The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandhorst, T. T.
Right arrow Articles by Klein, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandhorst, T. T.
Right arrow Articles by Klein, B. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 2004, 173: 7444-7453.
Copyright © 2004 by The American Association of Immunologists

Exploiting Type 3 Complement Receptor for TNF-{alpha} Suppression, Immune Evasion, and Progressive Pulmonary Fungal Infection1

T. Tristan Brandhorst*, Marcel Wüthrich*, Bea Finkel-Jimenez*, Thomas Warner and Bruce S. Klein2,*,{dagger},{ddagger},§

Departments of * Pediatrics, {dagger} Internal Medicine, and {ddagger} Medical Microbiology and Immunology, § Comprehensive Cancer Center, and Department of Pathology and Laboratory Medicine, University of Wisconsin Medical School, University of Wisconsin Hospital and Clinics, Madison, WI 53792


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TNF-{alpha} is crucial in defense against intracellular microbes. Host immune cells use type 3 complement receptors (CR3) to regulate excess TNF-{alpha} production during physiological clearance of apoptotic cells. BAD1, a virulence factor of Blastomyces dermatitidis, is displayed on yeast and released during infection. BAD1 binds yeast to macrophages (M{phi}) via CR3 and CD14 and suppresses TNF-{alpha}, which is required for resistance. We investigated whether blastomyces adhesin 1 (BAD1) exploits host receptors for immune deviation and pathogen survival. Soluble BAD1 rapidly entered M{phi}, accumulated intracellularly by 10 min after introduction to cells, and trafficked to early and late endosomes. Inhibition of receptor recycling by monodansyl cadaverine blocked association of BAD1 with M{phi} and reversed TNF-{alpha} suppression in vitro. Inhibition of BAD1 uptake with cytochalasin D and FcR-redirected delivery of soluble BAD1 as Ag-Ab complexes or of wild-type yeast opsonized with IgG similarly reversed TNF-{alpha} suppression. Hence, receptor-mediated entry of BAD1 is requisite in TNF-{alpha} suppression, and the route of entry is critical. Binding of soluble BAD1 to M{phi} of CR3–/– and CD14–/– mice was reduced to 50 and 33%, respectively, of that in wild-type mice. M{phi} of CR3–/– and CD14–/– mice resisted soluble BAD1 TNF-{alpha} suppression in vitro, but, in contrast to CR3–/– cells, CD14–/– cells were still subject to suppression mediated by surface BAD1 on wild-type yeast. CR3–/– mice resisted both infection and TNF-{alpha} suppression in vivo, in contrast to wild-type and CD14–/– mice. BAD1 of B. dermatitidis thus co-opts normal host cell physiology by exploiting CR3 to subdue TNF-{alpha} production and foster pathogen survival.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The systemic dimorphic fungus Blastomyces dermatitidis produces a progressive pulmonary and disseminated infection and is one of the principal systemic mycoses of humans and animals worldwide. Infections that go undiagnosed or untreated often progress and become fatal even in immunocompetent hosts. The progressive nature of many clinical B. dermatitidis infections distinguishes blastomycosis from several other related mycoses, such as histoplasmosis, coccidioidomycosis, and paracoccidioidomycosis, which more often occur as self-limited infections. A murine model of B. dermatitidis infection has been developed that resembles clinical features of pulmonary blastomycosis in humans (1, 2). Administration of B. dermatitidis via the respiratory route, with as few as 10–100 virulent yeast, leads to a chronic, progressive pneumonia, which consumes mice within weeks of infection (3). Thus, infection with even small numbers of B. dermatitidis cannot be resolved by an immune-competent host.

Although the factors that account for virulence of B. dermatitidis are incompletely understood, a bona fide virulence determinant of the fungus has recently been identified (3). Blastomyces adhesin 1 (BAD1)3 (formerly termed WI-1), a 120-kDa protein, is a major Ag and adhesion-promoting protein on B. dermatitidis. Tandem repeats of BAD1 display immunodominant B cell epitopes (4, 5) and also mediate attachment to CD18 and CD14 receptors on human macrophages (M{phi}) (4). BAD1-null strains of B. dermatitidis created by gene targeting and mutation of the BAD1 locus exhibit greatly reduced pathogenicity (3). In contrast to wild-type yeast, BAD1 knockout strains are nonpathogenic in a murine model, even at high inocula of 105 organisms. These observations underscore the prominent role of BAD1 in the pathogenicity of B. dermatitidis.

Mechanisms that underlie the virulence-promoting effect of BAD1 have been partially elucidated. Adherence is one of them. Yeast that lack BAD1 bind poorly to the lung ex vivo and to M{phi} in vitro (3). However, BAD1 also modulates host immunity early in the course of infection and thereby facilitates establishment of B. dermatitidis in the lung. BAD1 interferes with host immunity by blocking production of the proinflammatory cytokine, TNF-{alpha}, by both M{phi} and neutrophils. Restoration of TNF-{alpha} levels by gene therapy stems the progression of B. dermatitidis infection (5). Furthermore, B. dermatitidis strains expressing truncated BAD1 protein that fails to assemble on the yeast cell surface and fails to mediate adherence of yeast to M{phi} still suppress TNF-{alpha} production and retain wild-type virulence (6). Together, these findings underscore the pivotal role of soluble BAD1 (sBAD1) suppression of TNF-{alpha} in the pathogenesis of blastomycosis.

We recently investigated BAD1 mechanisms that suppress TNF-{alpha} production (7). We found that BAD1 displayed on the surface of B. dermatitidis yeast induces phagocyte TGF-{beta}, which, in turn, suppresses TNF-{alpha} production. Soluble BAD1 released from yeast in lung alveoli in vivo or added to cell culture in vitro suppresses phagocyte production of TNF-{alpha}, but in a manner independent of TGF-{beta}. In the present study we explored how sBAD1 acts to suppress M{phi} TNF-{alpha} production. We demonstrate that entry via type 3 complement receptor (CR3) is requisite for BAD1 action in immune suppression. Redirected entry of the protein (or pathogen) into M{phi} via alternate receptors buffers the cells against BAD1 action, bolsters host resistance, and stems the progression of lethal pulmonary blastomycosis. Although pathogens have been reported previously to suppress IL-12 in a CR3-dependent manner (8, 9, 10, 11), to our knowledge this is the first example of a microbe virulence factor that suppresses TNF-{alpha} by exploiting CR3. This pathogen strategy takes on heightened significance in view of the recent nationwide outbreak of tuberculosis and histoplasmosis in patients treated with Infliximab for autoimmune disorders (12, 13) and the growing appreciation of the vital role of TNF-{alpha} in controlling intracellular infections (14, 15).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fungi

ATCC strain 26199 of B. dermatitidis (American Type Culture Collection, Manassas, VA), a wild-type, virulent isolate originally obtained from a human patient, was used in this study together with an isogenic nonpathogenic BAD1 knockout strain (no. 55) recently described (3). Isolates of B. dermatitidis were maintained in the yeast form on Middlebrook 7H10 agar slants with oleic acid-albumin complex, grown at 39°C. Liquid cultures of yeast were grown in Histoplasma M{phi} medium.

Reagents

Complete tissue culture medium consisted of RPMI 1640 supplemented with 10% heat-inactivated FBS (HyClone, Logan, UT), 25 mM HEPES buffer, L-glutamine, sodium pyruvate, penicillin, and streptomycin (BioWhittaker, Walkersville, MD). Experiments were performed in the absence of fresh serum and under conditions designed to minimize endotoxin contamination. Medium and serum contained <0.005 U/ml endotoxin. Plasticware was obtained prepackaged and endotoxin-free. Casein, LPS derived from Escherichia coli, Histopaque 1077 and 1119, cytochalasin D, rat IgG, and monodansyl cadaverine (MDC) were purchased from Sigma-Aldrich (St. Louis, MO). mAb DD5-CB4 reactive with the BAD1 25-aa tandem repeat has been described previously (16, 17).

Antigens

Secreted BAD1 was purified as previously described (18). Briefly, yeast were grown in liquid Histoplasma M{phi} medium in a gyratory shaker at 37°C for 2 wk. BAD1 was purified from supernatants in two steps, using anion exchange chromatography, followed by hydrophobic interaction chromatography. The homogeneity of purified BAD1 was analyzed by SDS-PAGE and silver staining. BAD1–6H was also produced and purified using metal ion chromatography as previously described (6).

ELISA

A commercial ELISA was used to measure TNF-{alpha} in supernatants (R&D Systems, Minneapolis, MN). ELISAs were developed with streptavidin-HRP and substrate tetramethylbenzidine (Sigma-Aldrich). The OD450 of the wells was measured with an automatic plate reader as described above. The limit of detection in this assay is >16 pg/ml.

Cells and cell lines

RAW 264.7 M{phi} were obtained from American Type Culture Collection. Peritoneal exudate cells (PEC) were isolated as follows. At 16 and 3 h before PEC isolation, mice were injected i.p. with 3 ml of 10% casein in PBS. Cells were harvested in 3 ml of cold PBS supplemented with 0.05% EDTA. After two washes with HBSS (Invitrogen Life Technologies, Gaithersburg, MD), M{phi} were plated on 24-well plates at a concentration of 106/ml, incubated for 2 h at 37°C, and washed to remove nonadherent cells. Cells and cell lines were incubated in RPMI 1640 tissue culture medium as described above. Yeast and M{phi} were incubated at an E:T cell ratio of 4:1, unless otherwise indicated. After varying periods of incubation, supernatants were removed and frozen at –20°C until TNF-{alpha} was determined.

To block receptor-mediated endocytosis of sBAD1, MDC was used as previously described (19, 20). M{phi} were cocultured first with BAD1-null strain 55 for 4 h to stimulate TNF-{alpha} production. Wells were washed with cold RPMI 1640 to remove nonadherent yeast, and 50 µM MDC in DMSO or DMSO alone was added, because initial assays defined this concentration of MDC to be optimal. Cells were incubated for 2 more hours, and sBAD1 or medium alone was added. Supernatants were taken for TNF-{alpha} measurement after 18 more hours of incubation.

To block internalization of sBAD1, cytochalasin D was used as previously described (21). After incubation of M{phi} and yeast for 4 h as described above, the cultures were treated with 2 µM cytochalasin D in DMSO or with DMSO alone for 40 min before addition of sBAD1 or, in some cases, wild-type yeast strain 26199. Supernatants were assayed for TNF-{alpha} content after an additional 20-h incubation. Cytochalasin D or DMSO also was maintained in the assay throughout the experiment.

To opsonize wild-type yeast, anti-BAD1 mAb was mixed with yeast cells (1 µg/106 yeast) for 1 h at 37°C, and the cells were washed with RPMI 1640 before they were added to wells containing M{phi}. Alternatively, sBAD1 protein was first incubated with an equimolar amount of anti-BAD1 mAb (or rat IgG control) for 1 h at 37°C before addition to wells containing cells.

Yeast binding and phagocytosis assays were performed as previously described (5). M{phi} from PEC were plated at 1 x 105 cells/well in 16-well tissue culture chamber slides (Nunc, Naperville, IL). After overnight incubation at 37°C in 8% CO2, medium in each well was replaced with fresh medium containing 4 x 105 B. dermatitidis yeast. Binding and phagocytosis of yeast were analyzed in vitro as previously described (6, 17, 22, 23). M{phi} and yeast were incubated at an E:T cell ratio of 1:4 for 1 and 6 h at 37°C in 8% CO2. Unattached yeast were removed by washing wells three times with PBS. Attached, uningested yeast were stained with 0.1% Uvitex 2B (Specialty Chemicals for Medical Diagnostics, Kandern, Germany) for 30 s. Cells were fixed in paraformaldehyde (1%) for 15 min. After fixation, glycerol was added to the slide. To quantify binding and phagocytosis, the number of yeast attached to and ingested by 300–400 M{phi} was counted at x600 magnification using a U-MWU fluorescence cube in an Olympus BX60 microscope (Leeds Precision Instruments, Minneapolis, MN). The association index is defined as the number of attached and ingested yeast divided by the number of M{phi} counted. The ingestion index is defined as the number of yeast ingested per M{phi}.

Mouse strains

Inbred male CR3 (CD11b)-deficient B6.129S4-Itgamtm1Myd (stock no. 003991), CD14-deficient B6.129S-Cd14tm1Frm (stock no. 003726), and wild-type C57BL/6 mice, 6–7 wk of age at the time of purchase, were obtained from The Jackson Laboratory (Bar Harbor, ME). Knockout strains have been backcrossed to C57BL/6 for 10 (CR3–/–) and eight (CD14–/–) generations. Mice were housed and cared for throughout these experiments according to guidelines of the University of Wisconsin animal care committee, who approved all aspects of this work.

Fluorescence analysis of labeled BAD1

BAD1 was conjugated to Alexa 546 or Alexa 488 using an Alexa Fluor protein-labeling kit (Molecular Probes, Eugene, OR) and following the manufacturer’s instructions. The molar ratio of Fluor:protein was calculated to be 1:1 in each case by absorbance spectroscopy.

For FACS quantification of BAD1 uptake, RAW264.7 cells were seeded onto 48-well cell culture plates (Corning, Corning, NY) in RPMI 1640 plus 10% FCS medium at 5 x 105 cells/well and allowed to adhere overnight. Incubations of cells with BAD1-Alexa 488 and MDC were performed in RPMI 1640 without calf serum. Cells were incubated with or without MDC (50, 100, or 200 µM) for 15–180 min before adding BAD1-Alexa 488 for an additional hour. At the end of this time course, medium was removed, and cells were washed twice with PBS before they were trypsinized. Cells were dislodged from the well surfaces by incubation in 200 µl of trypsin/EDTA solution (Cellgro; Mediatech, Herndon, VA) for 15 min at 37°C. Cells were transferred to sterile microfuge tubes containing 300 µl of ice-cold RPMI 1640 plus 10% FCS and kept on ice for the remainder of the experiment. BAD1-Alexa 488 uptake was quantified in a FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA). A similar protocol was used to study the uptake of BAD1-Alexa 488 by primary M{phi} obtained from the peritoneal cavities of wild-type mice, mice deficient in CD11b (CR3), and mice deficient in CD14. Briefly, cells were seeded onto 48-well cell culture plates in RPMI 1640 plus 10% FCS medium at 1 x 106 cells/well and allowed to adhere overnight. Primary cells were incubated with 2 or 10 µg/ml BAD1-Alexa 488 for 20, 40, 60, and 120 min. Cells were collected, washed, and analyzed as described above.

For fluorescent microscopy, RAW264.7 cells were seeded onto Nunc chamber slides in RPMI 1640 plus 10% FCS medium at 5 x 104 cells/well and allowed to adhere overnight. Incubations of cells with BAD1-Alexa 546 were performed in RPMI 1640 without calf serum. Where it was desirable to visualize the exterior of individual M{phi}, FITC anti-mouse CR3 Abs were used (BD Biosciences, San Diego, CA). Visualization of early endosomes was achieved by adding 10 µg of Alexa Fluor 488 transferrin (Molecular Probes) to each well of RAW264.7 cells 10 min before fixation. Stained cells were washed twice with ice-cold PBS and fixed with fresh 4% paraformaldehyde in PBS for 20 min. Late endosome-specific staining was developed with FITC anti-mouse CD107a (lysosome-associated membrane protein 1 (LAMP-1))-conjugated Abs (BD Biosciences) postfixation. For postfixation staining, cell membranes were permeabilized with 0.2% Triton X-100 for 2 min and then washed twice with PBS. MDC-treated cells were exposed to a concentration of 200 µM MDC for 20 min before BAD1 uptake. Images were collected at x40 and x100 on a motorized Axioplan IIi (Zeiss, New York, NY) equipped with a rear-mounted excitation filter wheel and a triple-pass (4',6-diamido-2-phenylindole hydrochloride/FITC/Texas Red) emission cube. Fluorescence images were captured with a Zeiss AxioCam B&W CCD camera and were lightly deconvolved by a nearest neighbor algorithm, pseudo-colored, and merged using OpenLabs 3.0 software (Improvision, Lexington, MA). Brightfield images were captured as described above using differential interference contrast.

Experimental infection

Mice were infected intratracheally with 2 x 102 yeast of ATCC strain 26199 as previously described (24). Two to 3 wk later, when the first mice were moribund, all mice were killed to analyze extent of lung infection, which was determined by plating of homogenized lung and enumeration of yeast CFU on brain heart infusion (Difco, Detroit, MI) agar.

For histology, lung tissue was fixed in 10% formalin and embedded in paraffin wax. Sections 5 µm thick were stained with H&E and Gomori’s methenamine silver. Areas of pneumonic consolidation were measured at a final projected magnification of x8.8 and expressed as a percentage of the total lung areas in sections. The number of yeast was counted in 20 fields with a x60 objective, projected on a television screen, and expressed as yeast per high power field.

Measurement of TNF-{alpha} in alveolar fluids and lung homogenates

Alveolar fluid was obtained from mice by bronchoalveolar lavage (5). Briefly, alveolar fluid was harvested through a 20-gauge catheter placed intratracheally. A volume of 1 ml of PBS containing 0.5% EDTA was instilled and reaspirated once, yielding a total volume of 0.8 ml of lavage fluid/mouse. Individual fluid samples were centrifuged at 2500 rpm for 10 min. Supernatants were collected, frozen at –20°C, and thawed once for testing. The TNF-{alpha} content in individual samples was quantified by ELISA.

Lavaged whole lungs were harvested from killed mice. Before removal of lungs, the pulmonary vasculature was perfused through the left ventricle with PBS containing 0.5% EDTA. After removal, whole lungs were homogenized in 1.5 ml of PBS containing complete protease inhibitors (Roche, Indianapolis, IN) by crushing the organs in 40-µm pore size cell strainers (BD Biosciences, Lincoln Park, NJ). Homogenates were centrifuged at 2500 rpm for 10 min. Supernatants were passed through a 0.45-µm pore size filter (Gelman Sciences, Ann Arbor, MI) and stored at –20°C. The TNF-{alpha} content in individual samples was quantified as described above.

Real-time RT-PCR

Total RNA was isolated from bronchoalveolar lavage pellets (>90% alveolar M{phi}) using the RNeasy Mini Kit (Qiagen, Valencia, CA). RNA was purified over RNeasy minicolumns and treated with the RNase-free DNase Set (Qiagen). RNA (0.5–1 µg) in a final volume of 20 µl was reverse transcribed using random hexamers and the TaqMan RT-PCR Kit (Applied Biosystems, Foster City, CA). Five microliters of a 1/10 dilution of cDNA was amplified in a final volume of 25 µl of PCR using SYBR Green Supermix (Bio-Rad, Hercules, CA). Primers were used as previously described (25) at a final concentration of 100 nM: TNF-{alpha} (forward, TGGCCTCCCTCTCATCAGTT; reverse, TCCTCCACTTGGTGGTTTGC) and 18S rRNA as an endogenous control gene (forward, CGCCGCTAGAGGTGAAATTCT; reverse, CGAACCTCCGACTTTCGTTCT). Amplification was performed in an iCycler iQ real-time PCR detection system (Bio-Rad) and was assayed under the same conditions for all targets: 5 min at 95°C, 45 cycles of 15 s at 95°C, and 45 s at 60°C. Transcript quantity was calculated using the comparative threshold cycle method (26) and was reported as the n-fold difference relative to a calibrator cDNA (i.e., sample from wild-type mice).

Statistical analysis

Differences in TNF-{alpha} levels and in association and phagocytosis indexes between groups were analyzed using standard ANOVA methods (26). Differences in the number of lung CFU were analyzed using the Wilcoxon rank-sum test for nonparametric data (27, 28). A two-sided value of p <0.05 was considered statistically significant. A Bonferroni correction was used as a post-test to adjust for multiple comparisons.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Internalization of sBAD1 by M{phi}

B. dermatitidis releases sBAD1 in quantity (up to 25 mg/l) during growth in vitro (18, 29) and in the host lung alveolus during infection (7). In this study we analyzed the fate of sBAD1 after interaction with M{phi}, cells that mediate host defense against the fungus, but are also modulated by B. dermatitidis surface and sBAD1. After the addition of exogenous Alexa Fluor-labeled BAD1 to cells, the protein was internalized rapidly and detected intracellularly by 10 min. After 20 min, cells were packed with dense, focal collections of BAD1 protein that were polarized to the cell’s edge, just under the plasma membrane. After 2–4 h of incubation, collections of internalized BAD1 were distributed widely throughout the intracellular compartment (Fig. 1A).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 1. Internalization of sBAD1 by M{phi}. A, Alexa Fluor-labeled BAD1 (red) was added to wells containing RAW264.7 M{phi}. At serial time points of incubation, the cells were fixed with paraformaldehyde, stained for surface CR3 (green), and analyzed for fluorescence by confocal microscopy in the absence or the presence of MDC. B, Intracellular staining of the endosomal markers transferrin receptor, and LAMP-1 concurrently with inspection of Alexa Fluor-labeled BAD1 in M{phi}. The top row shows FITC-labeled transferrin binding to the transferrin receptor in early endosomes at 10 min of incubation and Alexa Fluor (red)-labeled BAD1. The bottom row shows FITC-labeled LAMP-1 Ab binding to LAMP-1 in lysosomes and Alexa Fluor 546-labeled BAD1 after 1 h of incubation. Overlay of the images demonstrates colocalization of BAD1 in compartments with transferrin and LAMP-1.

 
To identify which intracellular compartments contained sBAD1, we simultaneously followed the fate of BAD1 with transferrin receptor and LAMP-1. These latter two proteins are markers for early and late endosomes, respectively (30). Within 10 min of incubation, BAD1 colocalized with the transferrin receptor in early endosomes, and by 60 min of incubation, BAD1 colocalized with LAMP-1 in late endosomes or phagolysosomes (Fig. 1B). Thus, BAD1 is targeted to intracellular compartments that represent a traditional endocytic pathway within cells.

There are multiple routes of protein entry into early endosomes of host cells; one of these is receptor-mediated endocytosis (31). Because surface BAD1 on yeast has previously been shown to bind the fungus to human M{phi} by engaging CR3 and CD14 (4), we explored whether binding of receptors was requisite for sBAD1 internalization by M{phi}. MDC, an inhibitor of receptor recycling and receptor-mediated endocytosis, blocked binding of BAD1 to M{phi} in a concentration-dependent manner (Fig. 2). At a maximal concentration of 200 µM, MDC blocked nearly 95% of BAD1 binding to M{phi}. Inhibition of BAD1 binding was evident at 15 min, which was the earliest time point analyzed, and persisted throughout the entire 3-h period of incubation of BAD1 with M{phi}. Microscopic inspection of cells treated with MDC confirmed that they were largely devoid of intracellular BAD1 (Fig. 1A). Thus, sBAD1 is delivered into M{phi} chiefly by binding to cell surface receptors, which direct the protein to early endosomes.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2. Receptor-mediated binding of sBAD1 to M{phi}. Alexa Fluor-labeled BAD1 was added to wells containing RAW264.7 M{phi} that had first been treated with MDC to inhibit receptor recycling using the concentrations shown. At serial time points after incubation, FACS was performed to measure sBAD1 binding. The percent inhibition of BAD1 binding due to MDC treatment was quantified by comparison with cells that were treated with vehicle alone as a control. Results shown are the mean ± SEM for four independent experiments.

 
Roles of ligand-receptor binding and internalization during sBAD1 suppression of TNF-{alpha} production by M{phi}

We wondered whether inhibition of receptor recycling and BAD1 internalization into M{phi} would affect M{phi} TNF-{alpha} production in response to a positive stimulus. To perform these experiments in a manner that biologically mimics the host-pathogen interaction, we first cultured M{phi} with BAD1-null strain 55, and after M{phi} had internalized yeast, we removed extracellular yeast and then added MDC to the wells for 2 h before the addition of sBAD1 protein. Soluble BAD1, added even 4 h after M{phi} had internalized yeast, suppressed TNF-{alpha} production by >4-fold in response to strain 55. Treatment of the M{phi} with 50 µM MDC virtually abolished the ability of sBAD1 to suppress TNF-{alpha} production, whereas MDC treatment by itself did not significantly influence the response to preingested strain 55 yeast (Fig. 3A). These findings imply that sBAD1 must bind receptors to suppress TNF-{alpha} production by M{phi} in response to B. dermatitidis. However, BAD1 is unlikely to perturb M{phi} responses if the protein fails to interact with the cells. Consequently, these results do not address whether binding alone of sBAD1 to M{phi}, without subsequent internalization of the protein, is sufficient for BAD1 to suppress TNF-{alpha} production.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. Receptor-mediated entry of sBAD1 in M{phi} is required to suppress TNF-{alpha} production. After primary peritoneal M{phi} had ingested B. dermatitidis yeast (BAD1-null strain 55) over 4 h, nonassociated yeast were removed, and M{phi} were treated as described below to block receptor-mediated endocytosis before 10 µg of sBAD1 was added to the wells. Supernatant was collected from wells 18 h later and measured for TNF-{alpha} by ELISA. Results are the mean ± SE of four independent experiments. A, Ability of 50-µM MDC treatment of M{phi} to block receptor-mediated endocytosis of sBAD1. *, p < 0.0001 compared with each of the other groups. B, Ability of cytochalasin D (cytoD) treatment of M{phi} to selectively block phagocytosis, but not binding, of either sBAD1 or wild-type yeast (strain 26199) that express surface BAD1. *, p < 0.0001 when BAD1 or 26199 groups are compared with the respective groups treated with cytochalasin D.

 
To test whether binding of sBAD1, in the absence of internalization, is sufficient for TNF-{alpha} suppression, we used an inhibitor of actin microfilament organization. Cytochalasin D permits ligand binding while selectively blocking phagocytosis (21). In these assays, M{phi} were first cultured with BAD1-null strain 55 for 4 h to allow phagocytosis of the positive stimulus, washed to remove nonassociated yeast, and then treated with cytochalasin D for 30 min before addition of sBAD1. Cytochalasin D markedly inhibited the ability of sBAD1 to suppress the production of TNF-{alpha} by M{phi} (Fig. 3B). Neither the inhibitor nor the vehicle alone retarded TNF-{alpha} production in response to the positive (yeast) stimulus. In parallel, we verified that cytochalasin D permitted binding and selectively blocked phagocytosis by quantifying binding and phagocytosis of wild-type strain 26199 by M{phi} treated with the inhibitor (data not shown).

We have previously shown that wild-type yeast (displaying surface BAD1) block TNF-{alpha} production by M{phi} even when these yeast are presented alongside BAD1-null strain 55 (5, 7). We tested in this study whether blocking phagocytosis of wild-type strain 26199 altered its ability to suppress TNF-{alpha} production in response to strain 55. In wells in which M{phi} had first preingested strain 55 yeast and produced TNF-{alpha} in response to the yeast, blocking phagocytosis of wild-type strain 26199 with cytochalasin D sharply retarded its ability to suppress TNF-{alpha} production (Fig. 3B). Thus, sBAD1 and surface BAD1 on wild-type yeast must bind receptors and enter host M{phi} to suppress TNF-{alpha} production in response to the fungus.

Requirement for selective route(s) of cellular entry during BAD1 TNF-{alpha} suppression

Because both binding of receptors and internalization of sBAD1 are requisite for TNF-{alpha} suppression, we analyzed whether the particular receptor(s) used to deliver BAD1 into host cells influenced the function of the protein on M{phi}. To explore this question, we tested the influence of delivering sBAD1 (and wild-type yeast) via FcR. After M{phi} had preingested BAD1-null strain 55 for 4 h, the cells were exposed to various stimuli, including sBAD1 alone, Ag-Ab complexes of BAD1 plus anti-BAD1 mAb, wild-type yeast alone, and wild-type yeast opsonized with anti-BAD1 mAb. Both sBAD1 and wild-type yeast alone sharply suppressed TNF-{alpha} production. However, neither BAD1 in the form of an Ag-Ab complex nor that on the surface of opsonized wild-type yeast was able to suppress TNF-{alpha} production (Fig. 4). Addition of anti-BAD1 mAb alone to M{phi} did not stimulate TNF-{alpha} production. Conversely, the addition of rat IgG control Ab to wild-type strain 26199 did not alter TNF-{alpha} suppression mediated by the yeast. These results argue that the precise route of delivery of BAD1 into the cell may be important in its mechanism of action in TNF-{alpha} suppression, and that delivery via FcR is not suitable.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Redirected entry of sBAD1 or wild-type yeast restores TNF-{alpha} production by M{phi} in response to B. dermatitidis. After primary peritoneal M{phi} had ingested B. dermatitidis yeast (BAD1-null strain 55) over 4 h, nonassociated yeast were removed, and the M{phi} were treated with various stimuli, including anti-BAD1 mAb-opsonized wild-type yeast, Ag-Ab complexes of anti-BAD1 mAb plus sBAD1 protein, sBAD1 alone, or wild-type strain 26199 alone. Supernatant was collected from wells 18 h later and measured for TNF-{alpha} by ELISA. Results are the mean ± SEM of four independent experiments. *, p < 0.0005 compared with the respective group not treated with anti-BAD1 mAb. Addition of anti-BAD1 mAb alone to wells with M{phi} (as a control) failed to induce production of TNF-{alpha} above the level with medium alone, and addition of rat IgG to wells with BAD1 or wild-type yeast failed to suppress production of TNF-{alpha} (data not shown).

 
Because BAD1 on the yeast surface binds the fungus to human M{phi} via CR3 and CD14 (4), we investigated the roles of these receptors in dictating sBAD1 binding, entry, and TNF-{alpha} suppression using M{phi} from knockout mice lacking these receptors. M{phi} from both CR3- and CD14-deficient mice bound significantly less Alexa Fluor-labeled BAD1 than cells from wild-type mice at all time points throughout the course of incubation from 20–120 min (Fig. 5A). As the incubation proceeded, these differences became more pronounced. By 120 min, binding to CR3- or CD14-deficient cells had begun to plateau, whereas binding to wild-type cells was continuing to increase in a linear fashion. At 120 min, BAD1 binding to CR3- and CD14-deficient cells was, respectively, about one-half and one-third of the binding to wild-type cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. Binding of BAD1 to M{phi} from wild-type mice and CR3- or CD14 receptor-deficient strains. A, After primary peritoneal M{phi} were collected from the mouse strains indicated, soluble Alexa Fluor-labeled BAD1 was incubated with the cells, and binding was analyzed by FACS. Reduction of sBAD1 binding, as quantified by the mean fluorescence intensity, is expressed as a percentage of that detected in wild-type mice. Results are the mean ± SEM of four independent experiments. BAD1 binding to CR3- and CD14-deficient cells was significantly lower than BAD1 binding to wild-type cells (p < 0.01 and p < 0.001, respectively). B, TNF-{alpha} production by peritoneal M{phi} from wild-type and receptor-deficient strains of mice in response to the positive stimulus of BAD1-null strain 55 or the immune-suppressive stimuli of sBAD1 or wild-type yeast strain 26199. Cells were treated with strain 55 alone or together with sBAD1 (10 µg) or were treated with strain 26199 alone. Supernatants were collected after 24 h of incubation, and TNF-{alpha} levels were determined by ELISA. Results are the mean ± SEM of four independent experiments. *, p < 0.0001; **, p < 0.05 compared with strain 55 alone in the respective group of mice.

 
In parallel with analysis of sBAD1, we investigated the binding and ingestion of wild-type yeast by M{phi} from these strains of mice. Under nonopsonic conditions, M{phi} from wild-type mice bound yeast more efficiently than did cells of either CR3- or CD14-deficient strains of mice (Table I). At 6 h of incubation, association of yeast with M{phi} was reduced by ~25% in CR3- and CD14-deficient mice compared with wild-type mice (p = 0.005 and p = 0.001, respectively); in contrast, phagocytosis was not significantly altered. Hence, taken together, the loss of CR3 or CD14 receptors led to a reduction in M{phi} binding of sBAD1 and to modest reductions in M{phi} binding of wild-type yeast; however, the loss of either receptor did not fully abolish physical interactions of sBAD1 or yeast with the cells.


View this table:
[in this window]
[in a new window]
 
Table I. Binding and ingestion of B. dermatitidis by macrophages from wild-type mice and receptor-deficient strains

 
Because redirected entry of sBAD1 and opsonized wild-type yeast interfered with BAD1 suppression of TNF-{alpha} in M{phi}, we tested whether the loss of either CR3 or CD14 receptors affected BAD1 action on M{phi}, even if the loss of either receptor did not fully abolish physical interactions of sBAD1 or yeast with the cells. Soluble BAD1 and wild-type yeast sharply suppressed TNF-{alpha} production by M{phi} from wild-type mice. In contrast, however, neither sBAD1 nor wild-type yeast suppressed TNF-{alpha} in M{phi} from CR3-deficient mice (Fig. 5B). Cells from CR3-deficient mice were resistant to concentrations of BAD1 ranging from 1–40 µg/ml (data not shown).

M{phi} of CD14-deficient mice demonstrated an intermediate phenotype. Their reaction was similar to that of CR3-deficient mice in response to sBAD1, but similar to that of wild-type mice in response to parental strain 26199 (Fig. 5B). Hence, sBAD1 failed to suppress the production of TNF-{alpha} in CD14-deficient cells, but wild-type yeast were able to suppress TNF-{alpha} production in the cells. Thus, although the absence of CR3 receptors buffered M{phi} from the suppressive effects of sBAD1 and wild-type yeast, the absence of CD14 did so only in response to the soluble protein, but not BAD1, on wild-type yeast.

Outcome of experimental pulmonary blastomycosis in mice lacking CR3 and CD14 receptors

Because BAD1 is pivotal in the pathogenicity of B. dermatitidis and acts in part by suppression of TNF-{alpha} production in vivo, we explored whether redirecting entry of sBAD1 or wild-type B. dermatitidis into M{phi} via alternate receptors would buffer the host against suppression of TNF-{alpha} and alter the outcome of infection. In these experiments mice were infected intratracheally with a lethal dose of wild-type yeast to establish progressive pulmonary blastomycosis. We have previously demonstrated that the burden of lung infection, as determined by CFU, correlates closely with mortality rates during survival analysis (24, 25, 32). At 19 days postinfection, wild-type mice had almost 107 CFU in the lung and appeared moribund, whereas CR3-deficient animals had sharply reduced numbers of yeast, with 1–2 logs lower CFU (p < 0.02; Fig. 6), and did not appear ill at the time of CFU analysis. In contrast to CR3-deficient mice, CD14-deficient mice demonstrated significantly higher lung CFU values (p < 0.002), similar to those in wild-type mice. Most of the CD14-deficient mice had died or were near death by 19 days postinfection; six of the nine CD14–/– mice had already died by this time point, whereas all CR3–/– mice and wild-type mice were alive (p < 0.001 and p < 0.009 for survival of CD14–/– vs wild-type and CR3–/– mice, respectively).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 6. Outcome of primary pulmonary blastomycosis after infection of wild-type mice and CR3- or CD14-deficient strains. A, Lung CFU. Mice (n = 9–10) from each group were infected intratracheally with 2 x 102 wild-type yeast of strain 26199. Mice were killed to analyze lung CFU 19 days after infection, when wild-type controls began to manifest signs of illness. CFU data represent the number per lung averaged for the group. *, p < 0.002 vs CD14–/– mice; p < 0.02 vs wild-type mice. B, TNF-{alpha} levels in lungs of mice infected with B. dermatitidis. Mice were infected intratracheally with 2 x 104 wild-type yeast of strain 26199. Alveolar lavage fluid was collected as shown 24, 48, and 72 h after infection. Results are the mean ± SE of samples for three to five mice per group. *, p < 0.05 vs wild-type mice; **, p < 0.05 vs CD14–/– and wild-type mice. C, Histological appearance of lung tissue. Mice were infected as described in A, and their lungs were analyzed 19 days after infection. Upper panel, Histological appearance of lung tissue stained by H&E. Images are magnified x20, and each bar denotes 0.5 mm. Lower panel, Histological appearance after staining with Gomori methenamine silver (GMS) to depict yeast. Images are magnified x100, and each bar denotes 0.1 mm.

 
To analyze concurrent perturbations in BAD1 TNF-{alpha} suppression, we measured TNF-{alpha} in the lungs of these groups of mice. In prior studies (5, 6, 7), we compared the course of infection of isogenic BAD1+/– yeast. We observed that BAD1 suppresses TNF-{alpha} early in the infection, and that this immune suppression can be detected in the first few days when numbers of organisms are similar for wild-type and BAD1-null yeast. Accordingly, we quantified TNF-{alpha} in the lungs of mice during the first 72 h postinfection. At all three time points analyzed, levels of TNF-{alpha} protein in alveolar lavage fluid were ~6-fold higher in CR3-deficient mice compared with wild-type mice (Fig. 6B; p < 0.01). Levels in CD14-deficient mice were similar to those in wild-type mice. Levels of TNF-{alpha} transcript in leukocytes lavaged from the alveoli of these mice showed corresponding and statistically significant differences, as did the levels of TNF-{alpha} protein in lung homogenates (data not shown). Thus, TNF-{alpha} responses in vivo correlated with those in vitro and indicated that the absence of CR3 receptors buffered the host against the immune suppression mediated by BAD1.

To further assess alterations in inflammatory response as a consequence of redirected entry of BAD1 or wild-type yeast into M{phi}, we inspected the histological appearance of lung tissues from these groups of mice. At the time mice were analyzed for lung CFU, 19 days postinfection, the inflammatory response differed sharply among the groups. The histological appearance of tissue inflammation was similar for wild-type and CD14-deficient mice, showing diffuse and extensive inflammation replacing most of the alveoli, poorly organized granulomas, and vast numbers of healthy, intact yeast within and outside granulomas. In contrast, the extent of lung involvement was reduced in the lungs of CR3-deficient mice, and they had >10-fold fewer yeast in tissue (Fig. 6C; 10 yeast/high power field in CR3-deficient mice vs 104 and 100 for wild-type and CD14 deficient mice, respectively). One of the most striking features in CR3-deficient mice was the presence of numerous, well-organized granulomas with discrete, demarcated fibrous capsules circumscribing them, interspersed with normal lung tissue. Also, alveolar M{phi} were more abundant, as was perivascular lymphoid tissue, which consisted of lymphocytes and plasma cells. Within the well-organized granulomas of CR3-deficient mice, we visualized many misshapen yeast with irregular surface contours and degraded cell walls, suggesting that the cells were in various stages of disintegration. Thus, the inflammatory response differed in CR3-deficient mice and suggested more efficient walling off of the infection with a mature granulomatous response and possibly more efficient digestion and destruction of the yeast within the granulomas.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The crucial role of TNF-{alpha} in host defense against intracellular microbial pathogens such as Mycobacterium tuberculosis and Histoplasma capsulatum has been dramatically underscored by the increase in these infections in patients who received anti-TNF-{alpha} treatment for underlying autoimmune conditions (12, 13). These therapeutic interventions have been designed to stem the toxicity known to result from excess production of TNF-{alpha} (14). Host phagocytes, under normal physiological circumstances, have evolved CR3-dependent mechanisms to avoid the deleterious consequence of continuous exposure to inflammatory stimuli and release of proinflammatory cytokines. For example, dendritic cells use CR3 during elimination of apoptotic cells to down-regulate TNF-{alpha} in addition to other proinflammatory cytokines (33). The present study demonstrates that BAD1 ligation of CR3 similarly suppresses TNF-{alpha} and implies that a fungal pathogen and its principal virulence factor may exploit this normal host cell physiology as a survival strategy during the host-microbe interaction.

BAD1 of B. dermatitidis is an established virulence factor that mediates fungal pathogenicity in part by suppressing TNF-{alpha} production by M{phi} (3, 5, 6). Surface BAD1, an adhesin, suppresses TNF-{alpha} in a TGF-{beta}-dependent manner (7). Soluble BAD1 released from yeast cells also suppresses TNF-{alpha} and is sufficient for pathogenicity in vivo (6), underscoring the importance of shed BAD1 in the pathogenesis of infection.

In this study we delineated the steps involved and requirements for sBAD1 suppression of TNF-{alpha}. BAD1 enters M{phi} rapidly, appearing in cells within 10 min of its introduction to cells. Particles can be taken up by cells via multiple routes (30). Pinocytosis, for example, involves the nonspecific "drinking" of extracellular elements. We show that sBAD1 is internalized into M{phi} via specific receptor-mediated endocytosis. MDC, an inhibitor of receptor recycling (20), abolished the association of sBAD1 with cells in a concentration-dependent manner, as quantified by FACS and confirmed visually by confocal microscopy. The pathway the protein takes once in the cell involves a traditional trafficking route to early and late endosomes. This conclusion is based on studies of sBAD1 colocalization with transferrin and LAMP-1, molecular markers for early and late endosomes, respectively. These markers depict maturation of sBAD1-containing endosomes, but do not address whether sBAD1 interferes with phagosome lysosome fusion, a mechanism involved in intracellular survival by other microbes. Additional contents of sBAD1-containing endosomes, such as lipid raft microdomains, calveolae, or clathrin, are also under study.

Receptor-mediated endocytosis of sBAD1 is required for suppression of M{phi} TNF-{alpha} production. Treatment of cells with MDC reversed sBAD1 TNF-{alpha} suppression. Because MDC interfered with sBAD1 receptor binding, and little, if any, sBAD1 associated with the cell by alternate routes, this result is not surprising. Cytochalasin D treatment of M{phi}, designed to block sBAD1 uptake, but not binding, also reversed TNF-{alpha} suppression, implying that receptor binding alone by sBAD1 was insufficient, and internalization of BAD1 is requisite. This finding could imply that receptors are responsible for delivery of sBAD1 into a compartment where it must interact with elements of the signaling apparatus. Soluble BAD1 in endosomes could interfere with positive signaling events there or, alternatively, trigger a negative signaling pathway. LPS is delivered into cells via receptors (CR3 or CD14), which in themselves do not signal, but, rather, move LPS to a location where TLR4 and MyD88 transduce the intracellular signal (34, 35, 36, 37, 38, 39). The downstream signaling events after BAD1 ligation of CR3 are under study.

Despite the importance of receptor endocytosis of sBAD1 in TNF-{alpha} suppression, delivery of sBAD1 protein or sBAD1-coated yeast into cells by an alternate receptor pathway was insufficient to induce TNF-{alpha} suppression. We previously reported that BAD1 on yeast surfaces mediates binding to CR3 and CD14 (4). In this study we found that delivering sBAD1 into cells as Ag-Ab complexes or delivering wild-type yeast after opsonization with IgG prevented TNF-{alpha} suppression mediated by sBAD1. Hence, sBAD1 must enter cells by a specific route(s) to suppress host immunity. We presume that IgG2a mAb-containing complexes or opsonized particles entered cells via FcR, and that their fate and the composition of vacuolar compartments containing them were different from those for sBAD1 alone or nonopsonized yeast. These findings suggest that Ab-mediated immunity to BAD1 might ameliorate the infection. However, in a previous study (17) we found that anti-BAD1 treatment using the mAb studied in this study failed to protect mice against experimental infection. We addressed many variables that can affect protective efficacy (40), but did not consider the deleterious effects of high Ab concentrations due to prozone effects, as described in Cryptococcus infection (41).

Because we observed in this study that redirected entry of both sBAD1 and opsonized yeast, probably via FcR, restored TNF-{alpha} production, we explored the roles of CR3 and CD14 in binding sBAD1 or yeast surface BAD1 and the ensuing TNF-{alpha} suppression. We observed that binding of sBAD1 was significantly reduced in the absence of either receptor, using M{phi} from CR3–/– and CD14–/– mice. In contrast to the sharp reductions in sBAD1 binding, the adherence and ingestion of yeast were only modestly reduced in these receptor-deficient cells. This result implies that the alternate receptor may compensate in knockout mice, or when one of these key receptors is absent, other phagocyte receptors may promote interaction of yeast with the cells. Of great interest was the finding that CR3-deficient M{phi} were essentially buffered against the TNF-{alpha}-suppressive effects of either sBAD1 or wild-type yeast. In contrast to BAD1 perturbations of wild-type M{phi}, BAD1 failed to suppress TNF-{alpha} production in CR3-deficient cells both in vitro and in vivo.

CR3 have been shown to influence the outcome of other host-pathogen interactions in vitro. Multiple and diverse microbial stimuli, including H. capsulatum, Staphlococcus aureus, and Leishmania major (8, 9), blunt inflammatory responses (IL-12 and IFN-{gamma}) of monocytes and M{phi} in vitro by engaging CR3. In each of these instances, however, and in contrast to the effects of B. dermatitidis and BAD1, TNF-{alpha} production was unaffected. By exploiting CRs, L. major enhances its survival in phagocytes. The promastigote form activates and fixes the third component of complement, which is responsible for the parasite’s survival in mononuclear phagocytes (42). Wright and Siverstein (43) showed that CRs fail to trigger a respiratory burst, while still promoting phagocytosis of C3b- and C3bi-coated particles, and Mosser and Edelstein (42, 44) demonstrated that promastigote entry via CRs diminished the respiratory burst. Although we show in this study that BAD1 subdues proinflammatory responses, notably TNF-{alpha} production, through its interaction with CR3, we did not explore the respiratory burst. BAD1 in soluble form or on yeast surfaces may similarly perturb this host defense mechanism.

Whereas CR3 played a vital role in BAD1 TNF-{alpha} suppression, CD14–/– cells responded differently and were inconsistently buffered against BAD1. CD14–/– M{phi} resisted TNF-{alpha} suppression of sBAD1, but were still vulnerable to the suppression mediated by yeast surface BAD1. Mice lacking CD14 were also not protected against an experimental infection, in sharp contrast to mice lacking CR3, and in vivo levels of TNF-{alpha} were comparably reduced in CD14-deficient and wild-type mice. The reason(s) for the discordant effect of loss of CR3 vs CD14 receptors is unclear. Moore et al. (45) reported divergent responses to LPS and Gram-negative bacteria in CD14–/– M{phi}. The cells were not responsive to LPS, but, nevertheless, bound and internalized heat-killed bacteria, which stimulated responses in these cells by use of alternate receptors such as CR3, albeit at higher bacterial concentrations. Yeast and sBAD1 probably entered M{phi} mainly by CR3 in CD14-deficient mice, a more favorable avenue for pathogen, and this might explain why infection was exacerbated in mice lacking CD14.

CR3 is a crucial receptor for various leukocyte functions, including adherence and transmigration of cells (46, 47). In view of these critical functions, leukocyte adhesin deficiencies have been associated with enhanced susceptibility to recurrent infections in human patients (48) and vulnerability to experimental infection in knockout mice. For example, mice lacking CR3 are more susceptible than wild-type littermates to experimental infections with Streptococcus pneumoniae (49) or the tick-borne agent of human granulocytic erlichiosis, Anaplasma phagocytophila (50), and mice treated with anti-CD11b mAb are vulnerable to L. monocytogenes (51). Because phagocytes, both neutrophils and M{phi}, are thought to play pivotal roles in innate host immunity to B. dermatitidis, it was unclear whether loss of the leukocyte adhesion receptor CD11b/CD18 (CR3) would disadvantage the host or the pathogen during experimental pulmonary blastomycosis. Remarkably, mice lacking CR3 were significantly more resistant to B. dermatitidis infection than either wild-type or CD14-deficient mice. CR3-deficient mice demonstrated 1–2 log fewer fungi in their lungs and several-fold higher TNF-{alpha} levels in their lung alveolar fluid compared with the other groups, and histological analysis of lung tissue corroborated these results. The histological appearance of lung inflammatory responses differed sharply among the groups. Lungs of CR3-deficient mice had more focal disease, and the granulomas were more mature and well circumscribed, compared with the other groups, in which the inflammatory response was intense, diffuse, and poorly organized with respect to granuloma formation. Thus, our in vivo results correlate with in vitro studies, and both point to the fact that loss of CR3 sharply enhances host resistance to infection.

Taken together, our results suggest that BAD1 co-opts CR3 and exploits it to neutralize a key host defense: production of TNF-{alpha}. Bacterial pathogens have been shown to exploit CR3 or related CD18 receptors for survival or dissemination in vivo. Salmonella typhimurium promotes extraintestinal dissemination by CD18-expressing phagocytes (52). The bacterium is transported from the gastrointestinal tract to the bloodstream by phagocytes that express CD18, whereas CD18-deficient mice are resistant to dissemination of Salmonella to the liver and spleen after oral administration. Bordetella pertussis persists within lung M{phi}, without causing tissue injury, in a manner that requires interaction of filamentous hemagglutinin with CR3 on these host cells (53). Loss of the CR3 interaction, by either mutation of filamentous hemagglutinin or treatment with Ab to CR3, blocks the accumulation of viable intracellular bacteria, but not lung pathology. In concert with these earlier findings, Hellwig et al. (54) found that competition between B. pertussis uptake via CR3 or Fc{gamma}R determines the outcome of natural infection. Thus, in vivo studies with bispecific Abs revealed that Fc{gamma}R-mediated uptake facilitates bacterial clearance, in contrast to uptake via CR3. In addition to L. major, cited above (34), these are striking examples where microbes exploit CR3 to their advantage.

B. dermatitidis exploits CR3 in a manner that has not been described among the prior pathogen strategies. BAD1 co-opts an element of the normal host physiology by engaging CR3 to suppress TNF-{alpha} and allay tissue inflammation. By releasing and dispersing sBAD1, the fungus may amplify its suppressive effects locally and distally, allowing it to gain a foothold in the lung despite an army of resident and recruited leukocytes. This tips the balance in favor of the pathogen.

Note added in proof.

A recent review by Romani (55) described other pathogenic fungi that exploit CR3 to evade host immunity.


    Acknowledgments
 
We thank Dr. Jens Eickhoff (Department of Biostatistics and Medical Informatics) for statistical assistance; Robert Gordon (Department of Pediatrics) for assistance with illustrations; Hanna Filutowicz for technical assistance; and Dr. Jay Bangs (Department of Medical Microbiology and Immunology) for assistance with microscopic imaging.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants AI40996 and AI35681, a Burroughs Wellcome Fund Scholarship in Molecular Pathogenic Mycology (to B.S.K.), and a Parker B. Francis Fellowship (to T.T.B.). Back

2 Address correspondence and reprint requests to Dr. Bruce S. Klein, University of Wisconsin-Madison, 600 Highland Avenue, K4/434, Madison, WI 53792. E-mail address: bsklein{at}facstaff.wisc.edu Back

3 Abbreviations used in this paper: BAD1, blastomyces adhesion 1; CR3, type 3 complement receptor; M{phi}, macrophage; MDC, monodansyl cadaverin; PEC, peritoneal exudate cells; PMN, polymorphonuclear leukocyte; sBAD1, soluble BAD1; LAMP-1, lysosome-associated membrane protein 1. Back

Received for publication May 24, 2004. Accepted for publication October 15, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Harvey, R. P., E. S. Schmid, C. C. Carrington, D. A. Stevens. 1978. Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters. Am. Rev. Respir. Dis. 117:695.[Medline]
  2. Wüthrich, M., W. L. Chang, B. S. Klein. 1998. Immunogenicity and protective efficacy of the WI-1 adhesin of Blastomyces dermatitidis. Infect. Immun. 66:5443.[Abstract/Free Full Text]
  3. Brandhorst, T. T., M. Wüthrich, T. Warner, B. S. Klein. 1999. Targeted gene disruption reveals an adhesin indispensable for pathogenicity of Blastomyces dermatitidis. J. Exp. Med. 189:1207.[Abstract/Free Full Text]
  4. Newman, S. L., S. Chaturvedi, B. S. Klein. 1995. The WI-1 antigen on Blastomyces dermatitidis yeasts mediates binding to human macrophage CD18 and CD14 receptors. J. Immunol. 154:753.[Abstract]
  5. Finkel-Jimenez, B., M. Wüthrich, T. T. Brandhorst, B. S. Klein. 2001. Down-regulation of phagocyte TNF-{alpha} production by the WI-1 adhesin imparts pathogenicity on Blastomyces dermatitidis. J. Immunol. 166:2665.[Abstract/Free Full Text]
  6. Brandhorst, T. T., M. Wüthrich, B. Finkel-Jimenez, B. S. Klein. 2003. A C-terminal EGF domain governs BAD1 localization to the yeast surface and fungal adherence to phagocytes, but is dispensable in immune modulation and pathogenicity of Blastomyces dermatitidis. Mol. Microbiol. 48:53.[Medline]
  7. Finkel-Jimenez, B., M. Wüthrich, B. S. Klein. 2002. BAD1, an essential virulence factor of Blastomyces dermatitidis suppresses host TNF-{alpha} production through TGF-{beta} dependent mechanisms. J. Immunol. 168:5746.[Abstract/Free Full Text]
  8. Marth, T., B. L. Kelsall. 1997. Regulation of interleukin-12 by complement receptor 3 signaling. J. Exp. Med. 185:1987.[Abstract/Free Full Text]
  9. Sutterwala, F. S., D. M. Mosser. 1999. The taming of IL-12: suppressing the production of proinflammatory cytokines. J. Leukocyte. Biol. 1999 65:543.[Abstract]
  10. Carrera, L., R. T. Gazzinelli, R. Badolato, S. Hieny, W. Muller, R. Kuhn, D. L. Sacks. 1996. Leishmania promastigotes selectively inhibit interleukin 12 induction in bone marrow-derived macrophages from susceptible and resistant mice. J. Exp. Med. 183:515.[Abstract/Free Full Text]
  11. Mosser, D. M., T. A. Springer, M. S. Diamond. 1992. Leishmania promastigotes require opsonic complement to bind to the human leukocyte integrin Mac-1 (CD11b/CD18). J. Cell Biol. 116:511.[Abstract/Free Full Text]
  12. Zhang, Z., H. Correa, R. E. Begue. 2002. Tuberculosis and treatment with infliximab. N. Engl. J. Med. 346:623.[Free Full Text]
  13. Nakelchik, M., J. E. Mangino. 2002. Reactivation of histoplasmosis after treatment with infliximab. Am. J. Med. 112:78.
  14. McDermott, M. F.. 2001. TNF and TNFR biology in health and disease. Cell. Mol. Biol. 47:619.[Medline]
  15. Allendoerfer, R., G. S. Deepe, Jr. 1998. Blockade of endogenous TNF-{alpha} exacerbates primary and secondary pulmonary histoplasmosis by differential mechanisms. J. Immunol. 160:6072.[Abstract/Free Full Text]
  16. Klein, B. S., J. M. Jones. 1994. Purification and characterization of the major antigen WI-1 from Blastomyces dermatitidis yeasts and immunological comparison with A antigen. Infect. Immun. 62:3890.[Abstract/Free Full Text]
  17. Wüthrich, M., B. S. Klein. 2000. Investigation of anti-WI-1 adhesin antibody mediated protection in experimental pulmonary blastomycosis. J. Infect. Dis. 181:1720.[Medline]
  18. Audet, R., T. T. Brandhorst, B. S. Klein. 1997. Purification in quantity of the secreted form WI-1: a major adhesin on Blastomyces dermatitidis yeast. Protein Expression Purif. 11:219.[Medline]
  19. Vabulas, R. M., P. Ahmad-Nejad, C. da Costa, T. Miethke, C. J. Kirschning, H. Hacker, H. Wagner. 2001. Endocytosed HSP60s use Toll-like receptor 2 (TLR2) and TLR4 to activate the Toll/interleukin-1 receptor-signaling pathway in innate immune cells. J. Biol. Chem. 276:31332.[Abstract/Free Full Text]
  20. Van Leuven, F., J. J. Cassiman, H. Van Den Berghe. 1980. Primary amines inhibit recycling of {alpha}2M receptors in fibroblasts. Cell 20:37.[Medline]
  21. Newman, S. L., C. Bucher, J. Rhodes, W. E. Bullock. 1990. Phagocytosis of Histoplasma capsulatum yeasts and microconidia by human cultured macrophages and alveolar macrophages: cellular cytoskeleton requirement for attachment and ingestion. J. Clin. Invest. 85:223.
  22. Mukherjee, J., L. S. Zuckier, M. D. Scharff, A. Casadevall. 1994. Therapeutic efficacy of monoclonal antibodies to Cryptococcus neoformans glucuronoxylomannan alone and in combination with amphotericin B. Antimicrob. Agents Chemother. 38:580.[Abstract/Free Full Text]
  23. Mukherjee, J., S. C. Lee, A. Casadevall. 1995. Antibodies to Cryptococcus neoformans glucuronoxylomannan enhance antifungal activity of murine macrophages. Infect. Immun. 63:573.[Abstract]
  24. Wüthrich, M., H. I. Filutowicz, T. Warner, B. S. Klein. 2002. Requisite elements in vaccine immunity to Blastomyces dermatitidis: plasticity uncovers vaccine potential in immune-deficient hosts. J. Immunol. 169:6969.[Abstract/Free Full Text]
  25. Wüthrich, M., H. I. Filutowicz, T. Warner, G. S. Deepe, Jr, B. S. Klein. 2003. Vaccine immunity to pathogenic fungi overcomes the requirement for CD4 help in exogenous antigen presentation to CD8+ T cells: implications for vaccine development in immune-deficient hosts. J. Exp. Med. 197:1405.[Abstract/Free Full Text]
  26. Johnson, M. R., K. Wang, J. B. Smith, M. J. Heslin, R. B. Diasio. 2000. Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction. Anal. Biochem. 278:175.[Medline]
  27. Fisher, L. D., G. van Belle. 1993. Biostatistics: A Methodology for the Health Sciences 611. Wiley, New York.
  28. Gibbons, J. D., S. Chakraborti. 1992. Nonparametric Statistical Inference 3rd Ed. Marcel Dekker, New York.
  29. Klein, B. S., S. Chaturvedi, L. H. Hogan, J. M. Jones, S. L. Newman. 1994. Altered expression of surface protein WI-1 in genetically related strains of Blastomyces dermatitidis that differ in virulence regulates recognition of yeasts by human macrophages. Infect. Immun. 62:3536.[Abstract/Free Full Text]
  30. Oksvold, M. P., E. Skarpen, L. Wierod, R. E. Paulsen, H. S. Huitfeldt. 2001. Re-localization of activated EGF receptor and its signal transducers to multivesicular compartments downstream of early endosomes in response to EGF. Eur. J. Cell Biol. 80:285.[Medline]
  31. Mellman, I.. 1996. Endocytosis and molecular sorting. Annu. Rev. Cell Biol. 12:575.[Medline]
  32. Wüthrich, M., H. I. Fillutowicz, B. S. Klein. 2000. Mutation of the WI-1 gene yields an attenuated Blastomyces dermatitidis strain that induces host resistance. J. Clin. Invest. 106:1381.[Medline]
  33. Morelli, A. E., A. T. Larregina, W. J. Shufesky, A. F. Zahorchak, A. J. Logar, G. D. Papworth, Z. Wang, S. C. Watkins, L. D. Falo, Jr, A. W. Thomson. 2003. Internalization of circulating apoptotic cells by splenic marginal zone dendritic cells: dependence on complement receptors and effect on cytokine production. Blood 101:611.[Abstract/Free Full Text]
  34. Chow, J. C., D. W. Young, D. T. Golenbock, W. J. Christ, F. Gusovsky. 1999. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J. Biol. Chem. 274:10689.[Abstract/Free Full Text]
  35. Golenbock, D. T., M. J. Fenton. 2001. Extolling the diversity of bacterial endotoxins. Nat. Immunol. 2:286.[Medline]
  36. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162:3749.[Abstract/Free Full Text]
  37. Poltorak, A., X. He, I. Smirnova, M.-Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  38. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189:615.[Abstract/Free Full Text]
  39. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11:115.[Medline]
  40. Casadevall, A.. 1995. Antibody mediated immunity and invasive fungal infections. Infect. Immun. 63:4211.[Medline]
  41. Taborda, C. P., J. Rivera, O. Zaragoza, A. Casadevall. 2003. More is not necessarily better: prozone-like effects in passive immunization with IgG. J. Immunol. 170:3621.[Abstract/Free Full Text]
  42. Mosser, D. M., P. J. Edelson. 1987. The third component of complement (C3) is responsible for the intracellular survival of Leishmania major. Nature 327:329.[Medline]
  43. Wright, S. D., S. C. Silverstein. 1983. Receptors for C3b and C3bi promote phagocytosis but not the release of toxic oxygen from human phagocytes. J. Exp. Med. 158:2016.[Abstract/Free Full Text]
  44. Mosser, D. M., P. J. Edelson. 1985. The mouse macrophage receptor for C3bi (CR3) is a major mechanism in the phagocytosis of Leishmania promastigotes. J. Immunol. 135:2785.[Abstract]
  45. Moore, K. J., L. P. Andersson, R. R. Ingalls, B. G. Monks, R. Li, M. A. Arnaout, D. T. Golenbock, M. W. Freeman. 2000. Divergent response to LPS and bacteria in CD14-deficient murine macrophages. J. Immunol. 165:4272.[Abstract/Free Full Text]
  46. Hynes, R. O.. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69:11.[Medline]
  47. Springer, T. A.. 1995. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57:827.[Medline]
  48. Anderson, D. C., T. K. Kishimoto, C. W. Smith. 1995. Leukocyte adhesion deficiency and other disorders of leukocyte adherence and motility. C. R. Scriver, Jr, and A. L. Beaudet, Jr, and W. S. Sly, Jr, and D. Valle, Jr, eds. The Metabolic and Molecular Bases of Inherited Disease 3955. McGraw-Hill, New York.
  49. Prince, J. E., C. F. Brayton, M. C. Fossett, J. A. Durand, S. L. Kaplan, C. W. Smith, C. M. Ballantyne. 2001. The differential roles of LFA-1 and Mac-1 in host defense against systemic infection with Streptococcus pneumoniae. J. Immunol. 166:7362.[Abstract/Free Full Text]
  50. Borjesson, D. L., S. I. Simon, E. Hodzic, H. E. DeCock, C. M. Ballantyne, S. W. Barthold. 2003. Roles of neutrophil {beta}2 integrins in kinetics of bacteremia, extravasation, and tick acquisition of Anaplasma phagocytophila in mice. Blood 101:3257.[Abstract/Free Full Text]
  51. Rosen, H., S. Gordon, R. J. North. 1989. Exacerbation of murine listeriosis by a monoclonal antibody specific for the type 3 complement receptor of myelomonocytic cells: absence of monocytes at infective foci allows Listeria to multiply in nonphagocytic cells. J. Exp. Med. 170:27.[Abstract/Free Full Text]
  52. Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le, R. Berggren, W. T. Parks, F. C. Fang. 1999. Extra-intestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 401:804.[Medline]
  53. Hellwig, S. M., H. F. van Oirschot, W. L. Hazenbos, A. B. van Spriel, F. R. Mooi, J. G. van De Winkel. 2001. Targeting to Fc{gamma} receptors, but not CR3 (CD11b/CD18), increases clearance of Bordetella pertussis. J. Infect. Dis. 183:871.[Medline]
  54. Saukkonen, K., C. Cabellos, M. Burroughs, S. Prasad, E. Tuomanen. 1991. Integrin mediated localization of Bordetella pertussis within macrophages: role in pulmonary colonization. J. Exp. Med. 173:1143.[Abstract/Free Full Text]
  55. Romani, L.. 2004. Immunity to fungal infections. Nat. Rev. Immunol. 4:1.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Stapulionis, C. L. Pinto Oliveira, M. C. Gjelstrup, J. S. Pedersen, M. E. Hokland, S. V. Hoffmann, K. Poulsen, C. Jacobsen, and T. Vorup-Jensen
Structural Insight into the Function of Myelin Basic Protein as a Ligand for Integrin {alpha}M{beta}2
J. Immunol., March 15, 2008; 180(6): 3946 - 3956.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. T. Brandhorst, G. M. Gauthier, R. A. Stein, and B. S. Klein
Calcium Binding by the Essential Virulence Factor BAD-1 of Blastomyces dermatitidis
J. Biol. Chem., December 23, 2005; 280(51): 42156 - 42163.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. S. Mobberley-Schuman and A. A. Weiss
Influence of CR3 (CD11b/CD18) Expression on Phagocytosis of Bordetella pertussis by Human Neutrophils
Infect. Immun., November 1, 2005; 73(11): 7317 - 7323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandhorst, T. T.
Right arrow Articles by Klein, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandhorst, T. T.
Right arrow Articles by Klein, B. S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS