|
|
||||||||



Departments of
*
Immunohematology and Bloodtransfusion,
Ophthalmology, and
Rheumatology, Leiden University Medical Center, Leiden, The Netherlands
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
For optimal tumor-specific CTL immunity, help from CD4+ T cells is required. Previously, it was shown that help for CTL priming is mediated via CD40-CD40 ligand interactions (10, 11), and that "help" provided via CD40 signaling in vivo is a powerful way to install successful treatment of tumor-bearing mice through the induction of potent tumor-specific CTL immunity (12). Triggering of CD40 might lead to activation of APC endowing them with the capacity to activate CTL, as shown by the observation that CD40-matured DC in contrast to immature DC, are able to mount CTL immunity (13). Alternatively, CD40 triggering in vivo might act directly on tumor-specific CTL, as it was recently published that the help provided by CD4+ T cells to achieve CD8+ T cell memory is not routed through the APC, but results from a direct interaction between CD4+ T cells and CD8+ T cells (14).
To gain more insight into the mechanisms underlying CTL priming in tumor-bearing hosts, we took advantage of a well-defined tumor model expressing an Ag derived from the early region 1A of human adenovirus type 5 (Ad5E1A). Eradication of this tumor is CD8-mediated because administration of in vitro activated CD8+ clonal T cells leads to clearance of the tumor (15). Moreover, tolerization of E1A-specific CTL by the E1A-derived CTL peptide epitope resulted in the inability of the mice to eradicate E1A-expressing tumors (16). Also, in this tumor model CD40 ligation in vivo leads to the systemic appearance of E1A-specific CTL that eradicate established tumors. When CD8 cells were depleted, treatment with the agonistic CD40 mAb did not lead to tumor eradication, but tumors continued growing (12).
We now show that tumor Ags are presented to CTL by cross-presentation of Ag by CD11c+ cells. In tumor-bearing animals, tumor specific CTL do arise, but these are not endowed with efficient effector function, appearing only as "poised" CTL in tumor DLNs. In vivo activation of DC by treatment with a DC-activating agent results in gain of effector function of tumor-specific CTL leading to eradication of established tumors. Clearly, the antitumor response elicited by anti-CD40 mAb treatment operates via activation of CD11c+ cells, as anti-CD40 mAb treatment of tumor-bearing CD40-deficient mice harboring CD40-proficient CTL was not successful. Furthermore, for production of an efficient antitumor immune response, the expression of CD40 on CD8+ T cells is not required, as DC activation by CpG1826 treatment led to effective tumor eradication.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were purchased from Charles River Breeding Laboratories (Maastricht, The Netherlands). TAP/ mice and CD40/ mice (both on C57BL/6 background) were purchased from The Jackson Laboratory (Bar Harbor, ME). Strain 42 mice, bred at Netherlands Central Organization for Applied Scientific Research (TNO) Prevention and Health (Leiden, The Netherlands) are TCR transgenic mice expressing the TCR
-chain and
-chain derived from the H-2b-restricted, Ad5E1A234243-specific CTL clone 5 (15, 16). Strain 42*CD40/ mice were also bred at TNO Prevention and Health. Mice were kept at the Leiden University Medical Center animal facility and used at 713 wk of age in accordance with national legislation and under supervision of the animal experimental committee of the University of Leiden.
Tumor cells
Mouse embryo cells transformed by Ad5E1A plus EJ-ras (16) were cultured in IMDM (Invitrogen Life Technologies, Rockville, MD) supplemented with 8% (v/v) FCS, 50 µM 2-ME, glutamine, and penicillin, as described (16).
Tumor experiments
CD40-negative E1A-expressing tumor cells (1 x 107) were injected s.c. into 7- to 13-wk-old male mice in 200 µl of PBS. Tumor size was measured twice weekly with calipers in three dimensions. Treatment was started 2030 days after tumor inoculation, when palpable tumors were present. Mice were sacrificed when tumor size exceeded 1 cm3 to avoid unnecessary suffering.
Treatments
The FGK-45 hybridoma cells producing a stimulatory anti-CD40 Ab were provided by A. Rolink (Basel Institute for Immunology, Basel, Switzerland) (17). Mice received 100 µg of the anti-CD40 mAb given either i.v. (days 0, 1, and 2 of treatment) in 200 µl of PBS or intratumorally (days 0 and 3 of treatment) in 40 µl of PBS. As a control, mice received 100 µg of rat-IgG specific for human CD40 (6E9) (18) in the same volume of PBS. The CpG1826 oligodeoxynucleotides (ODN), which is a 20-mer containing two CpG motifs (TTCATGACGTTCCTGACGTT; the bold nucleotides represent the immunostimulatory CpG sequences) was provided by Coley Pharmaceutical (Langenfeld, Germany) and used at their suggested optimal working concentration of 50 µg/injection, intratumorally in 40 µl of PBS at days 0 and 3 of treatment. MPL (detoxified LPS) was provided by Corixa (Seattle, WA) and used at the suggested optimal concentration of 10 µg/injection, intratumorally in 40 µl of PBS at day 0 and 3 of treatment.
CFSE labeling and adoptive transfer
Single cell suspensions were made from spleen and peripheral lymph nodes of strain 42 mice. Erythrocytes were depleted by ammonium chloride treatment (2 min on ice). Cells were washed once in cold medium and once in cold PBS, after which they were resuspended in PBS at 1 x 107 cells/ml and incubated with 0.5 µM CFSE (Molecular Probes, Eugene, OR) for 30 min at 37°C. FCS was added to a concentration of 5% FCS, and the cells were washed in PBS. TCR transgenic CD8+ T cells (3 x 106) were injected into the tail veins of tumor-bearing mice in 200 µl of PBS.
Flow cytometry
Single cell suspensions of spleens and lymph nodes were prepared by mechanical disruption. Blood samples and cell suspensions of spleens were depleted of erythrocytes by ammonium chloride treatment for 5 min at room temperature. Cells were stained with directly allophycocyanin-conjugated mAb against CD8 (clone 53-6.7; BD Pharmingen, San Diego, CA) combined with PE-conjugated E1A234243-loaded H-2Db tetramers (E1A-TM) or, after CD11c-enrichment, with directly allophycocyanin-conjugated mAb against CD11c (clone HL3; BD Pharmingen) combined with stainings for CD80 (clone 16-10A1; BD Pharmingen), CD86 (clone GL1; BD Pharmingen), CD40 (clone 3/23; BD Pharmingen), I-A/I-E (clone M5/114.15.2; BD Pharmingen), or H-2Kb (clone AF6-88.5; BD Pharmingen). Data acquisition and analysis was done on a BD Biosciences FACScan (San Jose, CA) with CellQuest software.
Intracellular IFN-
staining
Single cell suspensions of lymph nodes were prepared by mechanical disruption. Intracellular staining was performed using BD Cytofix cytoperm kit with BD Golgiplug (BD Pharmingen), according to the manufacturers protocol. During the 6-h incubation with BD Golgiplug, 4.5 µg/ml of the E1A-peptide or a control peptide was added. Stainings were performed with directly allophycocyanin-conjugated mAb against CD8 (clone 53-6.7; BD Pharmingen), PE-conjugated E1A-TM and FITC-labeled IFN-
(clone XMG1.2; BD Pharmingen). Data acquisition and analysis was done on a BD Biosciences FACScan with CellQuest software.
Separation of CD11c+ and CD11c populations
Peripheral lymph nodes of tumor-bearing mice were treated with collagenase (250 U/ml; Sigma-Aldrich, St. Louis, MO) and DNase (50 µg/ml, Sigma-Aldrich) for 30 min at 37°C. CD11c+ cells were positively selected using magnetized Ab for CD11c (N418; Miltenyi Biotec, Bergisch Gladbach, Germany). The cell populations were analyzed by FACS, showing the CD11c+ population circa 90% pure, and >95% of the CD11c population was cleared of CD11c+ cells.
Proliferation assay and IFN-
ELISA
The CD11c+ and CD11c cell populations were incubated at graded doses with 0.1 x 106 spleen cells of TCR transgenic strain 42 mice. E1A-specific proliferation was measured after 3 days. At 8 h before termination, 0.5 µCi of [3H]thymidine per well was added. Supernatant taken after a 20-h incubation was analyzed for IFN-
production by a standard sandwich ELISA.
E1A-PCR
DNA from the tissues was isolated with High Pure PCR Template Preparation kit (Roche, Basel, Switzerland), as recommended by the manufacturer, and was amplified by PCR for 30 cycles using the primers for E1A: 5'-GCAGGAAGGGATTGACTTACTCAC-3' (sense) and 5'-CTCAGGTTCAGACACAGGACCTTT-3' (antisense). PCR products of 467 bp were observed after separation by electrophoresis in a 1% agarose gel.
| Results |
|---|
|
|
|---|
CD8+ CTL-mediated immunity is crucial for eradication of E1A-expressing tumors (12). Cross-priming as well as direct priming have been postulated as a mechanism to induce tumor-protective CTL immunity (5, 6, 7, 19). For priming of CTL in a direct fashion, tumor cells have to migrate to the tumor DLN. To study whether E1A-specific CTL could be primed directly by tumor cells in tumor DLNs or by tumor Ag-presenting professional APC, we analyzed whether tumor cells can be found in the secondary lymphoid organs of tumor-bearing animals. Twenty-five days after s.c. injection of E1A-expressing tumor cells, secondary lymphoid organs were examined. Both PCR amplification of the DNA encoding E1A (Fig. 1A) and selective in vitro outgrowth of tumor cells from lymph node cultures in medium containing G-418 (data not shown) revealed that the tumor cells had migrated to lymph nodes draining the tumor, but not to other lymph nodes or spleen. Subsequently we investigated whether these tumor cells, being able to reach the lymphoid organs, were capable of presenting tumor Ag in vivo. Therefore, we injected E1A-expressing tumor cells into wild-type and TAP/ mice, the APC of the latter being incapable of cross-presenting tumor-derived Ags because of defective MHC class I-loading in a TAP-dependent fashion. When a palpable tumor had developed, CFSE-labeled transgenic, E1A-specific CD8+ T cells were injected. Three days later, division of tumor-specific T cells in different lymphatic organs was analyzed. As shown in Fig. 1B, the tumor Ag is not presented in the DLNs of TAP/ mice, contradicting direct Ag presentation by the tumor cells themselves. In contrast, proliferating E1A-specific CTL were found in tumor DLNs of TAP-competent C57BL/6 mice. Together, these findings indicate that the tumor Ag is presented to the immune system by cells derived from the host, even though tumor cells are detectable in the tumor DLN.
|
These results indicate that the predominant cell responsible for Ag presentation to naive CTL is of host origin. Therefore we wished to determine the identity of this APC because this cell is likely to be responsible for the inadequate immune reactivity in tumor-bearing hosts. To this end, we separated cells from tumor DLNs in a CD11c+ (DC-enriched) and a CD11c (DC-depleted) fraction. The CD11c+ and CD11c populations were incubated directly ex vivo with E1A-specific CD8+ T cells derived from TCR transgenic mice, and proliferation of the CD8+ T cells was determined. As shown in Fig. 2, the population that best stimulated the TCR transgenic T cells was found in the CD11c+ population isolated from the tumor DLNs. These findings indicate that CD11c+ cells, most likely DC, are important for Ag presentation to CTL in otherwise naive tumor-bearing mice. Because E1A+ tumor cells do not express CD11c (data not shown) and the CD11c-negative population of TAP knockout mice did not stimulate TCR transgenic T cells, these findings confirm that Ag presentation is not mediated by tumor cells that have traveled to the DLN.
|
Although tumor Ags are presented to the immune system in vivo, no effective antitumor immune response can be found in most of the tumor-bearing animals. We demonstrate that CD11c+ APC are responsible for tumor Ag presentation. Because activation of these cells is considered crucial for induction of CTL immunity, this observation prompted us to examine the effect of the anti-CD40 agonist on CD11c+ cells in vivo. For this purpose, tumor DLNs of anti-CD40 mAb and untreated C57BL/6 mice bearing an E1A-expressing tumor were analyzed 3 days after the first anti-CD40 injection. In Fig. 3A it is shown that CD11c+ cells isolated from anti-CD40-treated mice had up-regulated their surface expression of CD80, CD86, CD40, MHC class I, and MHC class II in comparison with the CD11c+ cells isolated from untreated tumor-bearing mice. Thus, anti-CD40 treatment led to an activated phenotype of the CD11c+ cells present in tumor DLNs.
|
than T cells incubated with CD11c+ cells isolated out of untreated animals. Negligible IFN-
production by the tumor-specific T cells was seen after incubation with CD11c+ cells loaded with a control peptide (Fig. 3B). Thus, next to their activated phenotype, the CD11c+ cells of anti-CD40 treated animals are also functionally superior for priming tumor-specific T cells.
In untreated tumor-bearing animals, CD8+ T cells that recognize the tumor Ag arise and reside in the tumor DLN. Because it is not known whether these CTL also acquire effector function, we explored the capacity of tumor-specific T cells to produce IFN-
, as one parameter of effector phenotype, after encounter of tumor Ag in untreated and anti-CD40-treated tumor-bearing animals. As shown in Fig. 3C, only a small proportion (17%) of the tumor-specific T cells found in the tumor DLNs of untreated mice produced IFN-
directly ex vivo, whereas after treatment with the anti-CD40 mAb >65% of the tumor-specific T cells produced IFN-
. Hence, as was the case upon peptide loading ex vivo (Fig. 3B), also in vivo the activated CD11c+ APC were better capable of turning naive tumor-specific CD8+ T cells into effector cells.
Other DC-activating agents have similar effects on antitumor immune responses
Treatment of tumor-bearing animals with the anti-CD40 mAb leads to systemic spread of tumor-specific CTL resulting in tumor eradication (12). To analyze whether other professional APC-activating agents can induce similar effects, we treated otherwise naive tumor-bearing mice intratumorally with the TLR4 and TLR9 ligands, MPL, and CpG1826 respectively. These agents are known to activate DC both in vivo and in vitro (20, 21, 22, 23, 24, 25 and data not shown). Like in vivo CD40 triggering, intratumoral treatment with these agents was sufficient for eradication of the E1A-expressing tumors (Fig. 4A). The antitumor effect of CpG1826 could not be explained by a toxic effect of the CpG1826 on the tumor cells themselves, as in CD8-depleted animals the rate of tumor growth was comparable in untreated and CpG1826 treated animals (data not shown). In addition, the activation of host CD11c+ cells was strongly associated with systemic spread of endogenously formed CTL in these mice (Fig. 4B).
|
To analyze whether CD40 expression by CD11c+ cells and/or by CD8+ T cells is required for the induction of effective CTL immunity in tumor-bearing mice after treatment with the anti-CD40 mAb, we adoptively transferred CD40-proficient or CD40-deficient E1A-specific TCR transgenic CD8+ T cells into tumor-bearing CD40/ mice or normal C57BL/6 mice. As shown in Fig. 5, treatment with anti-CD40 mAb led to tumor eradication only in wild-type mice, but not in CD40/ mice, irrespective of CD40 expression by the transfused transgenic T cells.
|
| Discussion |
|---|
|
|
|---|
, when analyzed directly ex vivo. Also, they cannot be detected outside the DLN. We refer to these T cells as "poised" T cells, ready for action, not deleted or anergized, but also not properly activated by DC to migrate and exert peripheral effector function (see also Ref.26). Interestingly, effective, systemic CTL-mediated immunity is induced when CD11c+ cells are activated through CD40. This identifies the DC as the central cell orchestrating the outcome of tumor-specific immunity, determining tolerance or effective antitumor immunity. These findings are in line with recent publications, using DEC205-targeted Ag presentation to CD8+ T cells in immature or mature DC (27), or the effect of inducible expression of a model Ag in DC in vivo (28). When the Ag in these studies was presented by DC under "steady state" conditions, Ag-specific CTL tolerance was readily induced. In contrast, when CD40-activated DC presented the Ag, a powerful CTL response was the result. Our data indicate that similar outcomes of CTL-mediated immunity are seen when the Ag presented by the DC has been acquired exogenously from progressively growing tumors.
The data presented in this study stand in marked contrast to findings made in another tumor model, describing that not host-derived APC, but rather tumor cells themselves are responsible for Ag presentation to naive CTL (5). Although not well understood, several explanations can account for these contrasting observations. For example, the stability of the tumor Ag may play an important role in determining whether a tumor Ag is cross-presented to CTL. In case the Ag is highly unstable, it is likely that a strong flow of antigenic peptides makes it to the endoplasmic reticulum of tumor cells, leading to a high peptide-MHC density on the surface of tumor cells. In this scenario, a much lower amount of protein Ag is available for uptake by DC, keeping the Ag outside the sophisticated mechanisms for efficient cross-presentation (29, 30). In this case, indirect presentation of tumor Ags by DC is inefficient, allowing direct presentation of Ag by tumor cells that display a sufficient high peptide-MHC density on their cell surface. Also, it has been shown that the availability of a CTL epitope for biosynthetic processing or cross-presentation depends on the position of the epitope in the protein (31).
Alternatively, the type of tumor might be important with respect to its ability to directly present to naive T cells. For example, it is feasible that lymphoma cells, due to their chemokine receptor and homing-receptor makeup, can readily enter the T cell zone of DLNs, whereas other types of tumor, although capable of entering the DLN, do not make it into the zone in which priming of naive T cells occurs. The latter notion could explain the lack of CTL activation in TAP-deficient mice as the used E1A-expressing tumor cells are positive for MHC class I expression and are capable of activating naive TCR transgenic cells when analyzed directly ex vivo (data not shown), but apparently not in vivo despite the presence of tumor cells in tumor DLNs. However, these observations can also be explained by the superior efficiency of DC compared with tumor cells to communicate with CTL because semiquantitative analysis showed the presence of a substantial number of tumor cells in tumor DLNs (Fig. 1A).
Our data and those of others (32, 33, 34) show that administration of DC stimulating agents can be a powerful tool to evoke antitumor immunity under conditions of sufficient cross-presentation. It will be important to gain a detailed understanding of the mechanisms that govern tumor Ag presentation in vivo. Chemotherapy with gemcitabine increases cross-presentation leading to growth delay, but not complete eradication of tumors in a model involving mesothelioma transfected with the influenza hemagglutinin gene (35). Combination of gemcitabine with anti-CD40 mAb led to complete cure of these tumors (36). Moreover, not only expression of costimulatory molecules, but also Ag presentation by DC is enhanced after activation of the DC by CpG sequences (37). In addition, a combination of an Ag with CpG sequences was shown to lead to CD11c+ cells that were capable of eliciting protective immunity in naive mice in the absence of further Ag or adjuvant (38). Although we did not study the exact mode of action of treatment with CpG or MPL, it is conceivable that also in our study these agents act through the activation of DC. Together, these findings indicate that DC-activating agents have multiple effects on DC that are all beneficial to their capacity to prime efficient CTL responses.
Recently, it was shown that CD8+ T cells can express CD40 and that this CD40 expression is essential for CD8+ T cell memory formation (14). Our results clearly demonstrate that CD40 expression by host APC, but not by CD8+ CTL precursors is crucial for induction of CTL immunity following CD40 triggering in vivo. The potential of CD8+ T cells to express CD40 is, as such, not sufficient to allow productive CTL activation. Although we observed that, after adoptive transfer of transgenic T cells, the transgenic T cells dominate the response against the specific Ag (data not shown and Ref.39), no CTL immunity could be induced by treatment with the anti-CD40 mAb when CD8+ T cells from CD40-competent donors were transferred into CD40-deficient mice (Fig. 5). DC activation via TLR9 by CpG1826 ODN was sufficient to mount a strong antitumor CTL response, independent of possible CD40 expression on the transfused CD8+ T cells. Moreover, like CD40 signaling, also signaling via TLR4 and TLR9 led to CTL effector function and memory formation as mice rejected the initial tumor and were resistant to a subsequent rechallenge with tumor cells (data not shown). This was also evident in CD40/ mice after tumor eradication in response to treatment with CpG1826 ODN, indicating that, in contrast to previously published data (14), CD40 expression on CD8+ T cells is not necessary for formation of CTL memory (40).
Together these observations strongly indicate that effective CTL activation and memory formation are dependent on proper activation of DC. Provided that human cancers have shed enough protein Ags for cross-presentation by tumor-associated DC, all that may be required for effective tumor immunotherapy might be proper DC activation by suitable DC triggers, such as CD40 agonists and TLR ligands.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by European Community Grant QZK 3-T-1999-00064 and by Dutch Cancer Foundation Grants RUL 99-2025 and RUL 97-1450. R.E.M.T. is funded for research by a fellowship from the Royal Academy of Arts and Sciences. ![]()
2 Address correspondence and reprint requests to Dr. Cornelis J. M. Melief, Department of Immunohematology and Bloodtransfusion, Postal Zone E3-Q, Leiden University Medical Center, Albinusdreef 2, 2333 ZA, Leiden, The Netherlands. E-mail address: C.Melief{at}lumc.nl ![]()
3 Abbreviations used in this paper: DLN, draining lymph node; Ad5E1A, early region 1A of human adenovirus type 5; DC, dendritic cell; NDLN, nondraining lymph node; ODN, oligodeoxynucleotide. ![]()
Received for publication February 5, 2004. Accepted for publication September 21, 2004.
| References |
|---|
|
|
|---|
heavy chain class switching. Immunity 5:319.[Medline]
This article has been cited by other articles:
![]() |
C. Jackaman, S. Cornwall, A. M. Lew, Y. Zhan, B. W. S. Robinson, and D. J. Nelson Local effector failure in mesothelioma is not mediated by CD4+ CD25+ T-regulator cells Eur. Respir. J., July 1, 2009; 34(1): 162 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Sharma, K. G. Elpek, E. S. Yolcu, R.-H. Schabowsky, H. Zhao, L. Bandura-Morgan, and H. Shirwan Costimulation as a Platform for the Development of Vaccines: A Peptide-Based Vaccine Containing a Novel Form of 4-1BB Ligand Eradicates Established Tumors Cancer Res., May 15, 2009; 69(10): 4319 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Norian, P. C. Rodriguez, L. A. O'Mara, J. Zabaleta, A. C. Ochoa, M. Cella, and P. M. Allen Tumor-Infiltrating Regulatory Dendritic Cells Inhibit CD8+ T Cell Function via L-Arginine Metabolism Cancer Res., April 1, 2009; 69(7): 3086 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Gerner and M. F. Mescher Antigen Processing and MHC-II Presentation by Dermal and Tumor-Infiltrating Dendritic Cells J. Immunol., March 1, 2009; 182(5): 2726 - 2737. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Speetjens, P. J.K. Kuppen, M. J.P. Welters, F. Essahsah, A. M. E.G. Voet van den Brink, M. G. K. Lantrua, A. R. P.M. Valentijn, J. Oostendorp, L. M. Fathers, H. W. Nijman, et al. Induction of p53-Specific Immunity by a p53 Synthetic Long Peptide Vaccine in Patients Treated for Metastatic Colorectal Cancer Clin. Cancer Res., February 1, 2009; 15(3): 1086 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, H. S. Noh, J. Chen, J. H. Kim, L. D. Falo Jr., and Z. You Potent Tumor-Specific Protection Ignited by Adoptively Transferred CD4+ T Cells J. Immunol., September 15, 2008; 181(6): 4363 - 4370. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Gerner, K. A. Casey, and M. F. Mescher Defective MHC Class II Presentation by Dendritic Cells Limits CD4 T Cell Help for Antitumor CD8 T Cell Responses J. Immunol., July 1, 2008; 181(1): 155 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Currie, R. G. van der Most, S. A. Broomfield, A. C. Prosser, M. G. Tovey, and B. W. S. Robinson Targeting the Effector Site with IFN-{alpha}{beta}-Inducing TLR Ligands Reactivates Tumor-Resident CD8 T Cell Responses to Eradicate Established Solid Tumors J. Immunol., February 1, 2008; 180(3): 1535 - 1544. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Otahal, B. B. Knowles, S. S. Tevethia, and T. D. Schell Anti-CD40 Conditioning Enhances the TCD8 Response to a Highly Tolerogenic Epitope and Subsequent Immunotherapy of Simian Virus 40 T Antigen-Induced Pancreatic Tumors J. Immunol., November 15, 2007; 179(10): 6686 - 6695. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hubert, N. Jacobs, J.-H. Caberg, J. Boniver, and P. Delvenne The cross-talk between dendritic and regulatory T cells: good or evil? J. Leukoc. Biol., October 1, 2007; 82(4): 781 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E Polak, N. J Borthwick, P. Johnson, J. L Hungerford, B. Higgins, S. Di Palma, M. J Jager, and I. A Cree Presence and phenotype of dendritic cells in uveal melanoma Br J Ophthalmol, July 1, 2007; 91(7): 971 - 976. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. H. Hernandez, L. Shen, and K. L. Rock CD40-CD40 Ligand Interaction between Dendritic Cells and CD8+ T Cells Is Needed to Stimulate Maximal T Cell Responses in the Absence of CD4+ T Cell Help J. Immunol., March 1, 2007; 178(5): 2844 - 2852. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Anderson, K. Shafer-Weaver, N. M. Greenberg, and A. A. Hurwitz Tolerization of Tumor-Specific T Cells Despite Efficient Initial Priming in a Primary Murine Model of Prostate Cancer J. Immunol., February 1, 2007; 178(3): 1268 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Preynat-Seauve, P. Schuler, E. Contassot, F. Beermann, B. Huard, and L. E. French Tumor-Infiltrating Dendritic Cells Are Potent Antigen-Presenting Cells Able to Activate T Cells and Mediate Tumor Rejection J. Immunol., January 1, 2006; 176(1): 61 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Baruah, A. Propato, I. E. Dumitriu, P. Rovere-Querini, V. Russo, R. Fontana, D. Accapezzato, G. Peri, A. Mantovani, V. Barnaba, et al. The pattern recognition receptor PTX3 is recruited at the synapse between dying and dendritic cells, and edits the cross-presentation of self, viral, and tumor antigens Blood, January 1, 2006; 107(1): 151 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, J. Idoyaga, A. Charalambous, S.-i. Fujii, A. Bonito, J. Mordoh, R. Wainstok, X.-F. Bai, Y. Liu, and R. M. Steinman Innate NKT lymphocytes confer superior adaptive immunity via tumor-capturing dendritic cells J. Exp. Med., December 5, 2005; 202(11): 1507 - 1516. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Illidge Anti-CD40: Janus or gatekeeper? Blood, October 15, 2005; 106(8): 2595 - 2596. [Full Text] [PDF] |
||||
![]() |
Z. F. H. M. Boonman, G. J. D. van Mierlo, M. F. Fransen, R. J. W. de Keizer, M. J. Jager, C. J. M. Melief, and R. E. M. Toes Maintenance of Immune Tolerance Depends on Normal Tissue Homeostasis J. Immunol., October 1, 2005; 175(7): 4247 - 4254. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Th. den Boer, G. J.D. van Mierlo, M. F. Fransen, C. J.M. Melief, R. Offringa, and R. E.M. Toes CD4+ T Cells Are Able to Promote Tumor Growth through Inhibition of Tumor-Specific CD8+ T-Cell Responses in Tumor-Bearing Hosts Cancer Res., August 1, 2005; 65(15): 6984 - 6989. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Otahal, S. C. Hutchinson, L. M. Mylin, M. J. Tevethia, S. S. Tevethia, and T. D. Schell Inefficient Cross-Presentation Limits the CD8+ T Cell Response to a Subdominant Tumor Antigen Epitope J. Immunol., July 15, 2005; 175(2): 700 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dumortier, G. J. D. van Mierlo, D. Egan, W. van Ewijk, R. E. M. Toes, R. Offringa, and C. J. M. Melief Antigen Presentation by an Immature Myeloid Dendritic Cell Line Does Not Cause CTL Deletion In Vivo, but Generates CD8+ Central Memory-Like T Cells That Can Be Rescued for Full Effector Function J. Immunol., July 15, 2005; 175(2): 855 - 863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I.E. van Poelgeest, M. van Seters, M. van Beurden, K. M.C. Kwappenberg, C. Heijmans-Antonissen, J. W. Drijfhout, C. J.M. Melief, G. G. Kenter, T. J.M. Helmerhorst, R. Offringa, et al. Detection of Human Papillomavirus (HPV) 16-Specific CD4+ T-cell Immunity in Patients with Persistent HPV16-Induced Vulvar Intraepithelial Neoplasia in Relation to Clinical Impact of Imiquimod Treatment Clin. Cancer Res., July 15, 2005; 11(14): 5273 - 5280. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |