|
|
||||||||
Light Chain Repertoire1



* Department of Microbiology and Interdisciplinary Immunology Program, University of Iowa, Iowa City, IA 52242;
Institut National de la Recherche Agronomique, Institute of Molecular Biology, Jouy-en Josas, France; and
Revivicor, Blacksburg, VA 24060
| Abstract |
|---|
|
|
|---|
genes in the porcine preimmune repertoire belong to three subfamilies of V
genes that share 87% sequence similarity with human IGKV2. This porcine V
family also shares sequence similarity with some, but not all, V
genes from sheep. Hybridization with sperm DNA and sequence analyses of polynucleotides from overlapping bacterial artificial chromosome clones suggest swine possess
60 IGVK2 genes. The latter method also revealed that certain IGKV2 subfamilies are not expressed in the preimmune repertoire. Six members of an IGVK1 family were also expressed as part of the preimmune repertoire, and these shared 87% sequence similarity with human IGVK1. Five J
segments, complete with recombination signal sequences and separated by
300 nt, were identified
3 kb upstream of a single C
. Surprisingly, J
2 accounted for >90% of all framework region 4 sequences in the preimmune repertoire. These findings show that swine use
10 IGVK2 genes from three of six subfamilies and preferentially one J
segment to generate their preimmune
repertoire. These studies, like those of porcine Ig constant regions and MHC genes, also indicate unexpected high sequence similarity with their human counterparts despite differences in phylogeny and the mechanism of repertoire diversification. | Introduction |
|---|
|
|
|---|
80% of the preimmune repertoire (1, 2). This is a major departure from mice and humans that have large numbers of VH, DH, and JH segments and rely heavily on combinatorial diversity (reviewed in Ref.3). Rather, the swine is more reminiscent of the rabbit, which uses the most 3' VH gene in
90% of all early VDJ rearrangements (4). However, in the rabbit somatic conversion of this VH gene during VDJ rearrangement further diversifies the repertoire (5) in a manner reminiscent of the phenomenon described in the chicken (6). By contrast, gene conversion is rare in mice and humans (7), and the conversion-like hybrid VH genes that are readily recovered in swine can be explained as PCR artifacts (8). Because recent work has demonstrated a major role for L chain diversity in rabbit (9), we undertook the present study to determine whether L chain diversity in swine compensated for the limited VH diversity seen in this species.
A second reason for this study relates to the proportional usage of
and
light chains. Swine are artiodactyls like cattle and sheep and are members of the larger ungulate group that also includes the horse. Despite their phylogenetic relationship to other hoofed mammals, swine do not share the predominant use of
-chains (>90%) seen in cattle, sheep, and horses, but, rather, express light chains in a 1:1 ratio (10) (A. Moravkova, C. Lemke, J. Sinkora, J. Sun, J. E. Butler, unpublished observations) in a pattern that resembles the human (3). This raises the question of whether L chain usage merely reflects the size of the locus or is determined by some regulatory/selection process. In horses, the latter seems more likely, because this species has >20 V
genes, but C
accounts for only 5% of L chain usage (11). However, in sheep, there are 90140 V
genes (12, 13), but only 10 V
(14), so usage correlates with the size of the genomic repertoire. Therefore, we believed that a comparison of the V
and V
repertoire in swine, compared with that of L chain repertoires in other species, might provide additional insight into differential L chain usage among mammals. In this report we present data on expressed V
J
rearrangements from the preimmune repertoire, V
and J
diversity, and the size of the V
and J
genomic repertoire.
We examined
100 V
J
transcripts recovered from three different fetal lymphoid tissues. Fetal tissues were studied for two reasons. First, previous studies have shown that VDJ transcripts of the porcine preimmune repertoire have few or no mutations during fetal life (1, 2); therefore, expressed V
and J
segments are most likely to resemble their genomic counterparts. Second, our developmental studies have focused on the repertoire that develops without the influence of environmental Ag, pathogen-associated molecular patterns presented by gut flora, and passively acquired maternal regulatory factors. It is important to review that there is no placental transport of maternal Ig or environmental Ag to the fetal piglet (15). Therefore, we define the preimmune repertoire as the one that develops before colonization, not the one induced by colonization (16). Analysis of these fetal transcripts indicated four groups of V
genes. Three of the groups, representing >90% of expressed V
genes, belonged to a single family with high sequence similarity to human IGKV2, whereas the minor family shares equally high sequence similarity with human IGKV1. For these reasons, we have adopted the human IMGT nomenclature for the porcine V
genes. The number of IGKV2 genes in the genome was calculated from Southern blots using IGKV2 standards and by cloning and sequencing
200 IGKV2 genes recovered from overlapping bacterial artificial chromosome (BAC)3 clones. A comparison of germline IGKV2 genes with those used in the preimmune repertoire suggests preferential IGKV2 gene usage during development. Although studies identified six J
sequences, five were present in contiguous order in the genome, but only three were used, and J
2 was used in >90% of all V
J
rearrangements recovered from the preimmune repertoire. We concluded that combinatorial diversity in the preimmune porcine
locus is restricted and in this regard parallels the porcine H chain repertoire in differing from the pattern seen in mice and humans.
| Materials and Methods |
|---|
|
|
|---|
Total RNA was recovered from pooled fetal bone marrow (BM), thymus, and spleen. Fetal tissue was selected because the preimmune repertoire was the focus of the study and because somatic hypermutation (SHM) is rare during fetal life in piglets (2). One hundred and ten day gestation (DG110) thymus and BM and DG40 and DG50 fetal spleen were used. Thymus was selected because B cells occur in this organ (17), and we wondered whether the V
sequences from thymus differed from those recovered from BM. Early spleen (DG50) was chosen to determine whether certain V
or J
segments were predominantly used during early B cell lymphogenesis, because early B cell development in this species differs from that in the BM of animals at DG60 and later (18).
Recovery of V
J
cDNA
cDNA libraries were constructed from fetal thymus and BM from the same animals using the ZAP Express Library Construction kit supplied by Stratagene (La Jolla, CA). Libraries were screened using a C
probe based on published sequences and C
genes cloned in our laboratory (19) (J. Sun and J. E. Butler, unpublished observations). cDNAs were also recovered from five other animals by 5'RACE using a Gene Racer kit (Invitrogen Life Technologies, Carlsbad, CA) and specific antisense primers (Table I, Antisense PCR primers used in Generacer), and the products were cloned into the pCR4 TOPO vector and grown in TOP TEN cells. After plating on Luria Bertani-AMP, clones were transferred to nylon membranes and hybridized with a [32P]C
probe. Positive hybridizing clones were then sent to the University of Iowa DNA core facility for sequencing using the four-color ABI PRISM DNA analyzer (Applied Biosystems, Foster City, CA).
|
All sequences were initially analyzed in the Omiga program (Accelrys, Madison, WI); for analysis of rearranged V
J
segments, extraneous C
and 5' vector sequences were removed. Leader sequences were identified from ATG start site codons located 20 codons upstream of the consensus A-I-V-L motif that begins framework region 1 (FR1) of porcine V
gene sequences. FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 were identified by comparison with the international IMGT database (20). Because many clones recovered from the cDNA library were truncated at the 5' end, these were used to compare the sequences of expressed C
segments.
Nucleotide sequences for V
segments (FR1, CDR1, FR2, CDR2, and FR3) were compared using the PileUp program of SegWeb (GCG, Madison, WI), then translated and dendrograms were constructed comparing porcine V
genes with the consensus sequences of individual families of rabbit, horse, and sheep and human families IGKV1IGKV7 (Fig. 1). The Old Distances program from GCG was used to compare the porcine V
nucleotide sequences to each other. Sequences showing >80% intraspecies sequence similarity were regarded as members of the same family. Individual dendrograms comparing FR1, CDR1, FR2, FR3, and CDR3 were also prepared as an aid to identifying the sites of similarity and difference among porcine and V
sequences of other species. Results are described, but are not shown.
|
primers used in BAC library cloning), and the product was ligated into the pCR2.1-TOPO vector. Transformed bacteria (TOP TEN cells) were then cloned on Luria Bertoni-kanamycin agarose plates. Up to 43 clones for each different IGKV2-containing polynucleotide fragment were selected and sequenced (Table II). The sequences were analyzed using Omiga so that each unique IGKV2 gene sequence could be identified. Unique sequences were then compared using PileUp (see above) to classify them in relation to the subgroups identified from cDNA (Figs. 1, 2, and 6). It is important to note that this cloning procedure did not recover all nucleotides in the 3' portion of FR3 that have quite variable sequences perhaps due to real germline variation or perhaps as a result of junctional diversity and/or SHM (Fig. 2). Thus, sequence comparisons of expressed IGKV2 genes and those recovered from BAC clones (Table II and Fig. 6) are biased to similarities/differences in the 5' three quarters of IGKV2 genes.
|
|
|
A 4.3-kb DNA fragment was recovered from genomic DNA using a primer complementary to a portion of J
(caaggaqaccaagctggaactc) and an antisense primer complementary to a portion of C
(tgatcaagcacaccacagagacag). Another overlapping, upstream clone was obtained using a primer complementary to an EST (GenBank accession no. CB286054) that appeared to be a pre-B cell germline transcript (gcacatggtaggcaaaggactt) together with an antisense primer complementary to a region of the 4.3-kb amplicon described above (gtccccaatttcacacccgtat). In addition, a downstream sequence was obtained from an amplicon generated using a primer complementary to C
and a primer complementary to a region conserved among mammals in the downstream enhancer region. This was done to determine whether swine possess more than one C
sequence in the locus. These DNA fragments collectively contained the sequences of five porcine genomic J
segments, one C
gene, and a portion of the 3'
enhancer. The J
genes were aligned with those for human, rat, mouse, horse, rabbit, and partial sequences for the sheep. A porcine cosmid library (BD Clontech, La Jolla, CA) was also plated and screened using various
segment probes, of which an antisense J
probe (Table I, 32P-labeled primers used as probes to identify V
, J
, and C
by hybridization) recovered an additional J
segment.
V
-containing clones were recovered from a porcine BAC library constructed with sheared genomic DNA from fibroblasts of a Large White boar (similar to the Yorkshire breed). DNA was inserted into the pBelo BAC11 vector at the HindIII cloning site and then cloned into Escherichia coli DH10. The library, which was organized for PCR screening, comprised >107,000 clones with an average insert size of 145 kb (22). The library was cloned by PCR using V
-specific primers derived from cDNA clones (Fig. 2). Primers were tested for specificity against genomic sperm DNA and a panel of cDNA clones.
A clone-based physical map of the V
-containing region of the porcine genome was constructed using fluorescent fingerprinting according to the method described by Schibler et al. (23). A total of eight V
-containing BAC clones were recovered using both degenerate primers for V
genes and specific primers for porcine IGKV2. These clones were shown by fingerprinting to overlap, and one (BAC clone B) was recovered with a very strong signal, suggesting that it contained the bulk of especially the IGKV2 genes (see Fig. 5).
|
Southern blots were performed on enzyme-restricted sperm DNA and BAC clones. Transfer was performed using a Turbo-blotter (Schleicher & Schuell, Keene, NH), blocked 24 h at 65 C, and incubated 24 h with a IGKV2 probe. The 229-bp IGKV2 probe was made from clone Sk20 (Table I, IGKV2 probe used for Southern blot analyses of genomic DNA and BAC clones) and had >88% sequence similarity to all IGKV2 genes expressed in the preimmune repertoire. The randomly labeled 32P-labeled probe was generated by 25 cycles using the V
sense primer (Table I, V
primers used in BAC library cloning) and [32P]dCTP (21). Conditions were: 94°C for 1 min, 52°C for 5 min, and then 72°C for 10 min. This probe was tested for specificity against plasmid DNA for H chain VDJ, V
J
, TCR V
VDJ, and a panel of IGKV1 and IGKV2 clones. The 229-bp IGKV2 probe only recognized IGKV2-containing clones. Initial patterns were developed on a radioanalytical scanner (Packard Instrument, Meriden, CT) and then later by autoradiography.
Estimation of the size of the porcine IGKV2 genome
The number of IGKV2 genes in the porcine genome was estimated by two methods. First, the total density of hybridizing polynucleotides in genomic Southern blots was compared with the density of hybridization of known amounts of the gene in question using standard curves prepared using known amounts of IGKV2 plasmid DNA of defined length. For this calculation, we used the value of 2.67 x 109 bp as the size of the porcine genome (24). Second, four of the eight overlapping BAC clones (see above and Fig. 5B) were analyzed by restriction digestion and Southern blotting using the IGKV2-specific probe described above. Because BAC clone B was most easily recovered from the library using IGKV2 primers and gave the strongest signals in Southern blots (Fig. 5A), all major EcoRI fragments from this clone were cloned, and the
200 IGKV2 clones obtained were sequenced and analyzed as described above. A minimum estimate of the size of the IGKV2 repertoire was made by determining the total number of unique IGKV2 sequences in BAC clone B and in certain fragments from another BAC clone that extended downstream from clone B (Table II, see Fig. 5).
| Results |
|---|
|
|
|---|
genes expressed during fetal life belong to a single family with high sequence similarity to human IGKV2
V
genes and gene segments were defined according to the IMGT system used for the human. Using that system, FR3 ends with C104, and the last seven codons of V
encode the 5' end of CDR3. A dendrogram of 87 V
cDNA sequences (not shown) indicated the presence of four groups. The same pattern is shown in Fig. 1A using consensus nucleotide sequences for representative members of the subgroups shown in Fig. 2. When analyzed in terms of percent sequence similarity, the three subgroups shown in Fig. 1A (V2(A); V2(B); andV2(C)) all shared >80% similarity when analyzed using the GCG Old Distances program (data not shown) and thus were assigned to a single family, although we also retained the AC subfamily designations. Fig. 1B shows that members of this apparent family show
85% sequence similarity with human IGKV2 and with V
1 from sheep. Based on sequence differences and by comparing PileUp dendrograms of FR1, CDR1, FR2, FR3, and the 18 nt contributed by V
to CDR3 (data not shown), we tentatively defined three subgroups of IGKV2 genes in swine, IGKV2(A), -(B), and -(C) (Figs. 1A and 2), all of which share 87% homology to human IGKV2. The sequences not belonging to IGKV2 (Fig. 1A) had 87% sequence similarity to human IGKV1 and somewhat less similarity to those of possum V
1, sequences from the horse, and human IGKV4 (Fig. 1B).
Fig. 2 indicates that >90% of all the expressed V
genes we recovered from fetal piglets belong to the IGKV2 family. No exclusive differences in tissue distribution among IGVK2 subfamilies were observed, but a high proportion (60%) of IGVK2(A) subfamily sequences were recovered from DG40/50 spleens. No major differences in distribution between thymus and BM were observed. Putative porcine IGKV2 genes are labeled V2-1, V2-2, etc. Identical V
sequences (shown as sets 111) are not duplicate clones because they differ in CDR3 and J
. The number of IGKV1 sequences was too low to establish any pattern.
Porcine V
genes have shared and unique sequence motifs
FR1 of all porcine IGKV2 genes have the A-I-V-L motif (Fig. 2), which is only found in one sheep V
sequence and not in V
genes from other species (Fig. 1). The porcine IGKV1 genes begin with the A-I-Q-L/M motif (Fig. 2), which is also unique, although the V to Q change is seen in some sheep sequences. The terminal deduced sequence of FR1 for all porcine IGKV2 genes is S-I-S-C-R-S/A-S, which also characterizes the human IGKV2 family, but no other human family. Both FR1 and FR3 are highly conserved among the three IgGKV2 subgroups and group tightly in PileUp (not shown).
CDR1 of porcine IGKV2 genes matches that of human IGKV2 very well, but is distinct from CDR1 in all other human V
gene families. CDR1 of porcine IGKV2 comprises 11 codons, whereas human IGKV2 genes encode 12. The codon for aspartic acid following the threonine/serine codon is absent in swine (Fig. 2). The porcine V
genes we have classified as IGKV1 have only six codons in CDR1, which is exactly the same as human IGKV1; this trait is shared by all rabbit and horse and some sheep sequences that group together with this family of human V
genes (Fig. 1B). Differences among IGKV2 subgroups are found in the 3' half of CDR1, with the sequence of IGKV2-1 being notably most different by the absence of the most 3' codon.
FR2 is conserved in all families and in all species, similar to what is observed for FR2 in the porcine H chain V region genes (25). IGKV2(B) differs from the other subgroup V
genes, especially because of a Q/L exchange.
The CDR2 region of all porcine V
genes (IGKV1 and IGKV2) comprises seven amino acids and is therefore similar in length to CDR2 in all human IGKV consensus sequences and published sequences for horse, rabbit, and sheep. The gap between CDR2 and FR3 is based on use of the Lefranc system, which allows for the 10-codon CDR2 seen in certain human IGKV2 genes such as V3-15, V3-49, and V3-73. CDR2 in porcine IGKV2 subgroups (B) and (C) are very similar, with only a D/A exchange in their consensus sequences (Fig. 2).
FR3 of the expressed porcine V
genes we describe is also unique, beginning with a G-V-P-S/D motif that is not shared by any human V
family, but is shared by V
sequences from horse and rabbit. The 3' terminus of the V
gene in all species is highly conserved, ending in the T/V-Y-Y-C motif. The T-Y-Y-C motif is found in porcine IGKV1, rabbit, horse, and the human IGKV1 gene family. All other sequences have the V-Y-Y-C motif that characterizes all human and porcine IGKV2 genes. FR3 is nearly identical in all porcine IGKV2 sequences and differs only slightly from FR3 of porcine IGKV1. Thus, FR3 of porcine V
genes might serve as the target for a pan-specific probe similar to the pan-specific FR2 probe we have found useful in studies of H chain V usage (1, 26).
The seven codons of porcine V
that contribute to the 5' portion of CDR3 are variable and are not shared by any particular V
gene in another species. The three IGKV2 porcine subgroups (Fig. 2) have distinct sequences in this region. The Q-Q-N motif is found at the beginning of the CDR3 region of the V
genes of many species, although, surprisingly, it is replaced by M-Q-N in most human IGKV2 genes; this is the family to which >90% of the expressed porcine V
genes have their sequence similarity.
Assignment of V
nomenclature
The human IMGT nomenclature was adopted, so the three subfamilies of IGKV2 were designated (A), (B), and (C) to avoid confusion with IGKV2-1, -2, etc., which in the IMGT system are used for individual genes. The tentative assignment of nomenclature was based on findings of shared differences among variants that differed from the consensus for each subfamily. We also considered that SHM and subsequent selection were more likely to affect the CDR rather than the FR regions. This tentative nomenclature suggests that a minimum of three IGKV-1 genes and 10 IGKV2 genes or alleles are used to form the preimmune V
repertoire of the piglet.
At least six J
segments and one C
occur in the swine genome
Fig. 3 summarizes data on J
sequences recovered from cDNA, overlapping segments of genomic DNA recovered by PCR, and cosmid clones. Fig. 4A aligns the five genomic J
sequences and their recombination signal sequences (RSSs) recovered from swine with those available for various species. All five porcine RSSs identified have 23 nt spacers, all but J
3 have a heptamer terminating in TGTG, and all but J
3 and J
5 have nonamers ending in TTTTTGT. We have designated the porcine J
segments in the cloned genomic DNA segment as J
1
J
5 based on their order in the locus. Because we did not recover any additional J
segments in the region 56 kb upstream of J
1, and the other J
genes are separated by
300 bp, we designated J
1 as most 5' in the porcine J
locus. The genomic location of J
X recovered from the cosmid remains unknown. Otherwise, homology among species with regard to gene order appears to be consistent with current mouse and human genomic maps. Fig. 4B shows a map of the porcine J
/C
region of chromosome 3 and shows that J
5 lies nearly 3 kb upstream from C
.
|
|
2 segment was used in >90% of all preimmune V
J
rearrangements we recovered (Fig. 3). There was no indication of predominant expression in a particular tissue. Approximately one-third of these expressed J
2 segments differ from germline J
2 in the most 5' codon. Presumably this is the result of junctional diversity rather than SHM or J
2 polymorphism.
J
3, which has a noncanonical heptamer (CGCTATG not CACTGTG) and nonamer (ending TAT not TGT), was not expressed. Only four J
4-like transcripts were recovered, and no transcripts containing J
5 were recovered. Both J
4 and J
5 have no noncanonical heptamers and nonamers. J
1 was expressed in six cDNA clones, and J
X was known only from a cosmid clone and one thymic sequence. Using a C
primer (gatgccaagccatccgtcttcatc) and an antisense primer for a conserved region of the 3' enhancer (tgacaaagcagtgtgacggttgc), we recovered only a single C
gene sequence (Fig. 4B).
Estimation of the IGKV2 genomic repertoire in overlapping BAC clones
Fig. 5A shows a Southern blot analysis of four overlapping BAC clones obtained using a 32P-labeled probe determined to be specific for IGKV2 genes when tested against a panel of IGKV1 and IGKV2 clones (data not shown). Fig. 5B shows the length and orientation of eight overlapping BAC clones that were recovered from the BAC library. Although the complete BAC clone names are given in Fig. 5B, the bold abbreviations, e.g., B, F, etc., are routinely used. Because of the nature of the overlap, only four were chosen for restriction analysis, and these are indicated with bold lines (Fig. 5A). BAC clone B produced a very strong recovery signal when cloned from the library, whereas all others gave weak PCR products, suggesting that clone B contained a much larger number of IGKV2 genes. This is consistent with the intensity of Southern blot hybridization (Fig. 5A). Fig. 5A also shows that fragment B4 and perhaps B9 of the EcoRI digest of BAC clone B are also shared by clones C and H, whereas B1 and B12 are shared by weakly hybridizing BAC clone F. Both HindIII and BamHI digests confirm the similarity of clones C and H, an outcome expected based on their orientation (Fig. 5B). Not surprisingly, the restriction maps are characteristic for each of the infrequent cutting endonucleases used. BAC clones bI0408H04, bI0861F0l, bI03178B08, and bU0089B10 (Fig. 5B) were not analyzed because they heavily overlapped with the four clones that were studied (Fig. 5B).
BAC clone B was chosen for more detailed study because, as mentioned, it 1) hybridized most strongly with the IGKV2 probe and 2) was most readily recovered from the library by PCR. Furthermore, clone B occupied a central position among the orientated BAC clones. The six EcoRI fragments that contained IGKV2 genes (B1B12) were cloned, and the partial IGKV2 genes in the resulting clones were sequenced and analyzed. We also cloned partial IGKV2 genes from C7 and C9. Although B9 and C9 appear to be nearly the same size, the IGKV2 genes recovered indicated that they were only partially identical. Table II indicates the number of sequences analyzed and that a minimum of 52 unique IGKV2 genes were recovered by this method. In addition, one IGKV1 gene was recovered from B12, and an unclassified V
gene Y was recovered from B1.
Estimation of the number of V
genes by hybridization of sperm DNA
Fig. 7 gives an estimate of the size of the IGKV2 repertoire by comparing the cumulative density of all V
-containing polynucleotides in the HindIII, EcoRI, and BamHI digests with a standard curve constructed using known amounts of IGKV2 DNA in plasmids containing a single IGKV2 gene. In the case of weakly hybridizing genomic or plasmid DNA, the standard curve was linear, indicating that within the range of densities scanned, scan density was proportional to gene copy number. Using this method and the mathematical scheme described in Fig. 7, we estimated that the porcine genome contains
61 IGKV2 genes (Table V).
|
|
Fig. 2 identified 10 putative IGKV2 genes among the
100 transcripts recovered from the preimmune repertoire. Fig. 1A groups these into subfamilies, and Fig. 6 uses the same criteria for grouping sequences recovered from BAC clones. A comparison of Figs. 1A and 6 shows that only three of the six genomic subfamilies are used in the preimmune repertoire. Thus, the preimmune repertoire is not random with regard to the IGKV2 genetic potential of swine. In addition to genomic IGVK2 subfamilies AF, gene Y was recovered and is a borderline member of the IGKV2 family (Table II and Fig. 6).
Table IV compares the number of identical or very closely related genes recovered from the BAC clones and those expressed in the preimmune repertoire. Because we could in some cases recover numerous variants of certain putative IGKV2 genes, e.g., V2-1, it would suggest that putative IGKV2-1 is not a discrete gene, but, rather, a group of closely related V
2 genes. In contrast, because only a single genomic V2-5 and V2-9 sequence was recovered, the numerous variants expressed in the preimmune repertoire are likely to represent allelic variants or are the result of SHM. The failure to find genomic representatives of certain expressed IGKV2 genes may suggest that they lie outside the boundaries of BAC clone B.
|
| Discussion |
|---|
|
|
|---|
genes were identified in the porcine preimmune repertoire, each with surprisingly high (87%) sequence similarity to human IGKV1 and IGKV2, respectively (Fig. 1B). Each family had a unique leader sequence, and all shared a common A-I motif at the beginning of FR1 (A-I-Q-M for IgGKV1 and A-I-V-L for IgGKV2; Fig. 2). Surprisingly, both families showed their highest similarity to human V
sequences rather than those of other artiodactyls (Fig. 1B). More than 90% of expressed V
genes belonged to the IGVK2 family, and these fit into three subfamilies that we designated (A), (B), and (C) (Figs. 1A and 2). Subfamily differences among these expressed genes were concentrated to CDR1, CDR2, and the region contributing the 5' region of CDR3. IGKV2(A) was preferentially expressed in fetal spleen, whereas only one IGKV2(B) sequence was recovered from fetal spleen. IGKV2(C) was equally expressed in all three fetal tissues examined.
One of the unusual features of fetal and neonatal piglets is the involvement of the thymus in possible B cell lymphogenesis (2, 18) and especially in the presence of switched isotypes, i.e., IgA- and IgG-secreting plasma cells (17, 27). Data presented in this study show no evidence for preferential V
usage by thymic B cells, suggesting they may be immigrants from other lymphoid tissues. However, the preferential usage of the IGKV2(A) subfamily in fetal spleen suggests either selective homing of certain B cells to spleen or perhaps B cell lymphogenesis in spleen. There is some evidence that the spleen of other artiodactyls (cattle and sheep) is involved in B cell lymphogenesis (28, 29, 30), and
:
expression ratios in fetal porcine spleen suggest that some B cell lymphogenesis may also occur in this organ in swine (A. Moravkova, C. Lemke, M. Sinkora, J. E. Butler, unpublished observations). However, the porcine spleen is not macroscopically visible at the time when B cell lymphogenesis is occurring in fetal liver and yolk sac (18), and splenectomy of fetal lambs does not appear to affect B cell development (31).
The J
locus of the swine differs remarkably from that of the porcine JH locus, but parallels the organization of the J
locus in many species (Fig. 4). We identified five J
germline segments
3 kb upstream of C
plus one additional segment in a cosmid library. We ordered the porcine J
segments like those in humans; the location of J
X (derived from a cosmid) remains unknown. It is possible that part of the locus has been duplicated as in humans, and J
X may come from a duplicated region not in the genomic DNA segment we recovered (32, 33). The alignment of the J
segments in the locus agrees with the alignment of J
1 through J
5 seen in human, horse, rabbit, mouse, and rat. Because no additional J
segments were recovered in the region 5.6 kb upstream of J
1, we believe that the most 5' J
recovered is J
1 (Fig. 4). Furthermore, because only one C
gene was recovered in a DNA fragment spanning the region from J
5 to the 3' enhancer, the major
locus we describe has only one C
gene.
Despite the number of J
segments available for swine, J
2 is used in >90% of all V
J
rearrangements recovered from fetal tissue. Both J
5 and J
3 may be pseudogenes based on their noncanonical nonamer and heptamer sequences (Figs. 3 and 4). J
4 may be discriminated against in the fetal rearrangements we studied because of its downstream location and its noncanonical RSS.
In swine, B cell lymphogenesis occurs in three organs: fetal liver, bone marrow, and probably thymus (2). The products from these sites primarily differ in apparent selection for productive V(D)J rearrangement (18). The data presented in this study on V
J
sequences from different porcine tissues show few tissue-specific differences (Figs. 2 and 3). Although we did not examine fetal liver and spleen before 40 days, we know that there is no BM lymphogenesis before DG60, (18). Thus, the splenic V
J
repertoire we report most likely represents the pre-BM repertoire that was generated in fetal liver or fetal splenic anlagen.
The use of only IGKV2 genes and J
2 in >90% of rearrangements coupled with the comparatively small contribution of junctional diversity suggests that the preimmune
repertoire in this species is combinatorially restricted, but perhaps not to the degree as the porcine preimmune VH repertoire (1, 2). However, unlike the porcine VH repertoire (2), junctional diversity in CDR3 of V
J
rearrangements contributes very little diversity. V
gene usage in the preimmune repertoire is not only biased to the IGKV2 family, but to genes of subfamilies AC (Fig. 1A vs Fig. 6). At least for the preimmune repertoire, evidence is weak that diversity of the V
repertoire compensates for the limited VH combinatorial diversity, as may be the case in the rabbit (9). Studies of the porcine V
preimmune repertoire, which accounts for
50% of the L chain repertoire, are ongoing and may provide a different perspective on this issue (J. E. Butler, N. Wertz, and J. Sun, unpublished observations).
The two methods used to estimate the size of the IGKV2 repertoire differed by <15% (Tables II and IV and Fig. 7). The use of comparative scan density to estimate gene copy number relative to a standard is an old procedure that is less precise than sequencing the locus, but does consider all genomic DNA (Fig. 7) (34). Because this method gave a value of the same magnitude as the estimate from BAC cloning, it is unlikely to have greatly overestimated the number of genes as in early mouse/human studies (35). Estimation of the genome size by cloning polynucleotide fragments from cloned genomic DNA (Fig. 5 and Table II) has the advantage of providing genomic sequence data, but also has caveats. First, it depends on recovering the entire locus in YAC, BAC, or cosmid clones, so that clones containing very few genes are likely to be overlooked. The fact that all eight V
-containing BAC clones were overlapping (Fig. 5B) indicates that the porcine V
genes are not randomly scattered in the genome and that we have most likely found the major
locus. Furthermore, the ease of recovery of BAC clone B, its hybridization with the IGKV2 probe (Fig. 5A), and its central location (Fig. 5B) support the idea that it contains most IGVK2 genes. Nevertheless we did not clone V
genes from all four BAC clones analyzed by Southern blots, so some IGKV2 may have been overlooked; the value 52 is certainly an underestimation. A second caveat is that to avoid making antisense primers for each different IGKV2 gene that was expressed (Fig. 2), the primers used did not recover sequence data for the terminal 3' portion of each genomic IGKV2 gene. Whether differences at the 3' terminal portion of expressed IGKV2 genes are due to junctional diversity or somatic mutation will remain unknown until future investigators completely sequence all V
-containing BAC clones. If the 3' differences are genomic, there is reason to argue that the data we present in Table II underestimate the size of the genome. A third caveat is that the number of clones recovered from certain BAC clone B fragments may have been insufficient to identify all unique IGVK2 genes, again leading to an overall underestimation of the size of the genome. Our procedure was to continue cloning and sequencing until finding a new sequence becomes a rare evident. Considering both methods used, the swine probably possesses at least 60 IGKV2 genes.
An advantage of comparing the major portion of gene sequences recovered from genomic fragments allows expressed sequences (Fig. 2) to be compared with the genomic potential (Table IV and Fig. 6). However, such comparisons are not without their own caveats. First, swine are an outbred species, and the only inbred strain is homozygous only for MHC I. Because our data on V
expression comes from six different outbred fetal/neonatal animals, and the source of genomic DNA for J
and V
genes comes from yet another animals, attempts to compare expressed genes with genomic potential is immediately flawed. In defense of the procedure, most initial studies in humans are flawed in the same manner, because swine, like humans, are outbred species. Thus, our failure to find V
X in the genomic fragment used to sequence and align J
1-J
5 (Fig. 4) could result from differences in population genetics. Our failure to find genomic counterparts for V2-2, V2-7, V2-8, and V2-10 (Fig. 2) could mean they are genes that fell outside the boundaries of the region covered by the BAC clones examined (Fig. 5B), that the Large White used to prepare the BAC library lacked these genes, or that their allelic variants were unrecognizable. However, the sequences of V2-2, V2-8, and V2-10 are so unique that they unlikely to be mere allelic variants. The argument that IGKV2 genes recovered from the BAC clones could be mere allelic variants of those expressed in the preimmune repertoire is not supported by the PileUp data in Fig. 6 showing that many, e.g., V2-X groups, fall into subfamilies not expressed in the preimmune repertoire. Table IV also shows that a very large number of V2-5 and V2-9 variants were expressed, although only one genomic variant was found. This could suggest that the many expressed variants of these genes result from somatic mutation. If true, it supports the concept that the porcine preimmune repertoire is combinatorially restricted, but also that the
locus is subjected to a greater degree of SHM than has been seen in the VH locus (1, 2). Table IV also reveals another important observation. Especially IGKV2-1 and -3, which were believed to represent putative IGKV2, had many variants among IGKV2 genes recovered from genomic DNA. Thus, at least IGKV2-1 and IGKV2-3 must represent groups of genes with high sequence similarity.
Our estimation that one swine V
family contains
60 genes is surprising, because originally only 76 V
genes in all seven human families of V
genes were reported (36). However, later studies indicated that only 45 of the human V
genes are potentially functional, and there are 87 defective V
genes (37). Although the smaller proportion of germline IGKV2 genes expressed in the preimmune repertoire could result from selective usage, many of those not expressed could lack leader sequences or be otherwise nonfunctional. Although the overlapping BAC clones appear to span most of the IGKV2 repertoire (Fig. 5B), they have not been mapped, so the actual number of total and functional V
genes remains unknown. The apparent size of the porcine V
locus is noteworthy because the
250-kb region is
10-fold smaller than in mice and humans (20, 36).
It is also surprising from a comparative immunological aspect that the ratio of
:
usage among mature swine B cells resembles that in humans, rather than that in other artiodactyls (3, 10). Perhaps environmental pressures have selected for functionally similar preimmune BCRs in swine and humans. It is of some interest that porcine C
gene sequences are also most similar to those in humans (38), and other isotypes as well share a high level of sequence similarity with their human counterparts (25, 39, 40). Apart from the unique codons used at the beginning of FR1, the porcine V
genes are surprisingly similar in sequence to those from humans (Fig. 1B). A high level of sequence homology also exists between porcine and human MHC (41) as well as in the genomic organization of human and porcine MHC locus (42) and the TCRV
gene groups (43). These findings may suggest that 1) structural similarities are more related to lifestyle and presumably function; and 2) the phylogeny of individual systems may not follow species phylogeny. Despite these similarities with humans, V
family expression in humans favors IGKV3, not IGKV2 as in swine (44). Although our data indicate that diversity exists among mammals with regard to Ig gene usage, our data only concern the preimmune repertoire. Thus, swine exposed to environmental stimuli (Ags) after birth may express other IGKV2 genes or may even shift to IGKV1 expression. Therefore, both ontogenetic and species differences should be considered in any attempt to globalize V region usage by B or T cells.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by National Science Foundation Molecular and Cellular Biology Award 77237. ![]()
2 Address correspondence and reprint requests to Dr. John E. Butler, Department of Microbiology, University of Iowa, Iowa City, IA 52242-1109. E-mail address: john-butler{at}uiowa.edu ![]()
3 Abbreviations used in this paper: BAC, bacterial artificial chromosome; BM, bone marrow; DG, day gestation; FR, framework region; RSS, recombination signal sequence; SHM, somatic hypermutation. ![]()
Received for publication October 9, 2003. Accepted for publication September 9, 2004.
| References |
|---|
|
|
|---|
genes. J. Immunol. 153:1099.[Abstract]
diversification in cattle. J. Immunol. 161:5438.
locus consists of two copies that are organized in opposite polarity. Genomics 16:503.[Medline]
genes. T. Honjo, and F. W. Alt, eds. Immunoglobulin Genes 2nd Ed.173.-191. Academic Press, London.
locus and the germline repertoire of V
genes. Eur. J. Immunol. 31:1017.[Medline]
gene of swine. Mol. Immunol. 31:633.[Medline]
-chain. Immunogenetics 46:461.[Medline]
and J
repertoire of thymocytes and peripheral T-cells. Immunology. In press.
genes and their hypermutation. Eur. J. Immunol. 23:3248.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |