| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Molecular Pathogenesis Program, Skirball Institute, and Department of Pathology, New York University School of Medicine, New York, NY 10016
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Upon transfer of purified CD4+CD25+ cells into T cell-deficient mice, scurfy mice, or TCR transgenic RAG–/– mice, a substantial fraction of the cells become CD25–. Conversely, transfer of purified CD4+CD25– cells into T cell-deficient mice generates a population of cells expressing CD25 (10, 25, 26, 27, 28). CD25 expression appears to be more stable upon transfer of purified CD4+CD25+ T cells into wild-type mice (29). Laurie et al. (30) depleted CD4+CD25+ T cells by in vivo administration of anti-CD25 Abs to thymectomized BALB/c recipients and observed that CD25+ T cells returned to pretreatment proportion and functionality 48 days after Ab injection. In this and the previous cases it is unclear whether the CD25+ cells derived from the outgrowth of a small residual CD25+ population or the conversion of CD25– into CD25+ T cells. The biological properties of the cells that acquired CD25 expression through homeostatic proliferation are not well known; likewise, the factors that influence the degree of CD25 marker switching remain poorly understood.
To study these issues we used an experimental system, the T/B monoclonal mice, in which we showed that both CD4+CD25+ and CD4+CD25– T cells display in vivo suppressive activity. On the BALB/c background, T/B monoclonal mice produce hyper-Th2 and IgE responses after a single immunization. These hyperresponses can be prevented by adoptive transfer of total CD4+, purified CD4+CD25+, or CD4+CD25– T cells from BALB/c mice (24). T/B monoclonal mice harbor an I-Ad-restricted, monoclonal, OVA-specific T cell repertoire that lacks CD4+CD25+ T cells, and a monoclonal B cell repertoire specific for a linear peptide from influenza virus hemagglutinin (HA). T/B monoclonal mice were derived by crossing DO11.10 OVA-specific TCR transgenic mice, 17/9 HA-specific Ig H and L chain knockin mice, and RAG-1–/– mice (24).
We show in this study that donor polyclonal CD4+CD25– cells can convert in vivo to CD4+CD25+ upon homeostatic proliferation; the newly generated CD4+CD25+ cells are phenotypically and functionally equivalent to naturally occurring Treg cells. The expression of CD25 in Treg cells, which correlates with their Treg ability, depends on IL-2 secreted by cotransferred CD25– or by Ag-stimulated conventional T cells in peripheral lymphoid organs.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The T/B monoclonal mice (17/9 DO11.10 RAG-1–/–) were previously described (24). T/B monoclonal mice harbor monoclonal populations of T and B lymphocytes that are specific for chicken OVA323–339 and HA of influenza virus, respectively. BALB/c Thy1.2 mice and BALB/c IL-2–/– mice were purchased from The Jackson Laboratory (Bar Harbor, ME). BALB/c Thy1.1 mice were obtained from Dr. F. Zavala (New York University, New York, NY). TCR
-deficient mice were backcrossed to the BALB/c background in our facility. All mice were bred and housed at the Skirball specific pathogen-free animal facility.
Cell purification and adoptive transfer
BALB/c CD4+CD25+ and CD4+CD25– lymphocytes were purified from spleen and lymph nodes by MACS using Miltenyi reagents and a Vario MACS apparatus (Miltenyi Biotec, Auburn, CA).
To purify spleen and lymph node CD4+CD25– cells by MACS, the cells were first incubated with FITC-labeled Abs to CD8, B220, and CD25 (in some experiments Abs to CD11b, CD11c, and TER119 were also added), followed by incubation with anti-FITC magnetic beads. The cells were then passed through the first depletion column, incubated with more anti-FITC magnetic beads, and passed through a second depletion column. Thymic CD4+CD25– cells were purified by depletion of CD8+ and CD25+ cells using a similar two-step protocol. The unbound fraction typically contained 85–95% CD4+CD25– cells, 0.1–0.3% CD25low cells, and no CD25high cells. To purify CD4+CD25+ cells, spleen and lymph node cell suspensions were first depleted of CD8+ and B220+ cells by MACS, incubated with PE-anti-CD25 Abs followed by anti-PE magnetic beads, and subsequently purified as the bound fraction from a MACS column. The purity of the CD25+ population was >95%.
CD25+, CD25–CD45RBhigh, and CD25–CD45RBlow fractions from BALB/c mice used in the experiments shown in Fig. 5 were purified by cell sorting in a MoFlo cytometer (DakoCytomation, Carpinteria, CA) at New York University School of Medicine with 
99% purity. Typically, 1–5 x 106 purified cells were injected i.v. into recipient mice. All recipient mice were treated with broad-spectrum antibiotic (Bactrim; Sulfatrim Pediatric Suspension; Alpharma USPD, Baltimore, MD). Immunization of T/B monoclonal mice was performed the day after cell transfer, i.p. with 100 µg of cross-linked OVA-HA in alum (24).
|
Cells purified as described above were labeled with CFSE (Molecular Probes, Eugene, OR) by incubating 107 cells/ml in PBS with 5 µM CFSE resuspended in DMSO. Labeling was stopped with medium containing 10% FCS.
Immunostaining and RNA analysis
Spleen and lymph node cells from recipient mice were analyzed by flow cytometry using fluorochrome-labeled Abs purchased from BD Pharmingen (San Diego, CA), Caltag Laboratories (Palo Alto, CA), and R&D Systems (Minneapolis, MN). The samples were analyzed using a FACSCalibur or an LSR II cytometer (BD Biosciences, Mountain View, CA). For quantitative mRNA expression analysis, donor-derived CD4+CD25+ and CD4+CD25– cells were MoFlo-sorted. RNA was extracted from the samples using TRIzol, and cDNA was synthesized using standard procedures. The expression of Foxp3, CTLA-4, glucocorticoid-induced TNFR (GITR), and -actin was determined by quantitative real-time PCR using the primers below.
Expression was normalized to the level of -actin in each sample: Foxp3, ACTGGGGTCTTCTCCCTCAA, CGTGGGAAGGTGCAGAGTAG; CTLA-4, GTTGGGGGCATTTTCACATA, TTTTACAGTTTCCTGGTCTC; and -actin, TGACAGGATGCAGAAGGAGA, GTACTTGCGCTCAGGAGGAG.
In vitro suppression assays
Donor-derived CD4+CD25+ and CD4+CD25– cells from spleen and lymph nodes of recipient mice were MoFlo-sorted. Proliferation assays were set up in 96-well, round-bottom plates and contained, per well, 1 x 104 responder cells, 2 x 104 APC (mitomycin C-treated spleen cells from TCR-deficient BALB/c mice), and anti-CD3 Ab at a concentration of 0.5 µg/ml. Putative suppressor cells were cocultured at responder:suppressor ratios of 1:1, 1:0.3, and 1:0.1. Proliferation was determined by adding [3H]thymidine on the third day of culture and determining incorporation 6 h later.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We and others have observed that in conditions of homeostatic proliferation, CD25 expression is not stably maintained. Expanding CD4+CD25– cells generate a population of CD25+ cells, although expanding CD25+ cells partially lose CD25 expression (25, 26, 27, 28). To analyze the phenotypic and functional characteristics of the CD25+ cells derived from CD25– cells, we adoptively transferred purified CD25– T cells into host mice in which donor cells could undergo homeostatic expansion, such as RAG-1 knockout mice and T/B monoclonal mice. T/B monoclonal mice are DO11.10 TCR transgenic mice crossed with 17/9 Ig H and L chain knockin mice and RAG-1 knockout mice on the BALB/c genetic background. T/B monoclonal mice are devoid of Treg cells, and their peripheral T cells have a naive phenotype (24).
To investigate the relationship between homeostatic proliferation and peripheral conversion of CD25– T cells to CD25+, we purified CD4+CD25– cells from BALB/c mice (Fig. 1A), labeled them with CFSE, and transferred them to T/B monoclonal mice. Homeostatic proliferation of polyclonal CD4+ T cells in T/B monoclonal mice was demonstrated by CFSE dilution in the donor-derived population (gated as KJ1-26–CD4+ in Fig. 1B). Cells that became CD25+ were found in the population that underwent extensive proliferation (Fig. 1B). As in T cell-deficient hosts, cells that expanded in T/B monoclonal mice acquired a memory phenotype, expressing high levels of CD44 and low levels of CD45RB (Fig. 1C). In contrast, the endogenous OVA-specific KJ1-26+CD4+ cells maintained a naive phenotype (CD25–,CD44low,CD45RBhigh). Simultaneous transfer of purified CD4+CD25– BALB/c cells into T/B monoclonal mice and RAG1–/– mice demonstrated similar rates of conversion to CD25+ cells in both host strains (Fig. 1D).
|
|
1% of total donor-derived cells (2-fold increase from initial input), whereas Thy1.2+ donor-derived cells contained >7% CD25+ cells (49-fold increase from initial input; Fig. 2B). Thus, CD25+ cells derived from donor CD25– cells did not originate from preferential expansion of a few initial CD25+ cells. Instead, a fraction of CD25– cells converted to CD25+ cells in the periphery of recipient mice. FACS analysis of TCR V and V gene usage in peripherally converted CD25+ cells showed a broad diversity, similar to the freshly isolated CD4+ cells from BALB/c mice, arguing against the conversion-expansion of a few clones of CD25– donor cells (data not shown). CD4+CD25+ T cells derived from peripherally expanded CD25– cells are anergic and suppressive
We subsequently investigated whether the CD4+CD25+ cells arising from donor CD4+CD25– cells displayed phenotypic and functional properties ascribed to freshly isolated CD4+CD25+ Treg cells (9, 10, 11, 12, 13, 31, 32, 33, 34). Analysis of RNA expression by real-time quantitative PCR in purified donor-derived cells demonstrated high levels of Foxp3 in the donor-derived CD25+, but not in the donor-derived CD25– fraction (Fig. 3A). It is important to note that unlike other Treg markers, Foxp3 is not expressed by activated conventional mouse CD4+ cells (9, 10, 11). Flow cytometric analysis showed that donor-derived CD25+ cells, but not CD25– cells, expressed GITR, CD103, and CTLA-4 (Fig. 3B). Thus, phenotypically, CD4+CD25+ cells derived from homeostatic expansion of CD4+CD25– cells are very similar to freshly isolated CD4+CD25+ T cells.
|
Peripheral conversion of CD4+CD25– T cells to CD4+CD25+ T cells in wild-type newborn mice
As shown above, peripheral conversion of polyclonal CD4+CD25– to functional CD25+ Treg cells occurs efficiently in mice with no T cells (such as RAG-deficient mice) or mice harboring large numbers of monoclonal T cells (such as T/B monoclonal mice). We investigated whether peripheral generation of Treg cells from CD25– T cells could take place in mice with normal immune systems.
To study the expansion and conversion of CD25– cells in wild-type mice, CD4+CD25– cells from BALB/c Thy1.1/1.2 mice were purified, labeled with CFSE (to follow cell division), and transferred into newborn and adult BALB/c Thy1.2 recipient mice. In neonatally injected mice, the donor CD25– population efficiently generated CD25+ cells within the proliferating (CFSElow) cells (Fig. 4A). Very low proliferation and conversion occurred in adult mice. Cells that converted to CD25+ in neonatally injected mice were found in the CD45RBlow fraction of donor-derived CD4+ cells, similarly to naturally occurring Treg cells (Fig. 4B). All CD45RBlow cells within the donor population had undergone three or more cell divisions at the time of analysis. Similarly to naturally occurring Treg cells, CD25+ T cells derived from CD25– T cells in normal newborn mice expressed high levels of Foxp3 and CTLA-4 (Fig. 4C). Thus, peripheral conversion of CD25– into CD25+ Treg cells occurs in wild-type mice in conditions of peripheral expansion, such as the neonatal period (35).
|
Peripheral CD4+CD25– T cells represent a heterogeneous population containing naive and memory cells. Among other markers, this heterogeneity can be visualized by the differential expression of CD45RB. In clean animal facilities, a large fraction of CD4+CD25– T cells are naive T cells that express high levels of CD45RB (CD45RBhigh), and the remaining CD4+CD25– peripheral cells express intermediate or low levels of CD45RB (CD45RBlow). Peripheral CD4+CD25+ cells are CD45RBlow (12, 25). We sought to determine whether the CD45RBhigh and CD45RBlow fractions of CD4+CD25– cells had a different capacity to convert to CD25+ Treg cells during homeostatic expansion. CD4+CD25–CD45RBhigh and CD45RBlow cells from spleen and lymph nodes of BALB/c mice were purified by cell sorting and transferred into T/B monoclonal mice. Although a comparable fraction of CD45RBhigh- and RBlow-derived CD4+ T cells expressed CD25 on day 6 after transfer, only CD25+ cells derived from CD25–CD45RBlow T cells had a phenotype similar to that of wild-type Treg cells, such as higher CD25 and lower CD4 expression (Fig. 5A). However, 21 days after transfer, CD25+ cells derived from CD25–RBhigh or RBlow cells had similar FACS profiles (Fig. 5A). Similarly, CD4+CD25+ T cells derived from donor CD25–CD45RBhigh cells took a longer time to reach comparable expression levels of Treg genes, Foxp3 and CTLA-4, than the cells derived from the CD25–CD45RBlow donor population (Fig. 5B). Similar results were obtained when CD4+CD25–CD45RBhigh and CD45RBlow BALB/c cells were transferred into RAG1–/– recipients (data not shown). We concluded that both CD45RBhigh and CD45RBlow fractions of CD25– cells are able to generate peripheral CD25+ cells with phenotype of Treg cells, but the CD45RBlow fraction is (at least kinetically) more efficient.
CD25 expression in peripheral lymphoid organs is regulated by IL-2-producing effector-type T cells
It has been reported that upon transfer of CD25+ T cells into alymphoid recipients, the expression of CD25 is lost in a large part of the population unless CD4+CD25–CD45RBhigh T cells are cotransferred (25). We observed similar down-regulation of CD25 expression when CD25+ cells were transferred into T/B monoclonal mice. Given the fact that the T/B monoclonal mice contain a large number of CD4+CD25–CD45RBhigh T cells and virtually no CD4+CD25+ T cells, our finding was unexpected. The difference between the experiments was that the CD4+CD25–CD45RBhigh cells in the T/B monoclonal mice were OVA-specific resting cells, whereas polyclonal T cells injected into alymphoid mice were undergoing homeostatic proliferation. Peripheral expansion of the polyclonal T cells would lead to, among other things, IL-2 production. To test whether IL-2 production by CD25– T cells was necessary for the maintenance of CD25 expression byCD4+CD25+ cells, we cotransferred a polyclonal population of CD25– T cells from IL-2–/– BALB/c Thy1.2 mice with purified IL-2+ CD4+CD25+ T cells from BALB/c Thy1.1 mice into T/B monoclonal mice. Although cotransfer of polyclonal CD25– IL-2+ T cells allowed the maintenance of CD25 expression on 80% of CD25+ cells, IL-2–/– T cells were unable to affect the frequency of CD25+ T cells among Thy1.1 cells (Fig. 6A). FACS analysis of the Thy1.1 donor population in spleens of recipient mice revealed that the cotransfer of CD25– IL-2+ cells helped sustain Thy1.1 donor cells expressing high levels of CD25 and CTLA-4 (Fig. 6B). We conclude that polyclonal CD25– cells help to maintain peripheral Treg cells through IL-2 production.
|
|
The suppressor function of CD25+ cells is regulated by IL-2-producing effector-type T cells
Having described the properties of CD4+CD25+ T cells that derive from CD4+CD25– T cells upon homeostatic proliferation, we determined the properties of CD4+CD25– T cells that originate upon transfer of CD4+CD25+ T cells. Specifically, we studied whether CD25– cells derived from donor CD25+ cells that expanded in T/B monoclonal mice maintained the regulatory activity of their CD25+ predecessors. In addition, we determined whether immunization of the recipient T/B monoclonal mice with OVA-HA affected the suppressor activity of donor CD25+ cells. To address these issues we purified splenic CD4+CD25+ cells from BALB/c mice and transferred them into T/B monoclonal recipient mice. Half the recipient mice were immunized twice with OVA-HA (indicated I in Fig. 8), whereas the other half was not immunized (indicated NI in Fig. 8). Three days after the second immunization, donor-derived CD4+CD25– and CD4+CD25+ cells were isolated from the recipient mice and tested in vitro for the expression of Treg-associated genes, as well as for in vitro suppressor activity. Both donor-derived CD25+ and CD25– cells expressed CTLA-4, CD103, and GITR, but expression levels were higher in the CD25+ population (Fig. 8A). The donor-derived CD25+ and CD25– populations were tested in vitro for their ability to respond to anti-CD3 stimulation and to suppress the proliferation of freshly isolated CD25– cells (from DO11.10 RAG–/– mice). Donor-derived CD25+ cells from immunized mice were as anergic and suppressive as freshly isolated BALB/c CD25+ cells (Fig. 8B). Donor-derived CD25+ cells from nonimmunized mice showed somewhat lower suppressor activity than donor-derived CD25+ cells from immunized mice, but remained completely unresponsive to stimulation. The CD25– cells derived from CD25+ cells displayed even lower suppressor activity, but remained largely unresponsive to stimulation. Thus, down-regulation of CD25 expression in adoptively transferred CD25+ cells is associated with a reduction of regulatory activity. Immunization of the recipient mice maintains the suppressor activity of the donor-derived CD25+ population.
|
IL-2–/– mice develop lymphoproliferative diseases caused by defective Treg development and/or function. We showed previously that Treg cells do not need to produce IL-2, although their function is highly dependent on IL-2 signaling through CD25 expression. Moreover, the fact that splenic CD4+ T cells from IL-2–/– mice displayed normal regulatory activity when transferred to IL-2-sufficient mice indicated that IL-2 was not necessary for the development of Treg cells in the thymus (26).
To investigate the IL-2 dependence of CD4+CD25+ T cells, we isolated CD25+ and CD25– from the thymus of IL-2–/– and IL-2+ littermates. The proportion of CD4+CD8–CD25+ was only partially reduced in the thymus of IL-2–/– mice and was greatly diminished in the spleen (Fig. 9A), in agreement with published results (37, 38). Importantly, quantitative RNA expression analysis of purified populations of CD25+ cells from thymus or spleen of young IL-2–/– mice demonstrated high levels of expression of Foxp3, albeit somewhat lower than those in the IL-2+ littermates (Fig. 9B). These results indicate that the thymic generation of a Foxp3+CD4+CD25+ population is only marginally impaired in IL-2–/– mice, supporting our assertion that IL-2 is not required for the thymic development of Treg, but is crucial at later stages. Moreover, our results show that the induction of Foxp3 expression is independent of IL-2 signaling.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A number of recent studies reported the peripheral induction of Treg cells using a variety of protocols (3, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51). Some of these induced Treg cells are alloantigen-specific or foreign Ag-specific. The degree of phenotypic and functional resemblance between the induced regulatory cells and naturally occurring CD4+CD25+ Treg cells was investigated to different degrees in the different studies. Some of the protocols led to Treg cells that displayed phenotypes different from naturally occurring CD4+CD25+ Treg cells (42, 52, 53), whereas other protocols led to cells indistinguishable from naturally occurring Treg cells (49). The CD4+CD25+ Treg cells generated through homeostatic proliferation of CD4+CD25– T cells also behaved like naturally occurring Treg cells in all parameters that we studied.
The CD25+ T cell-spiking experiments (Fig. 2B) demonstrated that Treg cells generated through homeostatic proliferation do not represent the expansion of pre-existing CD4+CD25+ cells. On the basis that <1% of sorted human CD25+ cells remained alive by day 10 after activation, Walker et al. (40) concluded that the CD25–-derived CD25+ cells they obtained in vitro are not the product of the expansion of pre-existing CD25+ cells. In some cases, CD25–cell-derived CD25+ Treg cells were obtained from TCR-transgenic SCID or RAG–/– mice (41, 49, 54). Because these mice contain virtually no CD25+ T cells before Treg induction, outgrowth of pre-existing CD25+ cells is highly unlikely. Similarly, Ab depletion of CD25+ cells was used to show that Treg cells were derived from CD25– cells (43, 47, 48). In these three manuscripts it was shown or mentioned that few CD25+ cells were left behind after depletion, making it unlikely that contaminant CD25+ cells would play a role, although this possibility was not formally excluded.
CD4+CD25+Foxp3+ Treg cells could be derived from CD25– T cells in vitro by TCR stimulation in the presence of TGF- (39, 47). Interestingly, the treatment that induced the conversion of CD25– cells to CD25+ Treg cells did not trigger expansion of pre-existing CD4+CD25+ cells (39). Thus, in this case the CD25+ Treg cells also do not appear to be the product of outgrowth of pre-existing CD25+ cells. In contrast, Horwitz et al. (55) reported that TGF- induction of human CD4+CD25+ T cells derived in vitro from naive CD45RA+RO– T cells was markedly decreased if a pre-existing population (1% of naive CD4+ T cells) expressing CD25 was depleted. A subsequent study by the same group concluded that the residual CD25+ T cells greatly increase the number of CD25– T cells that become CD25+ (44). Using a TGF--inducible system, Peng et al. (46) showed that TGF- promotes expansion of the CD4+CD25+Foxp3+ Treg pool, although conversion of CD25– cells was not studied in this system.
Our results have several implications. First, homeostatic proliferation of lymphocytes is believed to play an important role in the immune systems of young (newborn) and aging normal individuals. In addition, several cancer treatments cause partial lymphocyte ablations that trigger homeostatic proliferation, and chronic infections can alter thymic output and cause homeostatic proliferation. Low level homeostatic proliferation is likely to be continuously taking place. Thus, in vivo conversion of CD4+CD25– T cells into CD4+CD25+ Treg cells under homeostatic proliferation conditions could play an important balancing role in the immune system.
Although naive CD25– T cells can eventually give rise to CD25+ Treg via homeostatic proliferation (Fig. 5), the capacity of CD25– cells to generate CD25+ Treg cells is not limitless. Retransfer experiments in which CD25– T cells were injected, and the donor-derived CD25– cells were purified and reinjected into secondary recipients showed a 5-fold decrease in the fraction of secondary donor-derived CD25+ cells compared with the fraction of CD25+ cells that arises upon transfer of fresh CD25– T cells (data not shown). Although fewer CD25+ cells were generated upon these retransfers, the CD25+ cells displayed normal Treg properties, such as elevated expression of Foxp3 (data not shown). Therefore, it appears that the generation of CD25+ cells is not a stochastic event by which any CD25– T cell has a given probability of becoming CD25+. Rather, many CD25– cells are, seemingly, not able to generate CD25+ cells in these experimental conditions. These data are consistent with a crucial role of TCR specificity in the generation of Treg cells, whereby only a fraction of CD25– T cells would express TCR chains that are compatible with Treg generation under particular stimuli (19, 56).
Another implication of the in vivo generation of CD4+CD25+ Treg cells from CD4+CD25– cells is that, considered together with the inability of genetically deficient CD25–/– T cells to exert suppression (26), it provides a model to explain the protective activity of CD4+CD25– T cells in models of autoimmunity and allergy; the ability of CD4+CD25– cells to protect in these disease models would depend on the generation of CD25+ Treg cells in the periphery.
In this manuscript we also determined that acquisition/loss of CD25 expression correlated with the acquisition/loss of suppressor phenotype, and found that IL-2, produced by cells other than Treg, is one of the key factors in determining the maintenance of CD25 expression. Cells that do not produce IL-2, such as nonexpanding CD25– T cells or IL-2–/– T cells, do not support CD25 expression.
In vitro, CD4+CD25+ Treg cells exert their suppressive activity by preventing IL-2 production by effector cells (57, 58); however, the situation in vivo is quite different. Indeed, the early burst of IL-2 production by OVA-specific T cells upon immunization of T/B monoclonal mice is unaffected by the presence of Treg cells (Fig. 7A) despite the striking suppressive effect of Treg cells on IL-4 production and IgE switching (Fig. 7A) (24). Thus, as proposed by Furtado et al. (26), IL-2 produced by activated effector T cells fuels the peripheral conversion of CD25– to CD25+ cells and sustains CD25 expression, thus establishing an autoregulatory loop during immune responses.
Our observations emphasize the interdependence of Treg and conventional T cells to maintain a peripheral balanced immune system. Although CD25+ cells down-regulate immune responses, self or Ag-specific conventional T cells help maintain a functional Treg compartment.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work was supported by the National Institute of Allergy and Infectious Disease, National Institutes of Health, the National Multiple Sclerosis Society, and the Dana-Goldsmith Foundation (all to J.J.L.). A.C.L. is a recipient of Predoctoral Fellowship SFRH/BD/13129/2003 from Fundacao para a Ciencia e a Tecnologia, Portugal. 
2 Address correspondence and reprint requests to Dr. Maria A. Curotto de Lafaille or Dr. Juan J. Lafaille, Molecular Pathogenesis Program, Skirball Institute, and Department of Pathology, New York University School of Medicine, New York, NY 10016. E-mail address: curotto{at}saturn.med.nyu.edu or lafaille{at}saturn.med.nyu.edu
3 Abbreviations used in this paper: Treg, regulatory T cell; HA, hemagglutinin from influenza virus; MFI, mean fluorescence intensity; GITR, glucocorticoid-induced TNFR.
Received for publication July 16, 2004. Accepted for publication September 24, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155:1151.[Abstract]
and IL-2 shape a population of regulatory cells that controls CD4+ T cell numbers. J. Immunol. 169:4850.E7 identifies unique subsets of CD25+ as well as CD25– regulatory T cells. Proc. Natl. Acad. Sci. USA 99:13031. chain, resistance to clonal deletion and IL-2 dependency. Int. Immunol. 10:371. induction of transcription factor Foxp3. J. Exp. Med. 198:1875., and IL-10. J. Immunol. 172:5213. induces a regulatory phenotype in CD4+CD25– T cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172:5149. regulates in vivo expansion of Foxp3-expressing CD4+CD25+ regulatory T cells responsible for protection against diabetes. Proc. Natl. Acad. Sci. USA 101:4572.-costimulated CD4+CD25– T cells. Int. Immunol. 16:1203. in the generation and expansion of CD4+CD25+ regulatory T cells from human peripheral blood. J. Immunol. 166:7282.This article has been cited by other articles:
|
|
 |
|
  J. Nolting, C. Daniel, S. Reuter, C. Stuelten, P. Li, H. Sucov, B.-G. Kim, J. J. Letterio, K. Kretschmer, H.-J. Kim, et al. Retinoic acid can enhance conversion of naive into regulatory T cells independently of secreted cytokines J. Exp. Med., September 28, 2009; 206(10): 2131 - 2139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Gregerson, N. D. Heuss, U. Lehmann, and S. W. McPherson Peripheral Induction of Tolerance by Retinal Antigen Expression J. Immunol., July 15, 2009; 183(2): 814 - 822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Horkheimer, M. Quigley, J. Zhu, X. Huang, N. J. Chao, and Y. Yang Induction of type I IFN is required for overcoming tumor-specific T-cell tolerance after stem cell transplantation Blood, May 21, 2009; 113(21): 5330 - 5339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Wang, G.-H. Chen, Y. Fan, M. Van Antwerp, and J. R. Baker Jr. Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Inhibits Experimental Autoimmune Thyroiditis by the Expansion of CD4+CD25+ Regulatory T Cells Endocrinology, April 1, 2009; 150(4): 2000 - 2007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Haribhai, W. Lin, B. Edwards, J. Ziegelbauer, N. H. Salzman, M. R. Carlson, S.-H. Li, P. M. Simpson, T. A. Chatila, and C. B. Williams A Central Role for Induced Regulatory T Cells in Tolerance Induction in Experimental Colitis J. Immunol., March 15, 2009; 182(6): 3461 - 3468. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Lathrop, N. A. Santacruz, D. Pham, J. Luo, and C.-S. Hsieh Antigen-specific peripheral shaping of the natural regulatory T cell population J. Exp. Med., December 22, 2008; 205(13): 3105 - 3117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. H. E. Mabarrack, N. L. Turner, and G. Mayrhofer Recent thymic origin, differentiation, and turnover of regulatory T cells J. Leukoc. Biol., November 1, 2008; 84(5): 1287 - 1297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A La Cava T-regulatory cells in systemic lupus erythematosus Lupus, May 1, 2008; 17(5): 421 - 425. [Abstract] [PDF]
|
|
|
|
|
|
M.-E. Blais, S. Brochu, M. Giroux, M.-P. Belanger, G. Dulude, R.-P. Sekaly, and C. Perreault Why T Cells of Thymic Versus Extrathymic Origin Are Functionally Different J. Immunol., February 15, 2008; 180(4): 2299 - 2312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-F. Lu, M. A. Gavin, J. P. Rasmussen, and A. Y. Rudensky G Protein-Coupled Receptor 83 Is Dispensable for the Development and Function of Regulatory T Cells Mol. Cell. Biol., December 1, 2007; 27(23): 8065 - 8072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Noguchi, D. Wakita, M. Tajima, S. Ashino, Y. Iwakura, Y. Zhang, K. Chamoto, H. Kitamura, and T. Nishimura Blocking of IL-6 signaling pathway prevents CD4+ T cell-mediated colitis in a Th17-independent manner Int. Immunol., December 1, 2007; 19(12): 1431 - 1440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Vu, X. Xiao, W. Gao, N. Degauque, M. Chen, A. Kroemer, N. Killeen, N. Ishii, and X. Chang Li OX40 costimulation turns off Foxp3+ Tregs Blood, October 1, 2007; 110(7): 2501 - 2510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Kang, H. W. Lim, O. M. Andrisani, H. E. Broxmeyer, and C. H. Kim Vitamin A Metabolites Induce Gut-Homing FoxP3+ Regulatory T Cells J. Immunol., September 15, 2007; 179(6): 3724 - 3733. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wong, D. Mathis, and C. Benoist TCR-based lineage tracing: no evidence for conversion of conventional into regulatory T cells in response to a natural self-antigen in pancreatic islets J. Exp. Med., September 3, 2007; 204(9): 2039 - 2045. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Nesburn, I. Bettahi, G. Dasgupta, A. A. Chentoufi, X. Zhang, S. You, N. Morishige, A. J. Wahlert, D. J. Brown, J. V. Jester, et al. Functional Foxp3+ CD4+ CD25(Bright+) "Natural" Regulatory T Cells Are Abundant in Rabbit Conjunctiva and Suppress Virus-Specific CD4+ and CD8+ Effector T Cells during Ocular Herpes Infection J. Virol., July 15, 2007; 81(14): 7647 - 7661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-K. Kang, M. Liu, and S. K. Datta Low-Dose Peptide Tolerance Therapy of Lupus Generates Plasmacytoid Dendritic Cells That Cause Expansion of Autoantigen-Specific Regulatory T Cells and Contraction of Inflammatory Th17 Cells J. Immunol., June 15, 2007; 178(12): 7849 - 7858. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yates, F. Rovis, P. Mitchell, B. Afzali, J.-S Tsang, M. Garin, R. Lechler, G. Lombardi, and O. Garden The maintenance of human CD4+CD25+ regulatory T cell function: IL-2, IL-4, IL-7 and IL-15 preserve optimal suppressive potency in vitro Int. Immunol., June 1, 2007; 19(6): 785 - 799. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Komatsu and S. Hori Full restoration of peripheral Foxp3+ regulatory T cell pool by radioresistant host cells in scurfy bone marrow chimeras PNAS, May 22, 2007; 104(21): 8959 - 8964. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Luhn, C. P. Simmons, E. Moran, N. T. P. Dung, T. N. B. Chau, N. T. H. Quyen, L. T. T. Thao, T. Van Ngoc, N. M. Dung, B. Wills, et al. Increased frequencies of CD4+CD25high regulatory T cells in acute dengue infection J. Exp. Med., May 14, 2007; 204(5): 979 - 985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. You, B. Leforban, C. Garcia, J.-F. Bach, J. A. Bluestone, and L. Chatenoud Adaptive TGF-beta-dependent regulatory T cells control autoimmune diabetes and are a privileged target of anti-CD3 antibody treatment PNAS, April 10, 2007; 104(15): 6335 - 6340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. N. Couper, D. G. Blount, J. B. de Souza, I. Suffia, Y. Belkaid, and E. M. Riley Incomplete Depletion and Rapid Regeneration of Foxp3+ Regulatory T Cells Following Anti-CD25 Treatment in Malaria-Infected Mice J. Immunol., April 1, 2007; 178(7): 4136 - 4146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Noris, F. Casiraghi, M. Todeschini, P. Cravedi, D. Cugini, G. Monteferrante, S. Aiello, L. Cassis, E. Gotti, F. Gaspari, et al. Regulatory T Cells and T Cell Depletion: Role of Immunosuppressive Drugs J. Am. Soc. Nephrol., March 1, 2007; 18(3): 1007 - 1018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Zheng, J. Wang, P. Wang, J. D. Gray, and D. A. Horwitz IL-2 Is Essential for TGF-beta to Convert Naive CD4+CD25- Cells to CD25+Foxp3+ Regulatory T Cells and for Expansion of These Cells J. Immunol., February 15, 2007; 178(4): 2018 - 2027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Cabbage, E. S. Huseby, B. D. Sather, T. Brabb, D. Liggitt, and J. Goverman Regulatory T Cells Maintain Long-Term Tolerance to Myelin Basic Protein by Inducing a Novel, Dynamic State of T Cell Tolerance J. Immunol., January 15, 2007; 178(2): 887 - 896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Milner, J. M. Ward, A. Keane-Myers, and W. E. Paul Lymphopenic mice reconstituted with limited repertoire T cells develop severe, multiorgan, Th2-associated inflammatory disease PNAS, January 9, 2007; 104(2): 576 - 581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Carrier, J. Yuan, V. K. Kuchroo, and H. L. Weiner Th3 Cells in Peripheral Tolerance. I. Induction of Foxp3-Positive Regulatory T Cells by Th3 Cells Derived from TGF-beta T Cell-Transgenic Mice J. Immunol., January 1, 2007; 178(1): 179 - 185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bochtler, C. Wahl, R. Schirmbeck, and J. Reimann Functional Adaptive CD4 Foxp3 T Cells Develop in MHC Class II-Deficient Mice J. Immunol., December 15, 2006; 177(12): 8307 - 8314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. M. Almeida, B. Zaragoza, and A. A. Freitas Competition controls the rate of transition between the peripheral pools of CD4+CD25- and CD4+CD25+ T cells Int. Immunol., November 1, 2006; 18(11): 1607 - 1613. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Bosco, F. Agenes, A. G. Rolink, and R. Ceredig Peripheral T Cell Lymphopenia and Concomitant Enrichment in Naturally Arising Regulatory T Cells: The Case of the Pre-T{alpha} Gene-Deleted Mouse J. Immunol., October 15, 2006; 177(8): 5014 - 5023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Yu and T. R. Malek Selective Availability of IL-2 Is a Major Determinant Controlling the Production of CD4+CD25+Foxp3+ T Regulatory Cells J. Immunol., October 15, 2006; 177(8): 5115 - 5121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Long and A. J. Adler Cutting Edge: Paracrine, but Not Autocrine, IL-2 Signaling Is Sustained during Early Antiviral CD4 T Cell Response J. Immunol., October 1, 2006; 177(7): 4257 - 4261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. de Latour, H. C. Dujardin, F. Mishellany, O. Burlen-Defranoux, J. Zuber, R. Marques, J. Di Santo, A. Cumano, P. Vieira, and A. Bandeira Ontogeny, function, and peripheral homeostasis of regulatory T cells in the absence of interleukin-7 Blood, October 1, 2006; 108(7): 2300 - 2306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Andaloussi and M. S. Lesniak An increase in CD4+CD25+FOXP3+ regulatory T cells in tumor-infiltrating lymphocytes of human glioblastoma multiforme Neuro-oncol, July 1, 2006; 8(3): 234 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. M. Almeida, B. Zaragoza, and A. A. Freitas Indexation as a Novel Mechanism of Lymphocyte Homeostasis: The Number of CD4+CD25+ Regulatory T Cells Is Indexed to the Number of IL-2-Producing Cells J. Immunol., July 1, 2006; 177(1): 192 - 200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Hansen, K. Loser, A. M. Westendorf, D. Bruder, S. Pfoertner, C. Siewert, J. Huehn, S. Beissert, and J. Buer G Protein-Coupled Receptor 83 Overexpression in Naive CD4+CD25- T Cells Leads to the Induction of Foxp3+ Regulatory T Cells In Vivo J. Immunol., July 1, 2006; 177(1): 209 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mahic, S. Yaqub, C. C. Johansson, K. Tasken, and E. M. Aandahl FOXP3+CD4+CD25+ Adaptive Regulatory T Cells Express Cyclooxygenase-2 and Suppress Effector T Cells by a Prostaglandin E2-Dependent Mechanism J. Immunol., July 1, 2006; 177(1): 246 - 254. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Leithauser, T. Meinhardt-Krajina, K. Fink, B. Wotschke, P. Moller, and J. Reimann Foxp3-Expressing CD103+ Regulatory T Cells Accumulate in Dendritic Cell Aggregates of the Colonic Mucosa in Murine Transfer Colitis Am. J. Pathol., June 1, 2006; 168(6): 1898 - 1909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shimoda, F. Mmanywa, S. K. Joshi, T. Li, K. Miyake, J. Pihkala, J. A. Abbas, and P. A. Koni Conditional Ablation of MHC-II Suggests an Indirect Role for MHC-II in Regulatory CD4 T Cell Maintenance. J. Immunol., June 1, 2006; 176(11): 6503 - 6511. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Vanasek, S. L. Nandiwada, M. K. Jenkins, and D. L. Mueller CD25+Foxp3+ Regulatory T Cells Facilitate CD4+ T Cell Clonal Anergy Induction during the Recovery from Lymphopenia J. Immunol., May 15, 2006; 176(10): 5880 - 5889. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M C Fantini, C Becker, I Tubbe, A Nikolaev, H A Lehr, P Galle, and M F Neurath Transforming growth factor {beta} induced FoxP3+ regulatory T cells suppress Th1 mediated experimental colitis Gut, May 1, 2006; 55(5): 671 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Antony, C. M. Paulos, M. Ahmadzadeh, A. Akpinarli, D. C. Palmer, N. Sato, A. Kaiser, C. Heinrichs, C. A. Klebanoff, Y. Tagaya, et al. Interleukin-2-Dependent Mechanisms of Tolerance and Immunity In Vivo J. Immunol., May 1, 2006; 176(9): 5255 - 5266. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Valzasina, S. Piconese, C. Guiducci, and M. P. Colombo Tumor-Induced Expansion of Regulatory T Cells by Conversion of CD4+CD25- Lymphocytes Is Thymus and Proliferation Independent. Cancer Res., April 15, 2006; 66(8): 4488 - 4495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Neujahr, C. Chen, X. Huang, J. F. Markmann, S. Cobbold, H. Waldmann, M. H. Sayegh, W. W. Hancock, and L. A. Turka Accelerated Memory Cell Homeostasis during T Cell Depletion and Approaches to Overcome It. J. Immunol., April 15, 2006; 176(8): 4632 - 4639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ono, J. Shimizu, Y. Miyachi, and S. Sakaguchi Control of Autoimmune Myocarditis and Multiorgan Inflammation by Glucocorticoid-Induced TNF Receptor Family-Related Proteinhigh, Foxp3-Expressing CD25+ and CD25- Regulatory T Cells. J. Immunol., April 15, 2006; 176(8): 4748 - 4756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Minamimura, W. Gao, and T. Maki CD4+ Regulatory T Cells Are Spared from Deletion by Antilymphocyte Serum, a Polyclonal Anti-T Cell Antibody J. Immunol., April 1, 2006; 176(7): 4125 - 4132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Tadokoro, G. Shakhar, S. Shen, Y. Ding, A. C. Lino, A. Maraver, J. J. Lafaille, and M. L. Dustin Regulatory T cells inhibit stable contacts between CD4+ T cells and dendritic cells in vivo J. Exp. Med., March 20, 2006; 203(3): 505 - 511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lundholm, V. Motta, A. Lofgren-Burstrom, N. Duarte, M.-L. Bergman, S. Mayans, and D. Holmberg Defective Induction of CTLA-4 in the NOD Mouse Is Controlled by the NOD Allele of Idd3/IL-2 and a Novel Locus (Ctex) Telomeric on Chromosome 1 Diabetes, February 1, 2006; 55(2): 538 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. P. Pavlick, D. V. Ostanin, K. L. Furr, F. S. Laroux, C. M. Brown, L. Gray, C. G. Kevil, and M. B. Grisham Role of T-cell-associated lymphocyte function-associated antigen-1 in the pathogenesis of experimental colitis Int. Immunol., February 1, 2006; 18(2): 389 - 398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Marski, S. Kandula, J. R. Turner, and C. Abraham CD18 Is Required for Optimal Development and Function of CD4+CD25+ T Regulatory Cells J. Immunol., December 15, 2005; 175(12): 7889 - 7897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Knoechel, J. Lohr, E. Kahn, J. A. Bluestone, and A. K. Abbas Sequential development of interleukin 2-dependent effector and regulatory T cells in response to endogenous systemic antigen J. Exp. Med., November 21, 2005; 202(10): 1375 - 1386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Chen, A. E. Herman, M. Matos, D. Mathis, and C. Benoist Where CD4+CD25+ T reg cells impinge on autoimmune diabetes J. Exp. Med., November 21, 2005; 202(10): 1387 - 1397. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Krupnick, A. E. Gelman, W. Barchet, S. Richardson, F. H. Kreisel, L. A. Turka, M. Colonna, G. A. Patterson, and D. Kreisel Cutting Edge: Murine Vascular Endothelium Activates and Induces the Generation of Allogeneic CD4+25+Foxp3+ Regulatory T Cells J. Immunol., November 15, 2005; 175(10): 6265 - 6270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Romagnoli, D. Hudrisier, and J. P. M. van Meerwijk Molecular Signature of Recent Thymic Selection Events on Effector and Regulatory CD4+ T Lymphocytes J. Immunol., November 1, 2005; 175(9): 5751 - 5758. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Skapenko, J. R. Kalden, P. E. Lipsky, and H. Schulze-Koops The IL-4 Receptor {alpha}-Chain-Binding Cytokines, IL-4 and IL-13, Induce Forkhead Box P3-Expressing CD25+CD4+ Regulatory T Cells from CD25-CD4+ Precursors J. Immunol., November 1, 2005; 175(9): 6107 - 6116. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ghiringhelli, P. E. Puig, S. Roux, A. Parcellier, E. Schmitt, E. Solary, G. Kroemer, F. Martin, B. Chauffert, and L. Zitvogel Tumor cells convert immature myeloid dendritic cells into TGF-{beta}-secreting cells inducing CD4+CD25+ regulatory T cell proliferation J. Exp. Med., October 3, 2005; 202(7): 919 - 929. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Huang, J. Zhu, and Y. Yang Protection against Autoimmunity in Nonlymphopenic Hosts by CD4+CD25+ Regulatory T Cells Is Antigen-Specific and Requires IL-10 and TGF-{beta} J. Immunol., October 1, 2005; 175(7): 4283 - 4291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Denning, G. Kim, and M. Kronenberg Cutting Edge: CD4+CD25+ Regulatory T Cells Impaired for Intestinal Homing Can Prevent Colitis J. Immunol., June 15, 2005; 174(12): 7487 - 7491. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. G. Marcondes, G. C. Furtado, A. Wensky, M. A. Curotto de Lafaille, H. S. Fox, and J. J. Lafaille Immune Regulatory Mechanisms Influence Early Pathology in Spinal Cord Injury and in Spontaneous Autoimmune Encephalomyelitis Am. J. Pathol., June 1, 2005; 166(6): 1749 - 1760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Min, H. Yamane, J. Hu-Li, and W. E. Paul Spontaneous and Homeostatic Proliferation of CD4 T Cells Are Regulated by Different Mechanisms J. Immunol., May 15, 2005; 174(10): 6039 - 6044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Y. Wan and R. A. Flavell Identifying Foxp3-expressing suppressor T cells with a bicistronic reporter PNAS, April 5, 2005; 102(14): 5126 - 5131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zelenay, T. Lopes-Carvalho, I. Caramalho, M. F. Moraes-Fontes, M. Rebelo, and J. Demengeot Foxp3+ CD25- CD4 T cells constitute a reservoir of committed regulatory cells that regain CD25 expression upon homeostatic expansion PNAS, March 15, 2005; 102(11): 4091 - 4096. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Walker, B. D. Carson, G. T. Nepom, S. F. Ziegler, and J. H. Buckner De novo generation of antigen-specific CD4+CD25+ regulatory T cells from human CD4+CD25- cells PNAS, March 15, 2005; 102(11): 4103 - 4108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Antony, C. A. Piccirillo, A. Akpinarli, S. E. Finkelstein, P. J. Speiss, D. R. Surman, D. C. Palmer, C.-C. Chan, C. A. Klebanoff, W. W. Overwijk, et al. CD8+ T Cell Immunity Against a Tumor/Self-Antigen Is Augmented by CD4+ T Helper Cells and Hindered by Naturally Occurring T Regulatory Cells J. Immunol., March 1, 2005; 174(5): 2591 - 2601. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
0.1% contamination by CD25+ cells. The cells were labeled with CFSE and transferred to T/B monoclonal mice (5 x 106 cells/mouse; n = 3). One month later, recipient mice were killed, and spleen and lymph node cells were analyzed by flow cytometry. Representative analyses are shown in B and C. B, Cells were stained with anti-CD4, anti-CD25, and KJ1-26 Abs. The left plot shows the gates used for the analysis of endogenous cells (CD4+KJ1-26+) and the donor-derived cells (CD4+KJ1-26–). The lower right plot shows CFSE dilution and CD25 expression in the donor-derived population. The upper right plot shows endogenous cells (CFSE-negative and naive). C, Cells were stained with anti-CD4, anti-CD45RB, anti-CD44, and KJ1-26 Abs. Donor and endogenous populations were gated as described in B. The figure shows overlapping histograms of CD44 (left) and CD45RB (right) expression in donor cells (CD4+KJ1-26–; line) and endogenous cells (CD4+KJ1-26+; solid gray). D, CD4+CD25– cells were purified from spleen and lymph nodes of BALB/c (Thy 1.1/1.2) mice and transferred to T/B monoclonal mice (T/B mc; Thy 1.2) and RAG-1–/– mice (2 x 106 cells/mouse; n = 3). Two weeks after immunization, the expression of CD25 in donor-derived CD4+ cells (Thy1.1+) was analyzed in peripheral blood samples stained with Abs to Thy1.1, CD4, and CD25. The plots show CD25 expression in donor-derived cells gated as CD4+Thy1.1+. Homeostatic proliferation of polyclonal CD4+ T cells in T/B monoclonal mice, and conversion of CD25– into CD25+ cells in T/B monoclonal and RAG-1–/– mice has been extensively confirmed in numerous experiments using both MACS- or MoFlo-sorted donor cells obtained from peripheral lymphoid organs or thymus.
) donor-derived cells. C, CD25+ cells derived from CD25– cells are anergic and suppressive. Donor-derived CD4+CD25+ and CD4+CD25– cells were isolated from T/B monoclonal mice that had been transferred with CD4+CD25– cells from BALB/c mice as in A. Donor-derived CD4+CD25+ and CD4+CD25– cells as well as freshly isolated CD4+CD25+ BALB/c cells were cultured alone or were cocultured with 1 x 104 freshly isolated CD4+CD25– BALB/c cells (responder cells) in wells containing anti-CD3 Abs and APC. Ratios of responder to suppressor cells were 1:1, 1:0.3, and 1:0.1. On the third day of culture, proliferation was measured by [3H]thymidine incorporation. Results are the average and SD of triplicate wells. DD, donor-derived.
