B). Interestingly, costimulation with TLR2 agonist also diminished the amount of IFN- induced by LPS in PBMCs (Fig. 4C). Thus, although TLR2 activation is unable to induce Th1-specific factors (IP-10, IFN-, IL-12, and IL-15; Fig. 1), it is at the same time capable of blocking the induction of some of them (IL-12 and IP-10 (Fig. 3) and IFN- (Fig. 4C)) by TLR4 and TLR3. This suggests that a cross-talk between different TLRs modifies the primary responses of some TLRs to their agonist.
|
|
One possible mechanism through which TLR2 agonists may block IL-12 and IP-10 induction would be through the release of an inhibitory factor. IL-10 is a cytokine with potent anti-inflammatory activity that has been demonstrated to be able to inhibit the synthesis of several cytokines (24), including IP-10 (25) and IL-12 (26). DCs stimulated for 5 h by TLR2 agonist released a higher amount of IL-10 than did cells stimulated with TLR4 or TLR7 agonists (Fig. 5A), suggesting that IL-10 may be responsible for inhibition of IP-10 and IL-12 induction by TLR2 costimulation. Addition of an anti-IL-10 neutralizing Ab to the DC medium greatly reduced the ability of TLR2 to block IP-10 (Fig. 5, B and C) and IL-12p35 (data not shown) induction by LPS, showing that, in fact, the block is mainly mediated by the autocrine action of IL-10. Moreover, addition of rIL-10 at a concentration similar to those found in the conditioned medium of DCs after 4 h of stimulation was able to diminish induction of IP-10 by LPS (Fig. 5B, left panel). Although TLR2 agonists are stronger IL-10 inducers, TLR4 and TLR7 agonists are also able to induce release of IL-10 in lower amounts, suggesting that the anti-IL-10 Ab may enhance the induction of IP-10 by LPS. We tested this hypothesis and found it to be correct. The anti-IL-10 Ab enhanced the induction of IP-10 by LPS at the levels of both mRNA (Fig. 5B, right panel) and protein (Fig. 5C).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
By analyzing the pattern of cytokines induced by each TLR agonist separately, it was possible to establish that each TLR elicits a distinctive type of response. Interestingly, the repertoire of cytokines induced by each TLR agonist in DCs did not completely overlap with that induced in PBMCs, suggesting the existence of cell-type-specific signaling pathways. Several cytokines were equally induced by all TLR agonists, but four genes, IFN-, IP-10, IL-12p35, and IL-15, showed a very restricted pattern of induction. Three of these genes, IFN-, IP-10, and IL-12p35, were already known to be differentially regulated by TLR2 and TLR4 (14), but not by other TLR agonists. The fourth gene, IL-15, is reported here for the first time as being differentially regulated by TLR agonists. IL-15 is particularly active on NK cells, which depend on this cytokine for optimal expression of IFN- (27).
Based on the ability to induce these four cytokines, TLR-mediated responses can be differentially classified. The most versatile receptor appeared to be TLR4 because it was able to induce all four genes. TLR3 was unable to induce IFN- and IL-12p35, but it retained the ability to induce IP-10 and IL-15. The inability of human DCs to produce IFN- when stimulated with TLR3 agonist is surprising because this stimulus is among the strongest inducers of type I IFN in several murine and human cell types. In PBMCs, poly(I:C) was a weak inducer of IL-12p35 and IFN-. The induction of IP-10 in the absence of IFN- during TLR3 stimulation suggests that IP-10 release is not a result of IFN- autocrine stimulation, as it has been proposed in other experimental settings (28). The pattern of cytokines induced by TLR7 agonist was less easily classifiable. In DCs (Fig. 1), TLR7 was able to induce IL-15 but not IFN-, IP-10, or IL-12p35. In PBMCs (Fig. 2), however, TLR7 agonist displayed a pattern of cytokine induction that mostly resembled TLR4 stimulation, strongly inducing IP-10, IFN-, and IFN- and weakly inducing IL-12p35. Thus, TLR7 signaling appeared to share features characteristic of both TLR2 and TLR4, depending on the cell type. These observations are in agreement with a report that demonstrated that TLR7 agonists induced distinct cytokines in different subsets of human DCs and were able to support Th1 differentiation (29). IFN-, IP-10, IL-12p35, and IL-15 were never induced by TLR2 agonists under any circumstances. In contrast, TLR2 agonists were more powerful inducers of IL-8 and IL-10, as previously reported (14). The TLR5 agonist flagellin, although a poor stimulator of cytokine production in DCs, was a good inducer in PBMCs and appeared to elicit a response that more closely resembles that of TLR2 agonists. DC hyporesponsiveness to flagellin may be due to low expression of TLR5.
Thus, each TLR appears to possess a distinctive ability to activate DCs or PBMCs, suggesting that TLR-mediated responses cannot be simply cataloged as resembling either TLR2 (MyD88 dependent) or TLR4 (MyD88 independent) and that other signaling modalities may exist. These results also support the notion that various TLR agonists possess different potentials to affect T cell biology, either directly or through APC-derived cytokines.
Accumulating evidence indicates that the signaling specificity of each TLR is achieved through the selective use of TIR-containing adaptors, five of which have been identified to date (reviewed in Refs.30 and 31). TLR4 can use four of these adaptors, MyD88, TIR domain-containing adaptor protein/MyD88 adaptor-like (32, 33), TRIF/TIR-containing adapter molecule (8, 34), and TRIF-related adaptor molecule (TRAM) (35). The last two adaptors control the MyD88-independent pathway that leads to activation of the transcription factor IRF3 and expression of IFN-. The use of so many adaptors by TLR4 may explain the high versatility of this receptor in terms of cytokine induction, as observed in our experiments. It is unclear at present whether IL-12p35 and IL-15 induction occur through the MyD88-independent pathway, which is known to control the expression of IP-10 and IFN-. Recent experimental evidence suggests that TLR3 signaling depends primarily on a single adaptor, TRIF (8, 34). This may explain the fact that the array and amount of cytokines induced by poly(I:C) in DCs is somewhat reduced when compared with other TLR agonists such as LPS or R848. Thus, the MyD88-independent pathway activated by TLR4 is different from that activated by TLR3 and, as a result, the two receptors induce different cytokines in DCs. The existing experimental evidence suggests that TLR2 and TLR5 cannot use the adaptors that belong to the MyD88-independent pathway (TRIF, TRAM) and mostly rely on MyD88 (and TIR domain-containing adaptor protein for TLR2 (32, 33)). This is consistent with our finding that TLR2 and TLR5 agonists are unable to induce IP-10, IFN-, IL-12p35, and IL-15. The ability of TLR2 to induce higher amounts of IL-8 and IL-10 than TLR4 is difficult to explain in terms of adaptor usage. It is conceivable that some signal generated through the MyD88-independent pathway may be able to down-regulate these cytokine genes. TLR7, although apparently unable to link with TRIF and TRAM, is still able to induce IL-15 in DCs and IP-10, IFN-, and IL-12p35 in PBMCs and type I IFN in plasmacytoid DCs (29), suggesting that an additional signaling pathway can be activated by TLR7, possibly in a cell-type-specific fashion.
Thus, the original classification of TLR signaling as either MyD88 dependent or MyD88 independent may be misleading because it suggests that only two types of responses can be activated by TLRs. Our data show that each TLR induces a characteristic response. How this diversity in signaling is generated remains unclear. The existence of at least five TIR-containing adaptors and their ability to participate in a multitude of interactions suggests a way by which additional signaling modes can be achieved.
By characterizing the pattern of cytokines induced by each TLR agonist, our study accomplishes a deeper understanding of the contribution of each TLR to the innate and adaptive immune response. The ability of TLR agonists to differentially activate DCs and control the expression of cytokines determinant for Th cell differentiation suggests that TLR agonists may find practical applications. Synthetic TLR4 agonists that share some of the immunomodulatory activities of LPS, yet not the toxicity, are being successfully tested as vaccine adjuvants (36). Our study suggests that each TLR has a distinct potential to modulate T cell responses, expanding the opportunities for the fine tuning of adaptive immunity during immunotherapies and vaccination strategies.
Although the dissection of the signaling pathway activated by each TLR can only be achieved by studying each recognition event separately, cells that encounter complex pathogens such as bacteria are exposed to several microbial products simultaneously. Thus, the overall innate immune response will be a sum of each single stimulation. The analysis of DC and PBMC activation by combinations of TLR agonists revealed that TLR2 agonists are able to block the induction of a subset of genes specifically induced by TLR3 and TLR4 agonists and by IFN- and IFN-. In DCs, TLR2 agonists were able to suppress IP-10 and IL-12p35 induction by LPS and poly(I:C). The mechanism by which TLR2 blocks IP-10 and IL-12 induction appears to be mainly through autocrine IL-10 release. DCs stimulated through TLR2 expressed a higher amount of IL-10 than did cells stimulated by TLR4 or TLR7 agonists, and anti-IL-10 Ab eliminated most of the TLR2 agonist’s ability to block the induction of those cytokines. The fact that anti-IL-10 Ab does not completely restore IP-10 induction to the same level as LPS stimulation may be due to intrinsic limitation of the experimental approach (i.e., IL-10 may bind its receptor before it can encounter the Ab) or it may suggest that other factors induced by TLR2 contribute to the inhibition of IP-10 secretion independently of IL-10. IL-10 is a cytokine with potent anti-inflammatory activities, capable of inhibiting the production of several proinflammatory cytokines (including IP-10 and IL-12) in different cell types (24, 25, 26). Interestingly, in PBMCs, TLR2 costimulation was also able to inhibit IFN- expression. Although it is unclear which cell type is responsible for IFN- expression in our PBMC experiments, it is likely that suppression of this cytokine by TLR2 agonist is also mediated by IL-10. In PBMCs, IL-10 could act on monocytes/DCs to inhibit production of IL-12, a major stimulator of IFN- expression. IL-10 could also act directly on T cells and NK cells to block IFN- production. Thus, TLR2 not only lacks the ability to induce cytokines that are important for Th1 differentiation, but, by inducing IL-10 release, it is also capable of blocking the induction of some of these genes by TLR3 and TLR4. This suggests that cross-talk between different TLRs modifies the primary responses of TLRs to their agonist, adding a further level of complexity to the regulation of innate immunity. Pathogens might have learned to take advantage of this cross-talk mechanism to hijack the development of adaptive immunity. For example, the 19-kDa mycobacterial lipoprotein, a TLR2 agonist, inhibits IFN--regulated MHC class II expression and Ag presentation (37) and blocks IFN- responses in macrophages via a TLR2-dependent mechanism (38). Candida albicans induces immunosuppression through TLR2-derived signals that mediate increased IL-10 production and survival of regulatory T cells (39). Experimental evidence also suggests that Mycobacterium tuberculosis uses IL-10 to colonize the host: transgenic mice overexpressing IL-10 are more susceptible to mycobacterial infections (40, 41), whereas IL-10 knockout mice are more resistant (42). Finally, it is possible that the synergies that develop when viral and bacterial infections occur sequentially (43) may originate from cross-talk between TLRs activated by each pathogen.
A deeper understanding of the cellular events triggered by the activation of each single TLR, or combination of different TLRs, is a prerequisite for the rational design of more successful immunotherapies and vaccination strategies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants AI-49524 (to J.L.S.) and AI-54665 (to F.R.). 
2 Address correspondence and reprint requests to Dr. Fabio Re, Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN 38163. E-mail address: fre{at}utmem.edu
3 Abbreviations used in this paper: DC, dendritic cell; PRR, pattern recognition receptor; TIR, Toll-IL-1R; TRIF, TIR domain-containing adaptor inducing IFN-; IRF, IFN regulatory factor; IP-10, IFN--inducible protein 10; PGN, peptidoglycan; h, human; TRAM, TRIF-related adaptor molecule.
Received for publication May 13, 2004. Accepted for publication October 12, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. J. Biol. Chem. 278:49751. and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491.[Medline]
-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041. by natural killer cells in vitro. J. Clin. Invest. 96:2578.
-induced STAT1
/-dependent gene expression in macrophages. Nat. Immunol. 3:392.[Medline]
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507. through myeloid differentiation factor 88-dependent and -independent mechanisms. J. Immunol. 172:6272.This article has been cited by other articles:
|
|
 |
|
  M. H. Wenink, K. C. M. Santegoets, J. C. A. Broen, L. van Bon, S. Abdollahi-Roodsaz, C. Popa, R. Huijbens, T. Remijn, E. Lubberts, P. L. C. M. van Riel, et al. TLR2 Promotes Th2/Th17 Responses via TLR4 and TLR7/8 by Abrogating the Type I IFN Amplification Loop J. Immunol., December 1, 2009; 183(11): 6960 - 6970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Thivierge, J. Stankova, and M. Rola-Pleszczynski Cysteinyl-Leukotriene Receptor Type 1 Expression and Function Is Down-Regulated during Monocyte-Derived Dendritic Cell Maturation with Zymosan: Involvement of IL-10 and Prostaglandins J. Immunol., November 15, 2009; 183(10): 6778 - 6787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Del Corno, A. Michienzi, A. Masotti, L. Da Sacco, G. F. Bottazzo, F. Belardelli, and S. Gessani CC chemokine ligand 2 down-modulation by selected Toll-like receptor agonist combinations contributes to T helper 1 polarization in human dendritic cells Blood, July 23, 2009; 114(4): 796 - 806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. McKimmie, M. Moore, A. R. Fraser, T. Jamieson, D. Xu, C. Burt, N. I. Pitman, R. J. Nibbs, I. B. McInnes, F. Y. Liew, et al. A TLR2 ligand suppresses inflammation by modulation of chemokine receptors and redirection of leukocyte migration Blood, April 30, 2009; 113(18): 4224 - 4231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. M. Bamboat, J. A. Stableford, G. Plitas, B. M. Burt, H. M. Nguyen, A. P. Welles, M. Gonen, J. W. Young, and R. P. DeMatteo Human Liver Dendritic Cells Promote T Cell Hyporesponsiveness J. Immunol., February 15, 2009; 182(4): 1901 - 1911. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Chase, J. Celli, and C. M. Bosio Direct and Indirect Impairment of Human Dendritic Cell Function by Virulent Francisella tularensis Schu S4 Infect. Immun., January 1, 2009; 77(1): 180 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang, S. Liu, J. Liu, T. Zhang, Q. Shen, Y. Yu, and X. Cao Immune Complex/Ig Negatively Regulate TLR4-Triggered Inflammatory Response in Macrophages through Fc{gamma}RIIb-Dependent PGE2 Production J. Immunol., January 1, 2009; 182(1): 554 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Scheu, P. Dresing, and R. M. Locksley Visualization of IFN{beta} production by plasmacytoid versus conventional dendritic cells under specific stimulation conditions in vivo PNAS, December 23, 2008; 105(51): 20416 - 20421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Fairweather, S. Frisancho-Kiss, and N. R. Rose Sex Differences in Autoimmune Disease from a Pathological Perspective Am. J. Pathol., September 1, 2008; 173(3): 600 - 609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Gerosa, B. Baldani-Guerra, L. A. Lyakh, G. Batoni, S. Esin, R. T. Winkler-Pickett, M. R. Consolaro, M. De Marchi, D. Giachino, A. Robbiano, et al. Differential regulation of interleukin 12 and interleukin 23 production in human dendritic cells J. Exp. Med., June 9, 2008; 205(6): 1447 - 1461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Marin-Esteban, M. Abdul, D. Charron, A. Haziot, and N. Mooney Dendritic Cells Differentiated in the Presence of a Single-Stranded Viral RNA Sequence Conserve Their Ability To Activate CD4 T Lymphocytes but Lose Their Capacity for Th1 Polarization Clin. Vaccine Immunol., June 1, 2008; 15(6): 954 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Borchers, A. Krishnamurthy, C. L. Keen, F. J. Meyers, and M. E. Gershwin The Immunobiology of Mushrooms Experimental Biology and Medicine, March 1, 2008; 233(3): 259 - 276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Li, M. M. Nooh, M. Kotb, and F. Re Commercial peptidoglycan preparations are contaminated with superantigen-like activity that stimulates IL-17 production J. Leukoc. Biol., February 1, 2008; 83(2): 409 - 418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Tu, A. Bozorgzadeh, R. H. Pierce, J. Kurtis, I. N. Crispe, and M. S. Orloff TLR-dependent cross talk between human Kupffer cells and NK cells J. Exp. Med., January 21, 2008; 205(1): 233 - 244. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Geisel, F. Kahl, M. Muller, H. Wagner, C. J. Kirschning, I. B. Autenrieth, and J.-S. Frick IL-6 and Maturation Govern TLR2 and TLR4 Induced TLR Agonist Tolerance and Cross-Tolerance in Dendritic Cells J. Immunol., November 1, 2007; 179(9): 5811 - 5818. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Lundberg, S. K. Drexler, C. Monaco, L. M. Williams, S. M. Sacre, M. Feldmann, and B. M. Foxwell Key differences in TLR3/poly I:C signaling and cytokine induction by human primary cells: a phenomenon absent from murine cell systems Blood, November 1, 2007; 110(9): 3245 - 3252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bevelander, J. Mayette, L. A. Whittaker, S. A. Paveglio, C. C. Jones, J. Robbins, D. Hemenway, S. Akira, S. Uematsu, and M. E. Poynter Nitrogen Dioxide Promotes Allergic Sensitization to Inhaled Antigen J. Immunol., September 15, 2007; 179(6): 3680 - 3688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Burke, L. M. Ganley-Leal, A. Khatri, and L. M. Wetzler Neisseria meningitidis PorB, a TLR2 Ligand, Induces an Antigen-Specific Eosinophil Recall Response: Potential Adjuvant for Helminth Vaccines? J. Immunol., September 1, 2007; 179(5): 3222 - 3230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. E. Walker and D. R. Goldstein Neonatal B Cells Suppress Innate Toll-Like Receptor Immune Responses and Modulate Alloimmunity J. Immunol., August 1, 2007; 179(3): 1700 - 1710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Geurtsen, H. A. Banus, E. R. Gremmer, H. Ferguson, L. J. J. de la Fonteyne-Blankestijn, J. P. Vermeulen, J. A. M. A. Dormans, J. Tommassen, P. van der Ley, F. R. Mooi, et al. Lipopolysaccharide Analogs Improve Efficacy of Acellular Pertussis Vaccine and Reduce Type I Hypersensitivity in Mice Clin. Vaccine Immunol., July 1, 2007; 14(7): 821 - 829. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Zolfaghari, C. J. Cifelli, S. O. Lieu, Q. Chen, N.-q. Li, and A. C. Ross Lipopolysaccharide opposes the induction of CYP26A1 and CYP26B1 gene expression by retinoic acid in the rat liver in vivo Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1029 - G1036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Elson, I. Dunn-Siegrist, B. Daubeuf, and J. Pugin Contribution of Toll-like receptors to the innate immune response to Gram-negative and Gram-positive bacteria Blood, February 15, 2007; 109(4): 1574 - 1583. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Flacher, M. Bouschbacher, E. Verronese, C. Massacrier, V. Sisirak, O. Berthier-Vergnes, B. de Saint-Vis, C. Caux, C. Dezutter-Dambuyant, S. Lebecque, et al. Human Langerhans Cells Express a Specific TLR Profile and Differentially Respond to Viruses and Gram-Positive Bacteria J. Immunol., December 1, 2006; 177(11): 7959 - 7967. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ejrnaes, C. M. Filippi, M. M. Martinic, E. M. Ling, L. M. Togher, S. Crotty, and M. G. von Herrath Resolution of a chronic viral infection after interleukin-10 receptor blockade J. Exp. Med., October 30, 2006; 203(11): 2461 - 2472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Bekeredjian-Ding, S. I. Roth, S. Gilles, T. Giese, A. Ablasser, V. Hornung, S. Endres, and G. Hartmann T Cell-Independent, TLR-Induced IL-12p70 Production in Primary Human Monocytes. J. Immunol., June 15, 2006; 176(12): 7438 - 7446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Casati, C. Camisaschi, F. Rini, F. Arienti, L. Rivoltini, F. Triebel, G. Parmiani, and C. Castelli Soluble Human LAG-3 Molecule Amplifies the In vitro Generation of Type 1 Tumor-Specific Immunity. Cancer Res., April 15, 2006; 66(8): 4450 - 4460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Doni, M. Michela, B. Bottazzi, G. Peri, S. Valentino, N. Polentarutti, C. Garlanda, and A. Mantovani Regulation of PTX3, a key component of humoral innate immunity in human dendritic cells: stimulation by IL-10 and inhibition by IFN-{gamma} J. Leukoc. Biol., April 1, 2006; 79(4): 797 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-T.A. Teng Protective and Destructive Immunity in the Periodontium: Part 1--Innate and Humoral Immunity and the Periodontium Journal of Dental Research, March 1, 2006; 85(3): 198 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Querec, S. Bennouna, S. Alkan, Y. Laouar, K. Gorden, R. Flavell, S. Akira, R. Ahmed, and B. Pulendran Yellow fever vaccine YF-17D activates multiple dendritic cell subsets via TLR2, 7, 8, and 9 to stimulate polyvalent immunity J. Exp. Med., February 21, 2006; 203(2): 413 - 424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Goriely, C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit, V. Flamand, F. Willems, and M. Goldman Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 gene activation Blood, February 1, 2006; 107(3): 1078 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tada, S. Aiba, K.-I. Shibata, T. Ohteki, and H. Takada Synergistic Effect of Nod1 and Nod2 Agonists with Toll-Like Receptor Agonists on Human Dendritic Cells To Generate Interleukin-12 and T Helper Type 1 Cells Infect. Immun., December 1, 2005; 73(12): 7967 - 7976. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Freeman, M. Hewison, S. V. Hughes, K. N. Evans, D. Hardie, T. K. Means, and R. Chakraverty Expression of 11{beta}-hydroxysteroid dehydrogenase type 1 permits regulation of glucocorticoid bioavailability by human dendritic cells Blood, September 15, 2005; 106(6): 2042 - 2049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ma, Q. Chen, and A. C. Ross Retinoic Acid and Polyriboinosinic:Polyribocytidylic Acid Stimulate Robust Anti-Tetanus Antibody Production while Differentially Regulating Type 1/Type 2 Cytokines and Lymphocyte Populations J. Immunol., June 15, 2005; 174(12): 7961 - 7969. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu, M. Fukata, and M. Arditi TLR Signaling in the Gut in Health and Disease J. Immunol., April 15, 2005; 174(8): 4453 - 4460. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
