|
|
||||||||





* Pediatric Oncology Branch, National Cancer Institute-Center for Cancer Research, Frederick, MD 21702;
Intramural Research Support Program and
Laboratory of Cell Mediated Immunity, SAIC-Frederick, Frederick, MD 21702; and
Department of Discovery Biology, DNAX Research Institute, Palo Alto, CA
| Abstract |
|---|
|
|
|---|
-inducing cytokines such as IL-12 can mediate potent antitumor effects against murine solid tumors. IL-27 is a newly described IL-12-related cytokine that potentiates various aspects of T and/or NK cell function. We hypothesized that IL-27 might also mediate potent antitumor activity in vivo. TBJ neuroblastoma cells engineered to overexpress IL-27 demonstrated markedly delayed growth compared with control mice, and complete durable tumor regression was observed in >90% of mice bearing either s.c. or orthotopic intra-adrenal tumors, and 40% of mice bearing induced metastatic disease. The majority of mice cured of their original TBJ-IL-27 tumors were resistant to tumor rechallenge. Furthermore, TBJ-IL-27 tumors were heavily infiltrated by CD8+ T cells, and draining lymph node-derived lymphocytes from mice bearing s.c. TBJ-IL-27 tumors are primed to proliferate more readily when cultured ex vivo with anti-CD3/anti-CD28 compared with lymphocytes from mice bearing control tumors, and to secrete higher levels of IFN-
. In addition, marked enhancement of local IFN-
gene expression and potent up-regulation of cell surface MHC class I expression are noted within TBJ-IL-27 tumors compared with control tumors. Functionally, these alterations occur in conjunction with the generation of tumor-specific CTL reactivity in mice bearing TBJ-IL-27 tumors, and the induction of tumor regression via mechanisms that are critically dependent on CD8+, but not CD4+ T cells or NK cells. Collectively, these studies suggest that IL-27 could be used therapeutically to potentiate the host antitumor immune response in patients with malignancy. | Introduction |
|---|
|
|
|---|
. Notably, both IL-12 and IL-18 induce the production of IFN-
by T and/or NK cell populations (1, 2, 3, 4), and have demonstrated potent IFN-
-dependent antitumor activity in preclinical tumor models when administered alone (5, 6, 7), or in combination with other cytokines such as IL-2 (8, 9, 10). Furthermore, both IL-12 (8, 11, 12) and IL-18 are currently under investigation in the clinical setting in patients with various solid tumors. More recent studies have now described two novel heterodimeric cytokines (IL-23 and IL-27) that are structurally related to IL-12 (13, 14), and functionally complement IL-12 and IL-18 to coordinately regulate the initiation, expansion, and maintenance of a productive T cell-mediated adaptive immune response (15, 16, 17). Furthermore, the functional characteristics of IL-23 and IL-27 suggest that they could be useful components of cytokine-based approaches for the treatment of solid tumors.
IL-23 is a heterodimeric cytokine that is mainly produced by monocyte/macrophage and dendritic cell populations (13). It consists of a p40 subunit that is also a component of IL-12, and a novel 19-kDa subunit (p19) that is unique to IL-23 (13). IL-23 binds to target cells via a heterodimeric receptor consisting of a
1 subunit that is also a component of the IL-12R, and a unique IL-23R chain that contains a cytoplasmic STAT4 binding domain (18, 19). IL-23 induces the proliferation of both naive and memory T cells in humans, although in mice, the biologic effects of IL-23 appear to be restricted primarily to memory T cell populations (13). IL-23 also stimulates IFN-
production by human T cells, although at lower levels than is elicited by related cytokines such as IL-12. In contrast, murine IL-23 does not induce the production of IFN-
by murine splenocytes (13). More recent studies now have implicated IL-23 as a critical mediator of disease pathogenesis in preclinical models of autoimmune disease such as experimental autoimmune encephalomyelitis (20). Furthermore, two recent reports have demonstrated that IL-23 may possess antitumor activity as well (21, 22). In these studies, overexpression of IL-23 in CT26 colon adenocarcinoma and B16F1 melanoma cells delays tumor growth and leads to complete tumor regression in >70% of mice (21, 22). Mice that reject IL-23-transduced tumors develop specific immunologic memory and reject subsequent wild-type tumor challenge, and CD8+ T cells appear to mediate the antitumor activity of IL-23 in these preclinical models.
IL-27, the most recently described heterodimeric IL-12-related cytokine, consists of EBV-induced gene 3 (EBI3)3 and p28 subunits that are structurally related to the p40 and p35 subunits of IL-12, respectively (14). Functional IL-27 heterodimer is produced by activated APCs including LPS-stimulated monocytes as well as CD40L or LPS + IFN-
-stimulated monocyte-derived dendritic cells (14). IL-27 acts on target cell populations via binding to a heterodimeric receptor that consists of WSX-1 (also known as T cell cytokine receptor) and gp130 subunits (23). WSX-1 expression has been demonstrated in tissues that include thymus, spleen, lymph nodes, and peripheral blood leukocytes (24). In leukocyte populations, WSX-1 expression is noted in both lymphocytes and monocytes, with the most intense expression found in NK cells and CD4+ T cells (24). Interaction of IL-27 with its receptor induces STAT-1 phosphorylation, activates the transcription factor T-bet, and up-regulates IL-12R
2 expression in naive CD4+ T cells (25). This suggests that IL-27/WSX-1 signaling may induce mechanisms that promote Th1 differentiation and ultimately sensitize effector cells to IL-12. Notably, IL-27 triggers clonal expansion of Ag-specific naive human and murine CD4+ T cells, promotes Th1 polarization, and synergizes with IL-12 ± IL-2 to potentiate IFN-
production by activated naive T and NK cell populations (14). Furthermore, WSX-1 knockout have markedly impaired early Th1 responses, suggesting that IL-27 may have a particularly important role in regulating the generation of a productive adaptive immune response (24, 26).
Based on these potent immunoregulatory effects in vitro, we hypothesized that IL-27 could promote a productive antitumor immune response in vivo as well. The present studies demonstrate that IL-27 mediates potent antitumor activity, including inhibition of tumor growth and the induction of complete regression of both primary and metastatic TBJ murine neuroblastoma tumors. The antitumor effects mediated by IL-27 in these models occur in conjunction with priming of T cells within tumor-draining lymph nodes to proliferate and produce IFN-
, as well as dramatic enhancement of local CD8+ T lymphocyte infiltration and potent induction of the expression of both IFN-
and tumor cell MHC class I molecules within the tumor microenvironment. Furthermore, IL-27-induced tumor regression occurs in conjunction with the induction of systemic tumor-specific CTL reactivity and the generation of immunologic memory, and is critically dependent on the action of CD8+ T cells. Collectively, these studies suggest that further evaluation of the preclinical antitumor activity of IL-27 is warranted, and that this cytokine could ultimately play an important role in efforts to use cytokines to therapeutically coordinate the generation, expansion, and maintenance of a productive T cell-mediated antitumor immune response in patients with malignancy.
| Materials and Methods |
|---|
|
|
|---|
Male A/J mice and BALB/c-SCID mice were obtained from the Animal Production Area (Charles River Laboratories, Frederick, MD). Mice were maintained in a dedicated pathogen-free environment and generally used between 8 and 10 wk of age. The TBJ neuroblastoma cell line syngeneic to A/J mice was used in all experiments, and was generously provided by M. Ziegler (Childrens Hospital, Boston, MA). TBJ tumor cells engineered to overexpress a single-chain fusion protein containing the p28 and EBI3 subunits of the IL-27 gene were established, as described below. Where indicated, TBJ neuroblastoma cells engineered to overexpress the red fluorescent protein (RFP) gene were used (for generation, see J. Stauffer and J. Wigginton, manuscript in preparation). The SA-1 murine sarcoma cell line (syngeneic to A/J mice) was generously provided by S. Ostrand-Rosenberg (University of Maryland, Baltimore, MD). Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication 86-23).
Reagents
Mouse anti-FLAG M2-coated plates (P-2983) and rabbit anti-FLAG Ab (F7425) purchased from Sigma-Aldrich (St. Louis, MO) were used as described below for the detection of IL-27 protein. Neutralizing mAbs including rat anti-mouse CD4+ (GK1.5) (27) and mouse anti-mouse CD8+ (Ly-2.2) (28), derived from hybridoma supernatants, were used for in vivo depletion of CD4+ and CD8+ T lymphocytes respectively, as we have previously described (10). NK cells were depleted in vivo with rabbit anti-mouse anti-asialo GM1 (Wako Pure Chemical, Osaka, Japan). Mouse anti-mouse tubulin mAb was purchased from Oncogene Research Products (San Diego, CA), and was used for Western blot detection of tubulin as described below. For in vitro proliferation experiments, optimally titered monoclonal mouse anti-mouse CD3 (clone 2C11) (29) derived from hybridoma supernatants and monoclonal hamster anti-mouse CD28 (BD Pharmingen, Palo Alto, CA) were used. For ELISPOT and flow cytometry analysis, rat anti-mouse IFN-
(clone R4-6A2) and biotinylated rat anti-mouse IFN-
Ab (clone XMG1.2) were used. To detect cell surface MHC class I Ag expression, FITC-conjugated mouse anti-mouse H-2Kk Ab (clone 36-7-5) and FITC-conjugated mouse anti-mouse H-2Dd Ab (clone 34-2-12S) were used (BD Pharmingen). Rat anti-neural cell adhesion molecule (N-CAM) Ab (BD Pharmingen) was used as a marker for cells of neural origin. Commercially available human rIL-2 (Chiron, Emeryville, CA) was used where indicated for ELISPOT and CTL assays.
Generation of TBJ-IL-27 and tumor cell lines
TBJ tumor cells were engineered to overexpress murine IL-27 using the p-FLAG-CMV-1 vector (Sigma-Aldrich) containing a fusion sequence encoding the mature coding sequences for murine EBI3, followed by the synthetic linker GSGSGGSGGSGSGKL and the mature coding sequence of mouse p28, as previously described (14). Briefly, TBJ neuroblastoma cells were stably transfected with either p-IL-27/FLAG-CMV-1 or the empty p-FLAG-CMV-1 vector alone using the calcium phosphate method, and cells were subsequently selected in G418 (800 µg/ml). Individual clones were isolated by limiting dilution cloning, and were screened subsequently for IL-27-FLAG or FLAG gene expression using RT-PCR. Total RNA was isolated from transfected IL-27-FLAG or FLAG clones using an RNeasy kit (Qiagen, Valencia, CA).
Reverse transcription and PCR were performed using a one-step RT-PCR kit, according to the manufacturer instructions (Qiagen). Amplification was performed in a thermocycler (Gene Amp PCR System 2400; PerkinElmer/Cetus, Foster City, CA), as follows: 50°C for 30 min, 95°C for 15 min (1 cycle), 94°C for 30 s, 59°C for 30 s, 72°C for 1 min (29 cycles), and 72°C for 10 min (1 cycle). PCR products were then separated by 1% agarose gel impregnated with ethidium bromide. The sequence of primer pairs for the respective genes evaluated in these studies and their predicted product sizes are as follows: IL-27/FLAG-CVM-1: sense GCCAAGTATTGCATCCAGGT, antisense GGACATAGCCCTGAACCTCA (product = 250 bp); FLAG-CMV-1: sense CACCAAAATCAACGGGACTT, antisense TGCAGCTCCAACAAGAGCTA (product = 171 bp); GAPDH: sense TGTTCCTACCCCCAATGTGT, antisense CCCTGTTGCTGTAGCCGTAT (product = 269 bp). The presence of the expected FLAG and IL-27-FLAG gene products was confirmed using p-IL-27/FLAG-CMV-1 or p-FLAG-CMV-1 vectors as controls.
The expression of IL-27 fusion protein was confirmed in tumor cell lysates by immunoprecipitation of the recombinant protein using anti-FLAG M2-coated plates. The immunoprecipitated proteins were then eluted from anti-FLAG-coated plates using Tris-glycine SDS sample buffer (Invitrogen Life Technologies, Carlsbad, CA), and were then separated by gel electrophoresis using 420% SDS-PAGE. Proteins were transferred to a polyvinylidene difluoride membrane, and were then screened via Western blot using a rabbit anti-FLAG Ab. Protein concentration was determined in the cell lysates by bicinchoninic acid method (Pierce, Rockford, IL), and was used to normalize gel loading. Determination of tubulin expression was used as a housekeeping gene to compare gel loading as well. In this assay, expression of the predicted 70-kDa IL-27-FLAG protein product was confirmed, and positive clones were subsequently screened for IL-27 secretion as well. Culture supernatants from clones engineered to overexpress IL-27 were subjected to anti-FLAG M2 immunoprecipitation. Proteins were then separated by SDS-PAGE, followed by Western blot, as above. Clones displaying intense secretion of IL-27-FLAG protein were selected for use in subsequent studies to investigate the antitumor activity of IL-27 in vivo.
In vivo tumor models and treatments
Where indicated, tumor cells including unmodified parental TBJ, or TBJ engineered to overexpress IL-27 (TBJ-IL-27) or empty vector alone (TBJ-FLAG) were implanted either s.c. or orthotopically in the adrenal gland. To induce hepatic metastases, the respective tumor cell lines were injected i.v. or intrasplenically, where indicated. In the s.c. model, mice were injected in the mid-flank with 1 x 106 tumor cells in 0.2 ml of HBSS. In the orthotopic model, tumor cells were implanted orthotopically in the adrenal gland, as described elsewhere in detail (T. Khan and J. Wigginton, manuscript in preparation). Briefly, mice were anesthesized with isoflurane (given to effect in line with oxygen in a vented hood), and a lateral incision was made under sterile conditions in the flank of each mouse. A small incision was made through the peritoneum, with pressure, and the proximal kidney was pushed out of the abdomen, making it and the suprarenal adrenal gland fully visible. With the aid of a Tridak stepper microinjector equipped with a 29-gauge needle, tumor cells (5 x 104 to 1 x 105 cells in 30 µl of HBSS) were directly injected into the adrenal gland. In the metastasis models, tumor cells were injected either i.v. or intrasplenically to induce neuroblastoma metastases. Where indicated, mice were injected i.v. with 1 x 105 TBJ tumor cells/animal and then either monitored for survival, or euthanized at the indicated time points posttumor implantation. Livers were then removed and fixed in Bouins solution for inspection and imaging/quantitation of the metastatic disease burden. In some studies, TBJ-IL-27 or TBJ-FLAG cells were coinjected intrasplenically (1.25 x 105 cells/animal) with equal numbers of TBJ-RFP to facilitate imaging, and mice were euthanized at the indicated time points posttumor implantation. Livers were resected and collected in cold PBS for macroscopic imaging as described below.
To evaluate whether specific immunologic memory responses were generated in mice bearing TBJ tumor cells engineered to overexpress IL-27, mice experiencing complete regression of s.c. TBJ-IL-27 tumors were rechallenged s.c. in the opposite flank with unmodified parental TBJ (1 x 106 cells/animal) and then monitored for survival. To investigate the overall role of the immune system in mediating the antitumor activity of IL-27, TBJ-FLAG or TBJ-IL-27 tumor cells were implanted s.c. in wild-type A/J or immunodeficient SCID mice, as described above, and mice were then monitored for survival. To investigate the specific functional role of T and/or NK cell subsets in the antitumor activity of IL-27, mice bearing s.c. TBJ-IL-27 tumors were depleted of these subsets using neutralizing Abs. To deplete CD4+ vs CD8+ T cell subsets respectively in vivo, mice were injected i.p. with rat anti-mouse CD4+ (GK1.5) or mouse anti-mouse CD8+ (Ly-2.2) Abs on days 3, 1, 1, 3, 6, 8, 10, 13, 15, and 17 posttumor implantation. To deplete NK cells in vivo, anti-asialo GM1 was administered i.p. on days 3, 1, 2, 6, 9, 13, and 16 posttumor cell implantation.
Lymphocyte proliferation
To investigate the impact of local IL-27 expression on the function of draining lymph node-derived lymphocytes in vivo, mice bearing established (day 12) s.c. TBJ-IL-27, TBJ-FLAG, or parental TBJ tumors were euthanized, and tumor-draining inguinal and axillary lymph nodes were collected under sterile conditions. Single cell suspensions were prepared, and lymph node-derived lymphocytes from the respective groups were cultured ex vivo in the presence of anti-CD3/anti-CD28. Lymph node cells were resuspended at 1 x 106 cells/ml in RPMI 1640 containing 5% FCS, 2 mM glutamine, 1 mM pyruvate, 5 x 105 M 2-ME, 2 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 mM HEPES (complete medium). Lymphocytes (5 x 104 cells/well) were cultured at 37°C in 5% CO2 for 72 h in round-bottom 96-well plates precoated with anti-CD3 in complete medium containing anti-CD28 (1 µg/ml). [3H]Thymidine (1 µCi/well) was added 18 h before harvest, and [3H]thymidine incorporation was determined using a beta counter and standard techniques.
ELISPOT assay
The production of IFN-
by lymphocytes derived from the draining lymph nodes of mice bearing TBJ-IL-27, TBJ-FLAG, or TBJ parental tumors was quantitated by ELISPOT assay. Tumor-draining lymph nodes were resected as above from mice bearing established (day 15) s.c. TBJ-IL-27, TBJ-FLAG, or TBJ parental tumors, and single cell suspensions were prepared. Effector cells (1 x 107 cells/ml) were restimulated with irradiated (4000 rad) parental TBJ target cells or irrelevant syngeneic SA-1 cells (1 x 106/ml), and were incubated at 37°C in complete RPMI 1640 medium consisting of 5% FCS, 2 mM glutamine, 1 mM pyruvate, 5 x 105 M 2-ME, 2 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, 10 mM HEPES, and 50 IU/ml IL-2 for 5 days. The production of IFN-
by these restimulated effector cells was assessed, as described below, using ELISPOT assay. Briefly, multiScreen-Immobilon-P plates (polyvinylidene difluoride membranes; Millipore, Bedford, MA) were coated overnight at room temperature with 50 µl/well rat anti-mouse IFN-
capture Ab (clone R4-6A2) diluted at 20 µg/ml in PBS. After overnight incubation at room temperature, coated plates were washed and blocked with complete medium (200 µl/well) (described above). Effector cells (2.5 x 104 cells in 100 µl of complete medium/well) were added in triplicate wells, followed by target cells (5 x 104 cells in 100 µl of complete medium/well), and were then incubated at 37°C for 24 h. Plates were then washed with PBS containing 0.5% Tween 20. Next, 50 µl/well biotinylated rat anti-mouse IFN-
Ab (clone XMG-1.2, diluted to 1.3 µg/ml) was added, and the plates were then incubated for 2 h at room temperature. Plates were then washed four times with PBS, and subsequently, 50 µl of streptavidin alkaline phosphatase (Invitrogen Life Technologies) diluted 1/1500 in PBS with 1% BSA was added to each well, and the plates were incubated for 1 h. Finally, plates were washed four times with PBS, and the spots were visualized with 100 µl/well filtered 5-bromo-4-chloro-3-indolyl phosphate-NBT phosphatase substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD). Plates were developed for 30 min at room temperature in the dark, and the reaction was stopped by rinsing plates with distilled water. The membranes were dried, and the number of spots per well was quantified using the ImmunoSpot Imaging Analyzer system (Cellular Technology, Cleveland, OH). The number of spots/105 effector cells was calculated using the following equation: (
experimental (effectors alone + targets alone))/(no. effector cells per well/100,000), where experimental = total number of spots obtained on effector cells + target cells.
Detection and quantitation of IFN-
mRNA expression within TBJ tumors
Orthotopic TBJ-IL-27 or TBJ-FLAG tumors were resected 14 days posttumor implantation and were immediately snap frozen and stored at 70°C until further use. Total cellular RNA was isolated, and reverse transcription and PCR were performed by one-step RT-PCR kit, according to the manufacturer instructions (Qiagen). Samples were amplified in a thermocycler, as follows: 50°C for 30 min, 95°C for 15 min (1 cycle), 94°C for 30 s, 54°C for 30 s, 72°C for 1 min (29 cycles), and 72°C for 10 min (1 cycle), and PCR products were then separated on 1% agarose gel impregnated with ethidium bromide. The sequence of primer pairs for the respective genes evaluated in these studies and their corresponding predicted sizes are as follows: murine IFN-
: sense ACTGGCAAAAGGATGGTGAC, antisense TGAGCTCATTGAATGCTTGG (product = 237 bp); murine GADPH: sense ACCCAGAAGACTGTGGATGG, antisense CACATTGGGGGTAGGAACAC (product = 171 bp). To quantitate murine IFN-
gene expression within the local tumor site, real-time quantitative PCR also was performed using a mouse IFN-
PCR kit and a sequence detector (ABI-Prism, model 7900HT; Applied Biosystems, Foster City, CA). Detection of murine GADPH was used as an internal control. The thermocycler conditions were: 50°C for 2 min, 95°C for 10 min (1 cycle), and 95°C for 15 s, 60°C for 1 min (40 cycles). The data were automatically collected and analyzed by using the sequence detection system software (SDS2.1) (Applied Biosystems).
Fluorescence imaging
In mice bearing induced metastatic neuroblastoma tumors consisting of TBJ-RFP tumor cells coinjected with either TBJ-IL-27 or TBJ-FLAG cells, fluorescence imaging was performed to assess the impact of IL-27 expression on disease burden in the liver. After mice were euthanized, livers were resected and placed in HBSS. Imaging was performed using a slit fiber optic illuminated light table (Lightools Research, San Diego, CA). Fluorescent excitation of RFP fluorescence was induced by excitation at 540 nm and collected through a 590-nm filter using a Nikon Eclipse E400 microscope fitted to a Nikon digital camera DXM1200 (Image Systems, Columbia, MD).
Immunohistochemistry
Orthotopic TBJ-IL-27, TBJ-FLAG, and TBJ parental tumors were resected at day 14 posttumor implantation, and were then snap frozen immediately in OCT and stored at 70°C for subsequent use. Sections were then cut at 5 µm thickness and were stained using a standard ABC procedure for cryosections (Vector Laboratories, Burlingame, CA) with either rat anti-mouse CD8a or rat IgG2a (negative control) Abs (BD Pharmingen). Tissue sections were examined, and images were captured at x100 and x200 magnification using a Nikon Eclipse E400 microscope equipped with a Nikon digital camera DXM1200 (Nikon, Columbia, MD).
Flow cytometric analysis
To investigate the impact of IL-27 on the cell surface expression of MHC class I Ag on TBJ tumor cells in vivo, single cell suspensions were prepared from TBJ-IL-27, TBJ-FLAG, and TBJ parental tumors. Cells (5 x 105 cells/sample) were initially blocked for 15 min with rat anti-mouse 24G2 Ab diluted 1/100 in PBS containing 3% FCS and 0.1% sodium azide to block Fc receptors and limit nonspecific Ab binding. FITC-conjugated mAbs to H-2Kk and H-2Dd were used at 1/500 dilution, to determine the cell surface MHC class I expression on tumor cells. Samples were analyzed using a FACScan instrument (BD Immunocytometry Systems, San Jose, CA) equipped with a 15 mW argon-ion laser. In some experiments, cells were also stained with rat anti-N-CAM Ab as a marker of neural origin, and the expression of MHC class I was analyzed more specifically in N-CAM-positive cells.
To test the in vitro effect of IFN-
on the expression of MHC class I molecules on TBJ tumor cells, parental TBJ cells were stimulated with IFN-
(500 IU/ml) for 44 h, and cells were then stained with Abs for H-2Kk and H-2Dd. To assess the direct effect of IL-27 on the expression of MHC class I on TBJ cells in vitro, two different approaches were used. First, IL-27-transfected TBJ or TBJ-FLAG cells were cocultivated with TBJ parental cells for 96 h using transwell 0.4-µm-pore polycarbonate membranes (Corning Glass, Corning, NY). Parental cells were washed and stained for MHC class I expression and analyzed, as above. Additionally, RFP-TBJ cells were cocultivated with either TBJ-FLAG or TBJ-IL-27 cells for 72 h, and thereafter, the expression of MHC class I molecules was analyzed on RFP-TBJ cells as above.
Chromium release assay
To investigate the impact of IL-27 on the induction of CTL reactivity in tumor-bearing mice, spleens were resected from mice bearing day 15 established s.c. TBJ-IL-27, TBJ-FLAG, and TBJ parental tumors, and single cell suspensions were prepared. Total splenocytes (1 x 107 cells/ml) were incubated at 37°C in the presence of irradiated (4000 rad) parental TBJ target cells (1 x 106/ml) in RPMI 1640 complete medium as described above, containing 50 IU/ml IL-2, for 5 days. The cytolytic activity of these splenic effector cells was then assessed using a standard 51Cr release assay. Briefly, 1 x 106 TBJ parental or irrelevant syngeneic SA-1 tumor cells were labeled with 100 µCi of Na251CrO4 (New England Nuclear, Boston, MA) for 2 h at 37°C. Target cells were washed, resuspended in the above medium, and plated in triplicate at 5 x 103 cells/well in 96-well plates (Costar, Cambridge, MA). Variable numbers of splenic effector cells in complete medium were then added to achieve the desired E:T ratio, and plates were then incubated for 6 h at 37°C. At the conclusion of the incubation, culture supernatants were harvested and counted individually in a gamma counter (PerkinElmer Wallac, Turku, Finland). The percentage of specific lysis was calculated as follows: percentage of specific lysis = (ER SR) x 100/(MR SR), where ER = experimental release; SR = spontaneous release; MR = maximum release. Minimum release was determined by incubating the target cells with medium alone. Maximum release was determined by exposing the target cells to 2% Triton X-100.
Statistical methods
Mice were monitored for tumor growth and/or overall survival where indicated. In mice bearing s.c. tumors, tumor dimensions were determined twice weekly using calipers. Tumor volumes were estimated by calculating the product of the smallest measured dimension2 x largest measured dimension. Tumor volumes and tumor weights among the respective groups were compared using the Wilcoxon rank-sum test. Kaplan-Meier curves were plotted for survival comparisons. The relative proportion of mice achieving complete durable tumor regression and long-term survival, and the proportion of mice rejecting tumor rechallenge and long-term survival were compared with Fishers exact test. Interpretations regarding survival and tumor regression outcomes were in complete interpretative agreement. For lymphocyte proliferative responses and MHC class I expression, mean values were determined for the respective conditions performed in triplicate, and groups were compared using Students t test. All p values were two tailed and were considered significant at p < 0.05.
| Results |
|---|
|
|
|---|
TBJ cells were transfected to overexpress IL-27 fusion protein using the pFlagCMV-1 expression vector, as described above. Overexpression of IL-27 was confirmed by RT-PCR (Fig. 1A). Clones that demonstrated overexpression of the IL-27 fusion gene were subsequently tested for protein expression using immunoprecipitation, followed by Western blot assay. Clone 5 expressed high levels of IL-27, while clones 9 and 8 showed intermediate and low level of protein expression respectively (Fig. 1B). IL-27 protein secretion by these clones was subsequently assayed using culture supernatants, and the secretion of large amounts of soluble IL-27 by clone 5 was confirmed (Fig. 1C).
|
To investigate the impact of IL-27 on the growth of neuroblastoma tumors, mice were injected s.c. with either TBJ-IL-27, TBJ-FLAG, or TBJ parental tumor cells as described above, and were then monitored for survival. Tumor dimensions were determined twice weekly as described above. TBJ-IL-27 tumors grew more slowly and were significantly smaller (593.5 ± 330.1 mm3) at day 16 postimplantation compared with either TBJ-FLAG (4386 ± 754.3 mm3) or parental TBJ (2879 ± 632.9 mm3) tumors (p = 0.001, TBJ parental vs TBJ-IL-27; p < 0.001, TBJ-FLAG vs TBJ-IL-27) (Fig. 2A). Furthermore, complete tumor regression and long-term survival were achieved in 20 of 21 mice (95%) bearing TBJ-IL-27 tumors compared with 1 of 21 mice (5%) bearing TBJ-FLAG tumors and 1 of 21 mice (5%) bearing parental TBJ tumors (p < 0.0001, TBJ-IL-27 vs either parental or TBJ-FLAG) (Fig. 2B). Potent antitumor activity was also observed using distinct TBJ clones, including clones that demonstrated lower levels of IL-27 protein expression, as detected by Western blot (data not shown).
|
Based on the potent antitumor activity of IL-27 in mice bearing s.c. neuroblastoma tumors, the antitumor activity of IL-27 was then evaluated in a more therapeutically challenging orthotopic model. IL-27 markedly delayed the growth of orthotopic TBJ neuroblastoma tumors. TBJ-IL-27 tumors (0.211 ± 0.052 g) were significantly smaller on day 15 postimplantation compared with either TBJ parental (1.155 ± 0.169 g) or TBJ-FLAG (1.487 ± 0.22 g) tumors (p < 0.001, TBJ-IL-27 vs either TBJ-FLAG or TBJ parental) (data not shown). Furthermore, complete tumor regression and long-term survival were achieved in 20 of 20 mice (100%) bearing orthotopic intra-adrenal TBJ-IL-27 tumors compared with 3 of 20 mice (15%) bearing either TBJ-FLAG or TBJ parental tumors (p < 0.0001, TBJ-IL-27 vs either TBJ-FLAG or TBJ parental) (Fig. 3).
|
In light of the antitumor activity of IL-27 against primary TBJ tumors, we next investigated whether IL-27 was also effective in mice bearing widespread metastatic disease. The burden of metastatic disease in the liver was markedly reduced in mice injected with TBJ-IL-27 tumor cells compared with those injected with either TBJ-FLAG or TBJ parental tumor cells. Fifteen days after i.v. injection of tumor cells, <5 macrometastatic lesions per liver were noted in mice injected with TBJ-IL-27 compared with >300 macrometastatic lesions per liver in mice injected with either TBJ-FLAG or parental TBJ (p < 0.001, TBJ-IL-27 vs either TBJ-FLAG or TBJ parental) (Fig. 4, A and B). Furthermore, metastatic TBJ-IL-27 tumors were completely rejected in 4 of 10 (40%) mice compared with 0 of 10 (0%) in mice bearing either TBJ-FLAG or TBJ parental cells (p = 0.001, TBJ-IL-27 vs either TBJ-FLAG or TBJ parental) (Fig. 4C). To investigate whether IL-27 could also mediate the regression of adjacent nontransfected tumor cells, mice were coinjected with equal numbers of either TBJ-IL-27 or TBJ-FLAG with TBJ-RFP tumor cells intrasplenically as described above. The formation of red fluorescent liver metastases at day 10 posttumor cell injection was markedly reduced in mice coinjected with TBJ-IL-27 and TBJ-RFP tumor cells compared with mice that were coinjected with TBJ-FLAG and TBJ-RFP tumor cells (Fig. 5).
|
|
To investigate whether an immunologic memory response was generated in mice that were cured of their original TBJ-IL-27 tumors, mice were rechallenged with parental TBJ tumor cells. Eight of 9 (88%) mice cured of their original s.c. TBJ-IL-27 tumors rejected a subsequent s.c. rechallenge in the opposite flank with parental TBJ, while 1 of 10 naive mice rejected a tumor challenge and all mice died before day 30 posttumor implantation (p = 0.0001) (Fig. 6). One mouse in each group was censored from the survival curves. One mouse in the naive control group inadvertently was euthanized, but was tumor free, while one mouse in the rechallenge group died at day 40, but was also tumor free. These results indicate that an effective systemic immunologic memory response to TBJ is generated in mice cured of their original TBJ-IL-27 tumors.
|
To define the role of an intact immune system in mediating the potent antitumor activity of IL-27, comparative experiments were performed in wild-type mice and immune-deficient SCID mice. TBJ-IL-27 or TBJ-FLAG tumor cells were injected s.c., as described above, and the mice were then monitored for survival. Although complete regression of TBJ-IL-27 tumors occurred in 8 of 10 wild-type mice, 0 of 10 TBJ-IL-27 tumors regressed in SCID mice (p = 0.0031) (Fig. 7A). These studies demonstrate that the ability of IL-27 to mediate complete tumor regression is critically dependent on the presence of an intact immune system.
|
IL-27 activates the host immune response in vivo
The generation of efficient immunologic memory responses in a high proportion of mice cured of their original TBJ-IL-27 tumors and the important functional role of CD8+ T cells in the antitumor effects of IL-27 suggested that IL-27 could potently modulate immune function in vivo. To directly address this question, draining lymph node-derived lymphocytes from mice bearing TBJ parental, TBJ-FLAG, or TBJ-IL-27 tumors were harvested 12 days posttumor implantation, and proliferative responses were assayed in the presence of ex vivo stimulation with anti-CD3/anti-CD28. Lymphocytes from mice bearing TBJ-IL-27 tumors were primed to proliferate more effectively (
2-fold increase) in response to ex vivo culture with anti-CD3/anti-CD28 compared with those from mice bearing either TBJ-FLAG or parental TBJ tumors (TBJ-IL-27, 18,097 ± 1,606 cpm; TBJ-FLAG, 10,363 ± 755 cpm; TBJ parental, 8,946 ± 499 cpm; p < 0.005, TBJ-IL-27 vs either TBJ-FLAG or TBJ parental) (Fig. 8A).
|
production upon restimulation with TBJ parental tumor cells compared with those derived from mice bearing TBJ-FLAG or TBJ parental tumors (TBJ-IL-27, 883 spots/105 effector cells; TBJ-FLAG, 0 spots/105 effectors; TBJ parental, 73 spots/105 effectors) (Fig. 8B). The augmentation of IFN-
production by IL-27 is tumor specific in that no significant effect is observed upon restimulation of lymph node-derived lymphocytes with unrelated, syngeneic SA-1 tumor cells (Fig. 8B).
IL-27 enhances infiltration of CD8+ T and up-regulates local IFN-
gene expression within the tumor microenvironment
To investigate alterations in the host immune response induced by IL-27 within the tumor microenvironment, orthotopic TBJ-IL-27 and TBJ FLAG tumors were resected at day 12 postimplantation, and sections were stained to visualize CD4+ or CD8+ T cells using standard immunohistochemical techniques. A dramatic increase in the local infiltration of CD8+ T cells was observed within TBJ-IL-27 tumors compared with either TBJ-FLAG or TBJ parental tumors (Fig. 9A). No consistent alterations in the infiltration of CD4+ T cells were observed within the IL-27 tumors (data not shown). Furthermore, IL-27 markedly enhanced the local expression of IFN-
within TBJ tumors. Orthotopic TBJ-IL-27 and TBJ-FLAG tumors were resected on day 14 postimplantation, and total RNA was isolated and tested for IFN-
and GAPDH mRNA expression using RT-PCR. TBJ-IL-27 tumors exhibited a marked and consistent increase in local IFN-
gene expression compared with TBJ-FLAG tumors (Fig. 9B). Confirmatory analysis using real-time quantitative PCR demonstrated 5-fold higher levels of IFN-
mRNA expression within TBJ-IL-27 tumors than is found in TBJ-FLAG tumors (Fig. 9C).
|
Based on our demonstration that IL-27 enhances tumor-specific immune responsiveness and the generation of immunologic memory, and promotes the expression of IFN-
within the tumor microenvironment, we hypothesized that IL-27 could up-regulate MHC class I molecules, a key component of T cell-target cell recognition, on TBJ tumor cells in vivo. Subcutaneous TBJ-IL-27, TBJ-FLAG, and TBJ parental tumors were resected at day 15 postimplantation, single cell suspensions were prepared, and cell surface expression of H-2Kk and H-2Dd Ags was determined via FACS analysis. IL-27-expressing tumors showed 4- to 5-fold increase in the expression of H-2Kk (mean fluorescence intensity 680.5 ± 42.5) and H-2Dd (361.9 ± 32.6), in comparison with TBJ-FLAG tumors (H-2Kk = 175.1 ± 28.7; H-2Dd = 90 ± 17.7) and TBJ parental tumors (H-2Kk = 157.8 ± 7.4; H-2Dd = 74 ± 15.9) (Fig. 10A). Similar trends were observed when cell suspensions prepared from mice bearing these respective tumors were costained with N-CAM, and class I expression was determined on N-CAM + cells. TBJ-IL-27 tumors showed a 3.3- to 5.3-fold increase in the expression of H-2Kk (mean fluorescence intensity 709.4) and H-2Dd (324.2), in comparison with TBJ-FLAG tumors (H-2Kk = 213.3; H-2Dd = 95.3) and TBJ parental tumors (H-2Kk = 142; H-2Dd = 74 ± 15.9) (data not shown).
|
(500 IU/ml) induced a 3-fold increase in the expression of H-2Kk (mean fluorescence intensity 299.2) and H-2Dd (210.2) in contrast to nontreated TBJ parental cells (H-2Kk = 101.6; H-2Dd = 71.4). We hypothesized that IL-27 could also directly induce the expression of MHC class I molecules on the cell surface of TBJ tumor cells. To investigate this question, TBJ-RFP tumor cells were cocultured in vitro with either TBJ-IL-27 or control TBJ-FLAG tumor cells, and the expression of MHC class I was determined on RFP-positive cells. Coculture of TBJ-RFP cells with TBJ-IL-27 enhanced the expression of both H-2Kk (mean fluorescence intensity 299.1) and H-2Dd (215.7) compared with TBJ-RFP cells cocultured with TBJ-FLAG (H-2Kk = 86.0; H-2Dd = 45.0). Similar effects were observed when TBJ parental cells were cocultivated with TBJ-IL-27 vs TBJ-FLAG cells separated from parental TBJ cells by transwell-pore polycarbonate membranes (data not shown).
We next investigated whether the observed alterations in the host immune response induced by IL-27 in tumor-bearing mice translated to enhanced tumor-specific killing using the 51Cr release assay. Spleens from mice bearing TBJ-IL-27 vs TBJ-FLAG tumors were resected at day 15 postimplantation and assessed for CTL activity against parental TBJ tumor cell or the irrelevant syngeneic SA-1 tumor cell line. A significant increase in specific CTL activity directed against TBJ parental tumors was observed in the splenocytes from mice inoculated s.c. with TBJ-IL-27 tumors (24.9% ± 2.5) compared with those from mice inoculated with TBJ-FLAG tumors (3.9% ± 2.9). In contrast, no significant CTL activity by either group was observed against irrelevant syngeneic SA-1 tumor cells (Fig. 10B). These findings demonstrate that IL-27 can potently enhance specific cytotoxic activity against TBJ neuroblastoma tumors in vivo, and that systemic immune reactivity is generated even at sites distant from locoregional lymph nodes draining the tumor site. Furthermore, these observations suggest that IL-27 may modulate tumor cell MHC class I expression both indirectly via induction of IFN-
production, as well as directly at the level of the tumor cell itself.
| Discussion |
|---|
|
|
|---|
(3, 40, 41, 42), a central mediator of the endogenous immune response to malignant cells and/or infectious pathogens in various preclinical models (43, 44). Furthermore, IL-12 and IL-18 have demonstrated dramatic antitumor activity, even against well-established primary and/or metastatic disease (45, 46, 47, 48), and several groups have now shown that IL-2 can synergistically enhance the immunoregulatory and antitumor activity of IL-12 (8) and/or IL-18 (10, 49, 50). Collectively, these observations have generated renewed interest in the potential use of cytokines for the treatment of solid tumors, and have provided preclinical rationale for the initiation of studies to investigate the clinical activity of IL-12 (11, 33, 37) and/or IL-18 administered alone or in combination with IL-2 (51, 52).
The host immune response can be divided into nonspecific innate immune surveillance mechanisms, and specific T cell-mediated adaptive immunity. Coordination of early innate immune surveillance mechanisms with the subsequent generation of a productive adaptive T cell-mediated immune response is regulated by a complex array of functionally interrelated cytokines. These include members of the common
-chain signaling family (i.e., IL-2, IL-7, IL-15, and IL-21) (53, 54, 55, 56) as well as IL-18 (57, 58) and a newly described family of cytokines that are related to IL-12 (IL-12, IL-23, and IL-27) (15, 19, 59, 60). The complexity of these mechanisms further emphasizes that the most successful approach to initiate, expand, and maintain a productive host antitumor immune response in a sustained fashion with cytokines may require rationally designed combinations of agents with complementary mechanisms of action. Definition of those cytokines that are most critical to a therapeutically driven antitumor immune response may offer the prospect of not only improved overall efficacy, but also a more favorable safety profile than could be achieved with high doses of any single cytokine alone. As such, defining the mechanisms of action by newly described cytokines such as IL-23 and IL-27 and the molecular basis for interaction between these factors and potent antitumor cytokines such as IL-2, IL-12, and IL-18 may be particularly important for the design of future cytokine-based strategies for the treatment of solid tumors.
The present studies demonstrate that IL-27, the most recently characterized member of a family of heterodimeric IL-12-related cytokines, can mediate tumor regression in the vast majority of mice bearing primary neuroblastoma tumors. A recent report has shown that IL-27 can mediate the regression of heterotopic s.c. implants of the CT26 murine colorectal carcinoma cells engineered to overexpress IL-27 (61). We have now shown that IL-27 also has potent antitumor activity in murine models of neuroblastoma, the most common extracranial solid tumor in children. Furthermore, this antitumor activity is seen not only in mice bearing heterotopic s.c. tumors, but also in mice bearing more therapeutically challenging orthotopic intra-adrenal neuroblastoma tumors. Furthermore, using fluorescence-based imaging, the present studies now demonstrate that IL-27 possesses potent antitumor activity even in mice bearing widespread induced metastatic disease in the liver, and that IL-27 can also mediate complete regression of coinjected unmodified parental TBJ tumor cells. This activity is particularly notable, in that patients with metastatic neuroblastoma have a very poor prognosis overall compared with those patients with more limited locoregional disease (62, 63), and there remains a particularly urgent need for new therapeutic interventions in this patient population.
We subsequently initiated studies to investigate the underlying mechanisms that contribute to the potent antitumor activity of IL-27. Immunologic memory responses were generated in mice that experience complete regression of TBJ-IL-27 tumors, in that these mice rejected a subsequent rechallenge with unmodified parental TBJ tumor cells. In addition, the efficacy of IL-27 was ablated in tumor-bearing SCID mice compared with wild-type mice, demonstrating a clear role for the presence of an intact immune system, and more specifically, T and/or B cells, in mediating the antitumor activity of IL-27. A report by Hisada et al. (61) has shown that CD8+, but not CD4+ T cells play an important role in the ability of IL-27 to regulate early events in tumor progression (1520 days posttumor implantation) and inhibit the growth of CT26 murine colon carcinoma tumors. We have clearly demonstrated both that CD8+ T cells are critical mediators of the induction of complete tumor regression and long-term survival by IL-27 in mice bearing TBJ neuroblastoma tumors, and that neither CD4+ T cells or NK cells are essential contributors to these mechanisms. Although consistent with observations in some studies using other IL-12-related cytokines including IL-12 (45, 64) or IL-23 (21) in preclinical tumor models, the role for CD8+ T cells and the generation of immunologic memory responses are somewhat unexpected based on the known biology of IL-27 and previous reports suggesting that the predominant effects of IL-27 are on naive CD4+ T cell populations.
Previous studies have shown that IL-27 can potentiate proliferative responses by human and/or murine naive CD4+ T cells in vitro (14), and enhance the production of IFN-
by activated naive murine CD4+ T cells as well. Furthermore, IL-27 can up-regulate expression of the
2 subunit of the IL-12R on murine CD4+ T cells (25), and as this observation might predict, can synergize with IL-12 ± IL-2 to induce the production of IFN-
in vitro by effector cell populations that include murine and human naive CD4+ T cells and human NK cells (14). We have now shown that IL-27 induces in vivo activation of the host immune system in mice bearing TBJ tumors as well. More specifically, we have found that lymph node-derived lymphocytes from mice bearing TBJ-IL-27 tumors are primed to proliferate upon subsequent ex vivo exposure to anti-CD3/anti-CD28 compared with those isolated from mice bearing control TBJ-FLAG tumors. Furthermore, restimulation of draining lymph node-derived lymphocytes with unmodified TBJ tumor cells leads to marked enhancement of IFN-
production by lymphocytes from mice bearing TBJ-IL-27 tumors compared with those from mice bearing TBJ-FLAG or parental TBJ tumors. The enhancement of IFN-
production by IL-27 in this assay system is tumor specific, in that restimulation with irrelevant syngeneic tumor cells (SA-1) has no effect, further supporting a role for T cells in the antitumor activity of IL-27.
The present studies have also provided additional insight into mechanisms initiated by IL-27 within the tumor microenvironment. More specifically, in addition to demonstrating the functional importance of CD8+ T cells in the antitumor efficacy of IL-27, we have also observed dramatic increases in the infiltration of CD8+, but not CD4+ T cells within the local microenvironment of TBJ-IL-27 tumors compared with either TBJ-FLAG or TBJ parental control tumors. Furthermore, potent induction of local IFN-
expression is observed within TBJ-IL-27 tumors compared with TBJ-FLAG or TBJ parental control tumors. In contrast to recent studies that have demonstrated substantial increases in circulating IFN-
levels in mice bearing CT-26 tumors engineered to overexpress IL-27 and implicated IFN-
in the delay of tumor growth by IL-27 (61), the regression of TBJ-IL-27 neuroblastoma tumors occurs in the absence of significant increases in systemic IFN-
levels (data not shown). The ability of IL-27 to markedly up-regulate local expression of IFN-
within TBJ tumors and enhance tumor-specific immune responsiveness led us to hypothesize that IL-27 could enhance the expression of MHC class I molecules on TBJ tumor cells. Subsequent studies revealed that the expression of both H-2Kk and H-2Dd MHC class I molecules is markedly up-regulated on the surface of TBJ-IL-27 tumor cells in vivo compared with levels observed on either TBJ-FLAG or TBJ parental tumor cells. Furthermore, consistent with this observation, we subsequently found that not only does direct treatment with IFN-
up-regulate the expression of H-2Kk and H-2Dd on the surface of TBJ cells in vitro, but also that IL-27 appears to directly up-regulate the expression of these molecules as well.
Substantial increases in tumor-specific systemic CTL reactivity were also generated in mice bearing TBJ-IL-27 tumors compared with mice bearing TBJ-FLAG or TBJ parental tumors. In conjunction with previous reports suggesting that IL-27 is produced early in an evolving immune response (14), and that IL-27 may also exert potent effects on naive T cells (14, 25, 65), these observations suggest that IL-27 may not only activate T cells themselves, but also act on target cells to up-regulate MHC class I expression and sensitize them to initial recognition by infiltrating T cells. Collectively, these effects may play an important role in the induction of systemic CTL reactivity, CD8+ T cell-mediated tumor regression, and the generation of immunologic memory, as we have observed in mice cured of their original TBJ-IL-27 tumors.
With respect to other members of the IL-12 cytokine family, although both IL-27 (14) and IL-12 (40, 41) can induce the production of IFN-
under certain conditions, IL-12 appears to be a more potent in vitro inducer of IFN-
production than IL-27 (14). Furthermore, the downstream mechanisms engaged by IL-12 vs IL-27 may in fact differ significantly both at the level of the effector cell, as well as within the local tumor microenvironment. IL-12 is known to exert its biologic effects on target cell populations via binding to a heterodimeric receptor consisting of IL-12R
1 and IL-12R
2 subunits, with subsequent activation of Tyk2 and Jak2, and ultimately the activation and nuclear translocation of transcription factors, including STAT-1, 3, 4, and 5 (reviewed in Ref.15). STAT-4 appears to mediate many of the downstream effects of IL-12 (15). In contrast, IL-27 mediates its biologic effects via binding to a heterodimeric receptor consisting of WSX-1 and gp130 subunits (23), and leads ultimately to the activation of the transcription factors STAT-1 and T-bet (25, 66). In mice bearing CT26 colon carcinoma tumors engineered to overexpress IL-27, although IFN-
and T-bet appear to mediate the ability of IL-27 to delay tumor growth, IL-27 retains its therapeutic efficacy in STAT-4 knockout mice (61). In tumor-bearing mice, treatment with IL-12-based regimens appears to engage several downstream mechanisms that collectively mediate pronounced inhibition of tumor neovascularization and/or the destruction of existing vasculature, including the production of IFN-
-inducible antiangiogenic chemokines such as IFN-
-inducible protein-10 and monokine induced by IFN-
(67, 68, 69), as well as activation of the FAS/FAS ligand pathway and FAS-mediated vascular endothelial injury (64). In striking contrast, our studies to date suggest that despite its strong antitumor activity, and the potent induction of local CD8+ T cell infiltration and IFN-
expression within the microenvironment of TBJ-IL-27 tumors, IL-27 does not appear to mediate either direct or indirect inhibition of tumor neovascularization or the destruction of existing vasculature (R. Salcedo and J. Wigginton, unpublished observations).
The current studies provide the first demonstration that IL-27 can mediate the complete regression of orthotopic primary as well as metastatic murine neuroblastoma tumors, as well as initial insight into mechanisms engaged within the local tumor microenvironment by IL-27. Although additional preclinical investigation will be required, the present studies suggest that IL-27 might play a role in future cytokine-based approaches for the treatment of primary and/or metastatic solid tumors. Furthermore, based on previous evidence suggesting that IL-27 may drive the initial commitment of T cells to a Th1 phenotype, up-regulate components of the IL-12R (25), and synergistically enhance the immunoregulatory activity of other antitumor cytokines such as IL-2 and IL-12 in vitro (14) (R. Salcedo and J. Wigginton, unpublished observations), these current studies suggest that preclinical investigation of therapeutic approaches combining IL-27 with other antitumor cytokines such as IL-2 and IL-12 is warranted as well.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract N01-C0-12400. The publisher or recipient acknowledges right of the U.S. government to retain a nonexclusive, royalty-free license in and to any copyright covering the article. The content of this publication does not necessarily reflect the views of policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the US government. ![]()
2 Address correspondence and reprint requests to Dr. Jon M. Wigginton, Pediatric Oncology Branch, National Cancer Institute, Building 560, Room 31-93, Frederick, MD 21702-1201. E-mail address: jw121b{at}nih.gov ![]()
3 Abbreviations used in this paper: EBI3, EBV-induced gene 3; N-CAM, neural cell adhesion molecule; RFP, red fluorescent protein. ![]()
Received for publication March 8, 2004. Accepted for publication October 4, 2004.
| References |
|---|
|
|
|---|
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
in mediating the antitumor efficacy of interleukin-12. J. Immunother. Emphasis Tumor Immunol. 17:71.[Medline]
production by T cells. Nature 378:88.[Medline]
for IFN-
production from human T cells. Int. Immunol. 12:151.
-inducing factor elicits antitumor immunity in association with interferon-
production. J. Immunol. 21:48.
produced by tumor-infiltrating cells and its secondary induction of anti-tumor pathways. J. Leukocyte Biol. 62:450.[Abstract]
production by anti-tumor T cells. Int. Immunol. 7:1135.
and Fas-ligand-dependent tumor eradication by combined administration of IL-18 and IL-2. J. Immunol. 169:4467.
induction is associated with clinical response. Clin. Cancer Res. 6:1678.