The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X. K.
Right arrow Articles by Gilkeson, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X. K.
Right arrow Articles by Gilkeson, G.
The Journal of Immunology, 2004, 173: 6481-6489.
Copyright © 2004 by The American Association of Immunologists

Decreased Expression of the Ets Family Transcription Factor Fli-1 Markedly Prolongs Survival and Significantly Reduces Renal Disease in MRL/lpr Mice1

Xian K. Zhang2,*, Sarah Gallant*, Ivan Molano*, Omar M. Moussa{dagger}, Phillip Ruiz{ddagger}, Demetri D. Spyropoulos{dagger}, Dennis K. Watson{dagger} and Gary Gilkeson*

* Department of Medicine, Division of Rheumatology and Immunology, Medical Research Service, Ralph H. Johnson Veterans Affairs Medical Center, and {dagger} Department of Pathology and Laboratory Medicine, Medical University of South Carolina, Charleston, SC 29425; and {ddagger} University of Miami School of Medicine, Miami, FL 33136


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased Fli-1 mRNA is present in PBLs from systemic lupus erythematosus patients, and transgenic overexpression of Fli-1 in normal mice leads to a lupus-like disease. We report in this study that MRL/lpr mice, an animal model of systemic lupus erythematosus, have increased splenic expression of Fli-1 protein compared with BALB/c mice. Using mice with targeted gene disruption, we examined the effect of reduced Fli-1 expression on disease development in MRL/lpr mice. Complete knockout of Fli-1 is lethal in utero. Fli-1 protein expression in heterozygous MRL/lpr (Fli-1+/–) mice was reduced by 50% compared with wild-type MRL/lpr (Fli-1+/+) mice. Fli-1+/– MRL/lpr mice had significantly decreased serum levels of total IgG and anti-dsDNA Abs as disease progressed. Fli-1+/– MRL/lpr mice had significantly increased splenic CD8+ and naive T cells compared with Fli-1+/+ MRL/lpr mice. Both in vivo and in vitro production of MCP-1 were significantly decreased in Fli-1+/– MRL/lpr mice. The Fli-1+/– mice had markedly decreased proteinuria and significantly lower pathologic renal scores. At 48 wk of age, survival was significantly increased in the Fli-1+/– MRL/lpr mice, as 100% of Fli-1+/– MRL/lpr mice were alive, in contrast to only 27% of Fli-1+/+ mice. These findings indicate that Fli-1 expression is important in lupus-like disease development, and that modulation of Fli-1 expression profoundly decreases renal disease and improves survival in MRL/lpr mice.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Fli-1 gene is a member of the Ets gene family of transcription factors (1, 2). Members of the Ets gene family are found in genomes of diverse organisms, including Drosophila, Xenopus, sea urchin, chicken, mouse, and human (3, 4, 5). Like all other members of the Ets gene family, Fli-1 has the conserved sequence, the Ets domain. Ets proteins bind to DNA sequences that contain a consensus GGA(A/T) core motif (Ets-binding site) and function as either transcriptional activators or repressors (3, 4, 5). Ets proteins regulate the expression of genes that are critical for the control of cellular proliferation, differentiation, and programmed cell death. Previous studies of Ets transcription factors, including Fli-1, suggest that they play important roles in the regulation of hemopoietic development (3, 5, 6). Studies regarding their role in immune function or dysfunction are limited.

Systemic lupus erythematosus (SLE)3 is an autoimmune disease with a wide spectrum of clinical and immunological abnormalities (7, 8). SLE is characterized by autoantibody production, arthritis, glomerulonephritis, and vasculitis (7, 8). The cause of SLE is unknown, although there appears to be a genetic predisposition coupled with environmental triggers that contribute to the development of the disease (9). We previously demonstrated that overexpression of the Fli-1 gene occurs in PBLs of SLE patients compared with normal healthy controls, and that New Zealand Black/New Zealand White mice, a murine lupus model, have higher Fli-1 mRNA expression in splenic lymphocytes than normal control mice (10). Zhang et al. (11) reported that 2- to 3-fold overexpression of Fli-1 protein in transgenic mice resulted in the development of a lupus-like disease. The phenotype of the Fli-1 transgenic mice included autoantibody production, renal deposition of immune complexes, glomerulonephritis, hypergammaglobulinemia, an increased number of autoreactive T and B lymphocytes, and increased mortality (11). Targeted disruption of the Fli-1 gene resulted in hemorrhage into the neural tube and embryonic death due in part to thrombocytopenia (12). There is also a likely contribution of inadequate vascular formation leading to neural tube hemorrhage (13). Heterozygous (Fli-1+/–) mice develop normally with normal platelet counts and peripheral blood white blood cell differentials. The expression level of Fli-1 protein in Fli-1+/– mice is half of that found in wild-type (Fli-1+/+) mice (12, 13).

MRL/MpJ-Faslpr (MRL/lpr) mice exhibit many clinical manifestations found in human SLE (14). Autoantibodies produced by these mice are similar in spectrum to those seen in human lupus, including anti-dsDNA Abs and anti-Sm Abs (14). MRL/lpr mice develop proliferative glomerulonephritis at an early age (4–5 mo), and renal failure is the presumed primary cause of death in these mice (14). The lymphoproliferation (lpr) phenotype is due to a defect in the fas gene, a key mediator of apoptosis (15, 16). The fas defect alone is sufficient to induce autoantibody production, but is not sufficient to induce renal disease (15, 16). If the lpr gene is bred onto a normal background, the congenic lpr mice produce autoantibodies, but do not develop renal disease. Thus, genes in the MRL background, independent of fas, are necessary for disease development, including renal disease, in MRL/lpr mice (15, 16).

To further investigate the role of the Fli-1 gene in disease development in SLE, we studied the expression of Fli-1 protein in MRL/lpr mice, and found that MRL/lpr mice had higher splenic Fli-1 protein expression than BALB/c mice as early as 10 wk of age. By backcrossing heterozygous Fli-1 (Fli-1+/–) B6 mice to MRL/lpr mice, Fli-1+/– MRL/lpr mice were generated with expression of Fli-1 protein reduced 50%. We report in this study that Fli-1+/– MRL/lpr mice had significantly lower serum autoantibodies, total IgG, serum MCP-1, and proteinuria than Fli-1+/+ MRL/lpr mice. Furthermore, reduction of Fli-1 expression significantly altered spleen cell subsets and reduced pathologic renal disease in MRL/lpr mice. The most profound finding in Fli-1+/– MRL/lpr mice was markedly prolonged survival compared with Fli-1+/+ MRL/lpr mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

MRL/lpr and BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Fli-1+/– B6 mice were backcrossed with MRL/lpr mice to generate two groups of mice, wild-type Fli-1+/+ MRL/lpr and Fli-1+/– MRL/lpr mice. Complete knockout of Fli-1 is lethal in utero. The derivation of the Fli-1 knockout was previously described (12). Congenic MRL/lpr mice were derived after six generations by monitoring their genotype using speed congenic techniques (16, 17, 18, 19). The mice were further backcrossed with MRL/lpr mice for one additional generation. The seventh backcross generation was interbred to generate MRL/lpr Fli-1+/+ and Fli-1+/– mice. For studies of disease progression, there were 9 mice in each group, with 5 females and 4 males. A second group of mice was maintained to assess the impact of Fli-1 expression on survival. There were 15 Fli-1+/+ mice (8 females and 7 males) and 13 Fli-1+/– mice (7 females and 6 males) in the survival groups. Additional groups of Fli-1+/– (n = 20) and Fli-1+/+ (n = 17) MRL/lpr mice were sacrificed at the ages of 12 and 24 wk for flow cytometry analysis or isolating T cells for in vitro stimulation. Mice were examined twice weekly for external disease signs such as skin rash, ear necrosis, and lymph node hyperplasia. All mice were housed under pathogen-free conditions at the animal facility of the Ralph H. Johnson Veterans Affairs Medical Center.

Genotyping of the mice by PCR

For genotyping of the mice, PCR was used to detect fragments of the wild-type Fli-1 and Fli-1+/– allele, as previously reported (12). The primers for PCR were as follows: Fli-1 exon IX/forward primer (positions 1156–1180), GACCAACGGGGAGTTCAAAATGACG; Fli-1 exon IX/reverse primer (positions 1441–1465), GGAGGATGGGTGAGACGGGACAAAG; and Pol II/reverse primer, GGAAGTAGCCGTTATTAGTGGAGAGG. DNA was isolated from tail snips of 4-wk-old mice using a QIAamp tissue kit (Qiagen, Santa Clarita, CA). PCR conditions were 1 cycle at 94°C for 10 min, followed by 35 cycles at 94°C for 1 min, 68°C for 1 min, and 72°C for 1 min. A 309-bp fragment indicates the presence of the wild-type allele, and a 406-bp fragment is amplified from the mutated allele.

Twelve known MRL disease susceptibility loci were genotyped for every generation. They were D4Mit7, D4Mit12, D5mit145, D5mit13, D5Mit24, D7Mit57, D7Mit211, D7Mit39, D10Mit20, D10Mit11, and D17Mit16, as previously reported (16, 17, 18, 19). Fas was genotyped by PCR using the following primers: Fas A (5'-AGGTTACAAAAGGTCACCC3'), Fas B (5'-GATACGAAGATCCTTTCCTGTG-3'), and Fas C (5'-CAAACGCAGTCAAATCTGCTC-3') (20). All mice used for analysis were genotyped as MRL at each of the 12 markers after six generations, including H2, and were lpr/lpr at the Fas locus.

Urine albumin excretion

Mice were placed in metabolic cages for 24-h urine collection every 4 wk, beginning at the age of 13 wk. Antibiotics (ampicillin and gentamicin from Invitrogen Life Technologies (Carlsbad, CA), and chloramphenicol from Sigma-Aldrich (St. Louis, MO)) were added in collection tubes to inhibit bacterial growth. Urinary albumin excretion was determined by ELISA, as previously described (21).

Measurement of autoantibodies

Anti-dsDNA Abs were measured by ELISA, as previously described (21, 22). Briefly, 96-well ELISA plates were coated with 5 µg/ml calf thymus dsDNA (Sigma-Aldrich) in sodium salt citrate buffer at 37°C overnight. To each well 200 µl of 1% BSA were added for blocking. After washing with PBS-T, sera were added in serial dilutions starting at 1/100. HRP-conjugated goat anti-mouse IgG ({gamma}-chain specific) (Sigma-Aldrich) was added after washing with PBS-T. Finally, substrate containing 3,3', 5,5'-tetramethylbenzidine (Sigma-Aldrich) in 0.1 M citrate buffer (pH 4.0) and 0.015% H2O2 was added for color development. OD A380 was measured by a microtiter plate reader (Dynatech Laboratories, McLean, VA).

Measurement of total IgG and subclass concentration

Total IgG, IgM, IgA, IgG1, IgG2a, IgG2b, and IgG3 levels in serum were determined by ELISA using a standard curve of known concentration of the same mouse IgG isotype (22). ELISA plates were coated with 1 µg/ml anti-mouse IgG, IgM, IgA, IgG1, IgG2a, IgG2b, or IgG3, respectively, overnight at 4°C. Sera were added in serial dilution starting at 1/20,000. HRP-conjugated goat anti-mouse IgG was added, followed by 3,3', 5,5'-tetramethylbenzidine for color development. OD at A380 was measured, and concentrations were calculated by comparison with the standard curve.

Flow cytometry analysis

Spleen cells were prepared for flow cytometry by crushing freshly dissected tissues between flat forceps in PBS. Cells were counted and washed with PBS with 1% BSA and 0.05% NaN3 (PBS-BSA). A total of 106 cells was incubated with unlabeled anti-mouse CD16/CD32 for blocking Fc receptors. Next, the cells were incubated with primary FITC or PE-conjugated Abs in PBS-BSA for 30 min at 4°C (BD Pharmingen, San Diego, CA). Cells were washed twice in PBS-BSA, resuspended in 500 µl of PBS-BSA, and analyzed on a flow cytometer (BD Pharmingen). The following mAbs were used to characterize spleen cell subsets: total B cells (B220+, CD3); follicular B cells (B220+, CD21intermediate+, CD23+); marginal zone B cells (B220+, CD21high+, CD23); naive T cells (CD4+ or CD8+, CD62L+, CD44); memory T cells (CD4+ or CD8+, CD62L, CD44+); germinal center B cells (B220+, GL-7+); total T cells (CD3e+); and double negative T cells (CD3+, B220+, CD4, CD8).

Western blot analysis

Immunoblots were performed, as described previously (23). Briefly, mice were sacrificed, spleens were homogenized, and spleen cells were lysed with radioimmunoprecipitation buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1 mM EGTA, 1 mM EDTA, 0.1% SDS, and protease inhibitor mixture). The protein concentration was determined by a bicinchoninic acid protein assay kit (Pierce, Rockford, IL). After SDS-PAGE (30 µg/well), the proteins were electrotransferred onto a polyvinylidene difluoride membrane. The membrane was blocked with 5% milk solution in TBS (50 mM Tris-HCl, pH 8.0, 140 mM NaCl). The membrane was incubated with specific rabbit polyconal Ab against Fli-1 for 1 h at room temperature after washing with TBS containing 0.1% Tween 20 (TBST). The membrane was incubated with goat anti-rabbit IgG conjugated with alkaline phosphatase. Enhanced chemifluorescence substrate was added for detection, and the membrane was scanned using a Storm Image System (Amersham Biosciences, Piscataway, NJ). The membrane was stripped with stripping buffer (Pierce), and reprobed with Ab against {beta}-actin for loading control of equal protein (Abcam, Cambridge, MA). The expression levels were quantified by ImageQuant densitometry software (Amersham Biosciences).

Cytokine/chemokine measures

Sera were collected from the mice at 12 and 18 wk of age for measurement of various cytokines via flow cytometer bead array technique. Kits for Th1/Th2 cytokines and inflammatory cytokines from BD Pharmingen were used, following the manufacturer’s instructions. Concentrations of serum MCP-1 were also determined by ELISA using a kit from R&D Systems (Minneapolis, MN). The assays were performed using the manufacturer’s instructions.

Pathology assessment and Ig, C3 deposition in kidneys

Kidneys were removed when the mice were sacrificed at the age of 24 wk. One kidney was fixed with 10% buffered formalin, embedded in paraffin, and then sectioned. The sections were stained with H&E. The other kidney was frozen immediately in liquid nitrogen. Frozen sections (4 µm each) were stained with fluorescein-conjugated anti-mouse IgG or complement C3. The H&E kidney slides were examined in a blinded fashion and graded for glomerular inflammation, proliferation, crescent formation, and necrosis. Scores from 0 to 3+ (0, none; 1+, mild; 2+, moderate; and 3+, severe) were assigned for each of these features and then added together to yield a final renal pathology score. The scores for crescent formation and necrosis were doubled to reflect the severity of those lesions. The maximum score was 18. Interstitial and tubular changes were also recorded. Vasculitis was judged as either present or absent. Immunofluorescence slides were read blinded and were graded from 0 to 3+ (0, none; 1+, weak staining; 2+, moderate staining; and 3+, strong staining) for fluorescence intensity.

T cell isolation and in vitro stimulation

T cells were isolated from two groups of mice, Fli-1+/– (n = 7) and Fli-1+/+ (n = 4), at the age of 12 wk. The spleen cells were prepared, as previously described (11), and T cells were isolated using the Dynabeads mouse pan T kits from Dynal Biotech (Lake Success, NY), following the manufacturer’s instructions. The T cells were cultured at 4 x 105 cells/ml in RPMI 1640 medium with 10% FBS. PMA (10 ng/ml; Sigma-Aldrich) and ionomycin (100 ng/ml; Sigma-Aldrich) were added to the cultures for T cell activation. The supernatants were collected 5 days after stimulation for measuring cytokine concentration.

Statistics

The unpaired Student’s t test was used to determine significant differences between the two groups. A p < 0.05 was considered to be statistically significant. The Mann-Whitney U test was used when appropriate. Survival significance was determined via analysis of survival curve with Prism software from GraphPad (San Diego, CA)


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased expression of Fli-1 protein in MRL/lprmice

To evaluate the expression level of splenic Fli-1 protein in MRL/lpr mice, we sacrificed groups of three to four MRL/lpr and BALB/c mice at the ages of 10, 15, and 20 wk. The expression level of Fli-1 protein was analyzed by immunoblotting. As seen in Fig. 1A, MRL/lpr mice expressed increased levels of Fli-1 protein in the spleen compared with BALB/c mice at all time points. Equal protein loading in each well was confirmed by reprobing with {beta}-actin Ab.



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 1. A, Expression of Fli-1 protein in spleens of MRL/lpr and BALB/c mice. The mice were sacrificed at 10, 15, and 20 wk of age. Equal amounts of protein extracts from the spleens were loaded in each well and probed by an anti-Fli-1 Ab. Lanes 1 (10 wk), 3 (15 wk), and 5 (20 wk), BALB/c mice; lanes 2 (10 wk), 4 (15 wk), and 6 (20 wk), MRL/lpr mice. Equal protein loading was monitored by reprobing with {beta}-actin Ab. Data are representative of three experiments. B, Expression of Fli-1 protein in splenic cells of Fli-1+/– and Fli-1+/+ MRL/lpr mice. Mice were sacrificed at 10 wk of age. Equal amounts of protein extracts from spleen, T cells, and B cells were loaded in each well and probed by anti-Fli-1 Ab. Lanes 1 (spleen), 3 (T cells), and 5 (B cells), Fli-1+/+ MRL/lpr mice; lanes 2 (spleen), 4 (T cells), and 6 (B cells), Fli-1+/– MRL/lpr mice. Equal protein loading was monitored by reprobing with {beta}-actin Ab. Data are representative of three experiments.

 
Generation and phenotypic assessment of Fli-1+/– MRL/lpr mice

To assess the role of Fli-1 in disease development in MRL/lpr mice, B6 Fli-1+/– mice were backcrossed to MRL/lpr mice for seven generations to produce two groups of mice: Fli-1+/+ and Fli-1+/– MRL/lpr mice. The Fli-1+/– congenic MRL/lpr mice were derived by speed congenic techniques monitoring 12 disease susceptibility loci microsatellites by PCR at each backcross generation, and selecting the mice with the most MRL background (17, 18, 19). The sixth backcross generation of mice was 100% MRL at the 12 disease susceptibility markers. The mice were then further backcrossed with MRL/lpr mice for an additional generation. The seventh backcross generation was interbred (Fli-1+/+ x Fli-1+/–) to generate two groups of mice, Fli-1+/+ and Fli-1+/– MRL/lpr mice. Fli-1 expression level in spleen, including both T and B cells, from Fli-1+/– MRL/lpr mice was reduced to about one-half compared with wild-type MRL/lpr mice (Fig. 1B). The number of offspring of each genotype was as predicted by Mendellian genetics (i.e., ~50% heterozygotes and 50% wild type). Two groups of these mice, MRL/lpr Fli-1+/– (n = 9) and MRL/lpr Fli-1+/+ (n = 9), were assessed for disease development.

All mice were examined at least twice per week for development of skin rash, ear necrosis, and lymphadenopathy. These were all graded as present or absent and recorded. At 16 wk of age, mice in both groups started to develop an excoriated skin rash, lymphadenopathy, and ear necrosis. There were no significant differences between the groups in the presence, time frame of development, or severity of these external signs of disease (data not shown). We also did not detect a significant difference between male and female mice, regardless of Fli-1 genotype, for external physical features or any of the parameters examined below. For this reason, data from male and female mice were combined for all results. Complete blood counts were performed at 24 wk before sacrifice. There were no significant differences between groups in peripheral blood white cell count, hemoglobin, or platelet count. At the time of sacrifice at 24 wk, there was no significant difference in spleen weight or cell number between the groups (data not shown).

Autoantibodies in Fli-1+/– MRL/lpr mice were significantly decreased

Autoantibodies including those to dsDNA play an important role in disease development in MRL/lpr mice. We collected sera from Fli-1+/+ and Fli-1+/– MRL/lpr mice at 14, 18, 22, and 24 wk of age, and measured anti-dsDNA and anti-glomerular Ag (GA) Ab levels. At the age of 14 wk, there was no significant difference in serum anti-dsDNA Abs of Fli-1+/– and Fli-1+/+ MRL/lpr mice. However, significantly lower anti-dsDNA autoantibodies were detected in the serum of Fli-1+/– MRL/lpr mice at the ages of 18, 22, and 24 wk, compared with Fli-1+/+ MRL/lpr mice (Fig. 2). Binding by the two groups in the anti-GA assay paralleled the anti-dsDNA assay with significant differences in serum anti-GA levels at 18, 22, and 24 wk (data not shown).



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 2. ELISA measures of anti-dsDNA production by MRL/lpr mice. Data presented are the mean OD 380 ± SE at a 1/100 dilution in each group (seven to nine mice). A, Sera were tested from mice at ages 14, 18, 22, and 24 wk. B, Titrations of sera at 24 wk are shown. p < 0.05, Fli-1+/– mice vs wild-type mice.

 
Fli-1+/– MRL/lpr mice have lower total serum IgG

One of the characteristics of disease in MRL/lpr mice is polyclonal B cell activation and hypergammaglobulinemia. To determine whether reduction of Fli-1 expression affected serum Ig concentrations in MRL/lpr mice, we measured serum total IgG, IgM, IgA, IgG1, IgG2a, IgG2b, and IgG3 in both Fli-1+/– and Fli-1+/+ MRL/lpr mice at different ages. As shown in Fig. 3, the concentrations of serum total IgG in Fli-1+/– MRL/lpr mice were reduced 40–60% at the ages of 18, 22, and 24 wk compared with Fli-1+/+ MRL/lpr mice. Similar to total IgG, concentrations of all IgG isotypes (IgG1, IgG2a, IgG2b, and IgG3), as well as IgA and IgM, were 40–50% lower in Fli-1+/– MRL/lpr mice at 18, 22, and 24 wk of age compared with Fli-1+/+ MRL/lpr mice (data not shown). There was no apparent skewing of IgG isotype in the serum of the Fli-1+/– mice.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of serum levels of total IgG between MRL/lpr Fli-1+/– and Fli-1+/+ mice. Data presented are the mean serum IgG concentrations ± SE (mg/ml) of seven to nine mice in each group at the time points indicated.

 
Proteinuria is significantly decreased in Fli-1+/– MRL/lpr mice

To assess the effect of Fli-1 on renal disease, we collected urine from Fli-1+/+ and Fli-1+/– MRL/lpr mice at the ages of 15, 19, and 23 wk. Minimal albuminuria was present in the urine collected from Fli-1+/– MRL/lpr mice at 15, 19, and 23 wk of age (0.02 mg/mouse/day, 0.3 mg/mouse/day, 0.3 mg/mouse/day, respectively) (Fig. 4). In contrast, albuminuria was observed in Fli-1+/+ MRL/lpr mice at 15, 19, and 23 wk of age, with significantly higher albuminuria in Fli-1+/+ MRL/lpr mice (1.1 mg/mouse/day, 4.3 mg/mouse/day, 5.6 mg/mouse/day, respectively) compared with Fli-1+/– MRL/lpr mice (p < 0.01; Fig. 4). These results indicate a significant impact of Fli-1 expression on renal disease in MRL/lpr mice.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 4. Proteinuria in MRL/lpr mice. Twenty-four-hour urine was collected at the ages of 15, 19, and 23 wk from Fli-1+/– MRL/lpr (n = 9) and Fli-1+/+ MRL/lpr mice (n = 7–9). Urinary protein levels were measured by albumin ELISA and represented as mg/mouse/day. *, Indicates p < 0.05 (by Mann-Whitney two-tailed U test).

 
Renal pathology in Fli-1+/– MRL/lprmice is reduced

We next assessed mice from the Fli-1+/– and Fli-1+/+ groups for proliferative renal disease at 24 wk of age. Two Fli-1+/+ MRL/lpr mice died early (one at 19, and another at 22 wk). As shown in Table I, MRL/lpr Fli-1+/– mice had significantly reduced renal pathology scores compared with MRL/lpr Fli-1+/+ mice (p < 0.05). In the kidney sections, Fli-1+/– MRL/lpr mice had mild glomerular proliferation and inflammation, and epithelial reactivity, whereas Fli-1+/+ mice had significantly more glomerular proliferation and renal inflammation with cellular crescents and necrosis (Fig. 5). In the interstitial regions, Fli-1+/– MRL/lpr mice had significantly less infiltration of inflammatory cells. Neither group had significant tubular changes or evidence of fibrosis. Three of nine Fli-1+/– MRL/lpr mice had medium vessel vasculitis in the kidney compared with three of seven Fli-1+/+ MRL/lpr mice, suggesting Fli-1 had minimal effect on development of renal vasculitis in MRL/lpr mice.


View this table:
[in this window]
[in a new window]
 
Table I. Comparison of renal pathology in Fli-1+/– and Fli-1+/+ MRL/lpr micea

 


View larger version (88K):
[in this window]
[in a new window]
 
FIGURE 5. Comparison of renal pathology from Fli-1+/– and Fli-1+/+ MRL/lpr mice. The mice were sacrificed at the age of 24 wk, and kidneys were stained by the H&E method. A, A representative kidney section from a Fli-1+/+ MRL/lpr mouse with glomerular proliferation, infiltration of inflammatory cells, crescents, and necrosis. B, A representative kidney from a Fli-1+/– MRL/lpr mouse with minimal proliferation and inflammation.

 
The deposition of IgG and C3 in glomeruli was analyzed by immunofluorescence staining. Frozen sections of kidneys from the two groups of mice were stained with fluorescein-conjugated anti-mouse IgG or C3. Although there was a trend toward less IgG and C3 deposition in the glomeruli of Fli-1+/– mice compared with Fli-1+/+ mice, the difference was not statistically significant (Table I). We also assessed pathology changes in the lungs of both Fli-1+/– and Fli-1+/+ MRL/lpr mice at the age of 24 wk. All mice had minimal or mild perivascular, peribronchial, and interstitial accumulations of lymphocytes. There was no statistically significant difference between the two groups.

Flow cytometry analysis of splenocytes

To study whether reduction of Fli-1 protein expression differentially affects T and B cell subpopulations as a mechanism of disease modulation, spleen cells from both groups were prepared for flow cytometry when six of each type were sacrificed at 12 wk of age. As shown in Table II, Fli-1+/– MRL/lpr mice trended to have higher total T cells (54.3% in Fli-1+/– vs 38.3% in Fli-1+/+) and lower total B cells (15.4% in Fli-1+/– vs 27.6% in Fli-1+/+), but these differences were not statistically significant. There were significantly higher percentages of naive T cells (CD62L+CD44) and CD8+ T cells in the spleens of Fli-1+/– MRL/lpr mice compared with Fli-1+/+ MRL/lpr mice (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. Flow cytometry analysis of spleen cells from Fli-1+/– and Fli-1+/+ MRL/lpr mice at 12 and 24 wk of agea

 
At 24 wk of age, Fli-1+/– MRL/lpr mice still had a significantly greater percentage of naive T cells, but the number of CD8+ T cells was similar in the two groups (Table II). Of note, at neither time point were there significant differences in the number of plasma cells or CD4+ T cells.

Cytokine/chemokine measures

IFN-{gamma} is known to play a key role in MRL/lpr disease (24). To assess whether decreased Fli-1 expression affected cytokine production as a mechanism for renal protection in Fli-1+/– mice, we determined serum levels of a number of cytokines early in disease (12 wk of age) and when disease was active (18 wk). As shown in Table III, there was a trend toward lower TNF-{alpha} levels in Fli-1+/– MRL/lpr mice at 12 and 18 wk of age compared with Fli-1+/+ MRL/lpr mice. Serum IFN-{gamma} levels were lower in the Fli-1+/– MRL/lpr mice at 12 wk of age, but not at 18 wk. Neither serum TNF-{alpha} or IFN-{gamma} was significantly different between the two groups, despite the trends noted.


View this table:
[in this window]
[in a new window]
 
Table III. Serum cytokine levels in Fli-1+/– and Fli-1+/+ MRL/lpr micea

 
One of the major differences in the renal pathology between the groups was the significantly decreased inflammatory infiltrate in the Fli-1+/– MRL/lpr mice. MCP-1 is a known modulator of renal inflammation and renal macrophage infiltration in MRL/lpr nephritis (25, 26). We therefore measured serum MCP-1 levels in the two groups. As shown in Table IV, serum MCP-1 levels were significantly lower in the Fli-1+/– MRL/lpr mice at the ages of 12, 18, and 24 wk compared with Fli-1+/+ MRL/lpr mice. Decreased chemokine production, such as MCP-1, provides at least in part a mechanistic explanation for the decreased inflammatory infiltrate in the Fli-1+/– mice.


View this table:
[in this window]
[in a new window]
 
Table IV. Comparison of serum MCP-1 levels in Fli-1+/– and Fli-1+/+ MRL/lpr micea

 
T cells from Fli-1+/– MRL/lpr mice produce significantly less MCP-1 in vitro

Next, we isolated the T cells from spleens of 12-wk-old Fli-1+/– and Fli-1+/+ MRL/lpr mice. T cells were cultured in vitro, and PMA and ionomycin were added for activation. The supernatants were collected 5 days after activation. As shown in Fig. 6, T cells from Fli-1+/– MRL/lpr mice produced significantly less MCP-1 after stimulation than T cells from Fli-1+/+ mice. The effect on cytokine production was not global, as IL-2 levels in the supernatants from Fli-1+/– and Fli-1+/+ MRL/lpr T cells were similar.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. Comparison of in vitro MCP-1 and IL-2 production in T cells from Fli-1+/– and Fli-1+/+ MRL/lpr mice. T cells were isolated from the spleens of Fli-1+/– MRL/lpr mice (n = 7) or Fli-1+/+ MRL/lpr (n = 5) mice, and stimulated with PMA (10 ng/ml) and ionomycin (100 ng/ml). The supernatants were collected after 5 days. MCP-1 (A) and IL-2 (B) levels were measured by the cytometry bead array method. *, p < 0.05.

 
MRL/lpr Fli-1+/– mice survive significantly longer than wild-type mice

A separate group of 13 Fli-1+/– and 15 Fli-1+/+ mice was followed without manipulation to assess whether reducing Fli-1 levels impacted survival in MRL/lpr mice. Results shown in Fig. 7 demonstrate survival was dramatically prolonged in Fli-1+/– mice compared with Fli-1+/+ mice. Fli-1+/+ MRL/lpr mice began dying at 17 wk of age, as expected for wild-type MRL/lpr mice (14, 21, 22, 25). By 48 wk of age, 11 of 15 MRL/lpr Fli-1+/+ mice had died. In contrast, all 13 Fli-1+/– mice survived to the age of 48 wk (27% vs 100% survival, respectively; p < 0.00001; Fig. 7).



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 7. Fli-1+/– MRL/lpr mice survived significantly longer than Fli-1+/+ MRL/lpr mice. All Fli-1+/– MRL/lpr mice (n = 13) survived to the age of 48 wk compared with only 27% (4 of 15) of Fli-1+/+ MRL/lpr mice (n = 15). The difference in survival between the two groups was significant at p < 0.00001.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our results indicate a critical role for the Ets family transcription factor Fli-1 in lupus-like disease in MRL/lpr mice. The first evidence presented in this study for a role for Fli-1 in murine lupus was the finding of enhanced expression of Fli-1 protein in the spleens of MRL/lpr compared with BALB/c mice. A previous report from our group found increased Fli-1 mRNA expression in spleens of New Zealand Black/New Zealand White mice, another murine model of lupus, indicating enhanced Fli-1 expression in two separate mouse models of lupus (10). To determine whether Fli-1 overexpression played a role in disease in MRL/lpr mice, we normalized the expression of Fli-1 in MRL/lpr mice by backcrossing Fli-1+/– B6 mice to MRL/lpr mice for seven generations to generate congenic Fli-1+/– MRL/lpr mice. As expected, MRL/lpr Fli-1+/– mice had reduced splenic expression of Fli-1 protein compared with wild-type MRL/lpr mice. Phenotypic effects of reduced Fli-1 expression were evident as the Fli-1+/– MRL/lpr mice had significantly decreased total serum IgG, serum anti-dsDNA Abs, proliferative glomerulonephritis, renal inflammation, and proteinuria. CD8+ T cells and naive (CD62L+CD44) T cells were significantly increased in the spleens of Fli-1+/– mice compared with wild-type mice at the age of 12 wk. Serum MCP-1 levels, a key mediator of the influx of inflammatory cells into the kidney in MRL/lpr mice, were significantly decreased at the ages of 12, 18, and 24 wk (25, 26). The most notable difference between the Fli-1+/– and Fli-1+/+ groups, however, was the markedly enhanced survival in the MRL/lpr Fli-1+/– group.

The protective effect demonstrated in these studies of heterozygous Fli-1 mice provides a contrast to studies of B6 transgenic mice that overexpress Fli-1 and develop a lupus-like disease (11). Thus, Fli-1 expression is increased in lupus mice; enhancing its expression in normal mice causes a lupus-like disease, and down-modulating its expression has protective effects on disease in MRL/lpr mice. Our results suggest that Fli-1 impacts disease via multiple mechanisms, including decreasing autoantibody production, altering T cell subsets, and decreasing chemokine production. The overall result of these multiple mechanistic effects is a profound improvement on renal disease and survival in MRL/lpr mice.

In defining the role of Fli-1 in lupus-like disease, we believe the effects on autoantibody production, T cell subsets, and MCP-1 production are most relevant to the decreased disease expression in the Fli-1+/– mice. We propose that the primary effect of Fli-1 on serum autoantibody levels is through its effects on B cell activation. Indeed, all Ig isotypes measured, including IgM, IgA, IgG1, IgG2a, IgG2b, and IgG3, were significantly lower in the serum of Fli-1+/– MRL/lpr mice at the ages of 18 and 24 wk compared with littermate Fli-1+/+ MRL/lpr mice (data not shown). The decreased levels of total serum IgG paralleled the decreased serum autoantibodies in these mice. Serum anti-GA Abs were also lower in the Fli-1+/– mice, suggesting a global effect on Ab production rather than an isolated effect on one autoantibody specificity. Thus, we believe the decreased total serum IgG production is the proximate mechanism for the decreased serum anti-dsDNA Ab levels in the heterozygous mice. Similarly, in the Fli-1-overexpressing transgenic mice, polyclonal B cell activation was a prominent part of their disease (11). In the Fli-1 transgenic mice, the B cells were more responsive to mitogen stimulation and were longer lived than B cells from nontransgenic mice (11). Fli-1 is expressed in mature B cells, although the effects of its expression on normal B cell function are not clear (11). Fli-1 has been implicated in Ig-{alpha} transcription by interaction with Pax-5 (27). Its role in transcription of other Ig genes is unknown at present.

The MRL/lpr Fli-1 heterozygote knockout mice had significant alterations in splenic T cell subsets also possibly impacting autoantibody production. We studied splenic T cell subsets at 12 wk of age before the onset of overt clinical disease and at 18 wk when disease was active, but not endstage. The 12-wk time point was selected because we believed studying the mice early in disease would allow us to differentiate direct effects of Fli-1 from secondary effects via Fli-1 protection against lupus-like disease. Data on spleen cell subsets at the 18-wk time point are undoubtedly affected by both disease progression and Fli-1 expression, but provide insight into the overall impact of Fli-1 effects in disease. We found increased numbers of CD8+ T cells and naive (CD62+CD44) T cells in the spleens of the heterozygote knockout mice compared with wild-type mice at 12 wk of age. The increased number of naive T cells suggests there is less T cell activation in the Fli-1+/– mice. This contrasts with the T cell hyperreactivity in the transgenic mice overexpressing Fli-1 (11). The increased numbers of naive T cells are maintained at 18 wk of age, although the difference in CD8+ T cells is not. Whether the alterations in splenic T cell subsets play a role in the modulation of disease seen in the Fli-1+/– mice is unclear at present. There were no significant differences in splenic B cell subsets detected, despite the marked effect on serum total IgG and autoantibody production.

The impact of Fli-1 expression on renal disease was profound. Despite the presence of immune complex deposition in the kidneys of Fli-1+/– MRL/lpr mice, no Fli-1+/– MRL/lpr mice ever had proteinuria greater than 1 mg/mouse/day, and all had significantly less renal disease than their wild-type littermates. The most notable pathologic differences between the groups were decreased mesangial proliferation and interstitial inflammatory infiltrate. These findings suggest that the renal protective effect of Fli-1 heterozygosity may not solely represent a decrease in immune complex deposition, but a dampened proliferative/inflammatory response of the Fli-1+/– MRL/lpr kidney to immune injury. It is also conceivable that the renal effect of Fli-1 heterozygosity is primarily on the macrophages and neutrophils by limiting their migration toward inflammatory sites. In studies of the chronology of renal disease development in MRL/lpr mice, infiltration of inflammatory cells occurs before glomerular proliferative changes (14). Thus, limiting the inflammatory infiltrate via effects on the migratory response of macrophages and neutrophils would secondarily prevent glomerular proliferative changes (28).

We predicted that we would observe a decrease in systemic IFN-{gamma} production in the Fli-1+/– mice due to the known critical role of this cytokine in disease in MRL/lpr mice (24, 29, 30). At 12 wk of age, there was a trend toward lower serum IFN-{gamma} levels in the Fli-1+/– MRL/lpr mice. This trend, however, was not present at 18 wk. TNF-{alpha} is an inflammatory mediator also known to affect renal disease in lupus mice (31). There was a trend toward lower serum TNF-{alpha} levels in the Fli-1+/– MRL/lpr mice at both 12 and 18 wk, but not significantly different from Fli-1+/+ MRL/lpr mice at either time point. One limitation of these cytokine analyses is the use of serum; systemic cytokine measures may not reflect local phenomena in the kidney. Chemokines play an important role in inflammatory responses by recruiting inflammatory cells to the site of injury. MCP-1 is an important mediator of disease in MRL/lpr mice specifically affecting the influx of macrophages into the kidney (25, 26). MRL/lpr MCP-1 knockout mice develop less severe disease and have improved survival compared with wild-type mice (25). Serum MCP-1 levels were significantly lower in Fli-1+/– MRL/lpr mice compared with Fli-1+/+ MRL/lpr mice. We believe that there are three potential Ets binding sites in the promoter of MCP-1; it is possible that modulation of Fli-1 expression affects MCP-1 transcription through direct effects on the MCP-1 promoter. Alternatively, decreased Fli-1 expression may influence MCP-1 through more indirect means via an effect on an intermediate factor that regulates MCP-1 expression. We are actively investigating the mechanisms of Fli-1 affecting MCP-1. We do not believe that the effects on MCP-1 expression alone are sufficient to account for the profound effects of Fli-1 heterozygosity. In the MCP-1 MRL/lpr knockout mice, although disease was diminished, the overall impact on renal disease and survival was not as profound as in the Fli-1+/– MRL/lpr mice (25).

The effects of Fli-1 expression on MRL/lpr disease were significant, but not all lupus disease parameters were influenced by reduction of Fli-1 levels. There was, for example, no significant difference in skin rash, ear necrosis, lymphadenopathy, or splenomegaly between Fli-1+/– and Fli-1+/+ MRL/lpr mice. Previous studies by Nose et al. (32) demonstrated that the vasculitic component of disease in MRL/lpr mice can be pathogenetically disassociated from the glomerular disease. As vasculitis was not affected by Fli-1 expression level, we believe that the pathogenetic pathways leading to proliferative glomerulonephritis and vasculitis are separable and differentially affected by Fli-1. We previously reported an opposite clinical effect in MRL/lpr inducible NO synthase knockout mice in which the inducible NO synthase-deficient mice developed renal disease, but did not develop vasculitis (33).

Splenomegaly and lymphadenopathy were not significantly affected by Fli-1 expression. The lpr (Fas) mutation plays a key role in the development of lymphadenopathy and splenomegaly in MRL/lpr mice (15, 16). Fli-1 transgenic overexpression in B6 mice led to increased splenomegaly that correlated with the degree of Fli-1 overexpression (11). The mechanism for splenomegaly in Fli-1 transgenic mice may be through the known effect of Fli-1 in up-regulating Bcl-2 expression (34). We have not as yet measured Bcl-2 expression, apoptosis, or lymphocyte survival to determine whether these were affected in the Fli-1+/– mice. Our results suggest, however, that any effect of decreasing Fli-1 expression in MRL/lpr mice has on lymphocyte survival and accumulation is insufficient to overcome the lymphoproliferation induced by the lpr/Fas defect.

A concern in any knockout study is whether the phenotype observed is due to the knockout of the targeted gene or due to genes linked to the knockout gene that are carried along in the breeding process. We do not believe that this is a concern in the Fli-1+/– mice as the Fli-1 gene is not located in any of the disease susceptibility loci identified for MRL/lpr mice (17, 18, 19). We believe it is most likely the overexpression of Fli-1 in lupus mice, and in patients with the disease is in response to another stimulatory factor. Understanding of the transcriptional control of Fli-1 expression is incomplete, especially in immune cells (4, 5). Hodge et al. (35) recently reported that IL-6 induces expression of the Fli-1 gene via STAT3. MRL/lpr mice are known to overproduce IL-6 as part of their disease (31). Thus, one potential mechanism for increased Fli-1 expression in MRL/lpr mice is a response to increased IL-6.

In translating these findings to humans, Fli-1 mRNA expression in PBLs from SLE is increased compared with health controls (10). Elf-1, another Ets family transcription factor, was reported to impact TCR {zeta}-chain expression in SLE (36, 37). Further studies in humans are needed to investigate a link between Fli-1 expression and human lupus.

The most profound finding in the Fli-1+/– mice was their prolonged survival. The primary cause for mortality in MRL/lpr mice is believed to be renal failure (14). Thus, the significantly decreased pathologic renal disease in the Fli-1+/– mice most likely explains the prolonged survival of the Fli-1 heterozygote mice. Interstitial pulmonary disease is also believed to contribute to mortality in MRL/lpr mice (14). Interstitial pulmonary disease, however, was equally prevalent and severe at 24 wk of age in both Fli-1+/+ and Fli-1+/– MRL/lpr mice (data not shown). When the Fli-1+/– mice were sacrificed at 1 year of age, pathologic examination of their lungs again revealed interstitial pulmonary disease similar in severity to the limited number of wild-type mice alive at that age (data not shown). It does not appear that Fli-1 affected lung disease in MRL/lpr mice, and, thus, we believe the major effect on survival of Fli-1 heterozygosity was via the decreased severity of renal disease.

In summary, decreased expression of Fli-1 in MRL/lpr mice affects multiple pathologic features of lupus-like disease. MRL/lpr Fli-1+/– mice had lower serum autoantibodies, less proteinuria, decreased renal disease, and prolonged survival. These results indicate that the Fli-1 transcription factor plays an important role in disease development and mortality in MRL/lpr mice. Understanding the mechanisms for the effects of Fli-1 on disease will most likely provide novel insight into the pathogenesis of lupus, and perhaps provide new targets for therapy.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by the Medical Research Service at the Ralph H. Johnson Veterans Affairs Medical Center and National Institutes of Health Grants AR47451 and PO1CA78582. Back

2 Address correspondence and reprint requests to Dr. Xian K. Zhang, Department of Medicine, Division of Rheumatology and Immunology, Medical University of South Carolina, 96 Jonathan Lucas Street, P.O. Box 250623, Charleston, SC 29425. E-mail address: zhangjo{at}musc.edu Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; GA, glomerular Ag; lpr, lymphoproliferation. Back

Received for publication May 7, 2004. Accepted for publication September 15, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Watson, D. K., F. E. Smyth, D. M. Thompson, J. Q. Cheng, J. R. Testa, T. S. Papas, A. Seth. 1992. The ERGB/Fli-1 gene: isolation and characterization of a new member of the family of human ETS transcription factors. Cell Growth Differ. 3:705.[Abstract]
  2. Ben-David, Y., E. B. Giddens, K. Letwin, A. Berstein. 1991. Erythroleukemia induction by Friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev. 5:908.[Abstract/Free Full Text]
  3. Seth, A., R. Ascione, R. S. Fisher, G. J. Mavrothalassitis, N. K. Bhat, T. S. Papas. 1992. The ets gene family. Cell Growth Differ. 3:327.[Medline]
  4. Karim, F. D., L. D. Urness, C. S. Thummel, M. J. Klemsz, S. R. McKercher, A. Celada, C. Van Beveren, R. A. Maki, C. V. Gunther, J. A. Nye, et al 1990. The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev. 4:1451.[Free Full Text]
  5. Papas, T. S., N. K. Bhat, D. D. Spyropoulos, A. E. Mjaatvedt, J. Vournakis, A. Seth, D. K. Watson. 1997. Functional relationships among ETS gene family members. Leukemia 11:557.
  6. Athanasiou, M., P. A. Clausen, G. J. Mavrothalassitis, X. K. Zhang, D. K. Waston, D. G. Blair. 1996. Increased expression of ETS-related transcriptional factor FLI-1/ERGB correlates with and can induce the megakaryocytic phenotype. Cell Growth Differ. 7:1525.[Abstract]
  7. Mills, J. A.. 1994. Systemic lupus erythematosus. N. Engl. J. Med. 330:1871.[Free Full Text]
  8. Mok, C. C., C. S. Lau. 2003. Pathogenesis of systemic lupus erythematosus. J. Clin. Pathol. 56:481.[Abstract/Free Full Text]
  9. Cooper, G. S., M. A. Dooley, E. L. Treadwell, E. W. St. Clair, C. G. Parks, G. S. Gilkeson. 1998. Hormonal, environmental, and infectious disease risk factors for the development of systemic lupus erythematosus. Arthritis Rheum. 41:1714.[Medline]
  10. Georgiou, P., I. G. Maroulakou, J. E. Green, P. Dantis, V. Romano-Spica, S. Kottaridis, J. A. Lautenberger, D. K. Watson, T. S. Papas, P. J. Fischinger, N. K. Bhat. 1996. Expression of ets family of genes in systemic lupus erythematosus and Sjogren’s syndrome. Int. J. Oncol. 9:9.
  11. Zhang, L., A. Eddy, Y. T. Teng, M. Fritzler, M. F. Kluppel, A. Melet, A. Berstein. 1995. An immunological renal disease in transgenic mice that overexpress Fli-1, a member of the ets family of transcription factor genes. Mol. Cell. Biol. 15:6961.[Abstract]
  12. Spyropoulos, D. D., P. N. Pharr, K. R. Lavenburg, P. Jackers, T. S. Papas, M. Ogawa, D. K. Watson. 2000. Hemorrhage, impaired hematopoiesis, and lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription factor. Mol. Cell. Biol. 20:5643.[Abstract/Free Full Text]
  13. Hart, A., F. Melet, P. Grossfeld, K. Chien, C. Jones, A. Tunnacliffe, R. Favier, A. Bernstein. 2000. Fli-1 is required for murine vascular and megakaryocytic development and is hemizygously deleted in patients with thrombocytopenia. Immunity 13:167.[Medline]
  14. Theofilopoulos, A. N., F. J. Dixon. 1985. Murine models of systemic lupus erythematosus. Adv. Immunol. 37:269.[Medline]
  15. Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314.[Medline]
  16. Waston, M. L., J. K. Rao, G. S. Gilkeson, P. Ruiz, E. M. Eicher, D. S. Pisetsky, A. Matsuzawa, J. M. Rochelle, M. F. Seldin. 1992. Genetic analysis of MRL-lpr mice: relationship of the Fas apoptosis gene to disease manifestations and renal disease-modifying loci. J. Exp. Med. 176:1645.[Abstract/Free Full Text]
  17. Vidal, S., D. H. Kono, A. N. Theofilopoulos. 1998. Loci predisposing to autoimmunity in MRL-fas and C57BL/6 mice. J. Clin. Invest. 101:696.[Medline]
  18. Gu, L., A. Weinreb, X. P. Wang, D. J. Zack, J. H. Qiao, R. Weisbart, A. J. Lusis. 1998. Genetic determinants of autoimmune disease and coronary vasculitis in the MRL/lpr/lpr mouse model of systemic lupus erythematosus. J. Immunol. 161:6999.[Abstract/Free Full Text]
  19. Wakeland, E. K., K. Liu, R. R. Graham, T. W. Behrens. 2001. Delineating the genetic basis of systemic lupus erythematosus. Immunity 15:397.[Medline]
  20. Molano, I. D., S. Redmond, H. Sekine, X. K. Zhang, C. Reilly, F. Hutchison, P. Ruiz, G. S. Gilkeson. 2003. Effect of genetic deficiency of terminal deoxynucleotidyl transferase on autoantibody production and renal disease in MRL/lpr mice. Clin. Immunol. 107:186.[Medline]
  21. Watanabe, H., G. Carnier, A. Circolo, R. A. Wetsel, P. Ruiz, V. M. Holders, S. A. Boackle, H. R. Colten, G. S. Gilkeson. 2000. Modulation of renal disease in MRL/lpr mice genetically deficient in the alternative complement pathway factor B. J. Immunol. 164:786.[Abstract/Free Full Text]
  22. Sekine, H., C. M. Reilly, I. Molano, G. Garnier, A. Circolo, P. Ruiz, V. M. Holders, S. A. Boackle, G. S. Gilkeson. 2001. Complement component C3 is not required for full expression of immune complex glomerulonephritis in MRL. lpr mice. J. Immunol. 166:6444.[Abstract/Free Full Text]
  23. Zhang, X. K., T. S. Papas, N. K. Bhat, D. K. Watson. 1995. Generation and characterization of monoclonal antibodies against the ERGB/Fli-1 transcription factor. Hybridoma 14:563.[Medline]
  24. Schwarting, A., T. Wada, K. Kinoshita, G. Tesch, V. R. Kelley. 1998. IFN-{gamma} receptor signaling is essential for the initiation, acceleration, and destruction of autoimmune kidney disease in MRL-Fas(lpr) mice. J. Immunol. 161:494.[Abstract/Free Full Text]
  25. Tesch, G. H., A. Schwarting, K. Kinoshita, H. Y. Lan, B. J. Rollins, V. R. Kelley. 1999. Monocyte chemoattractant protein-1 promotes macrophage-mediated tubular injury, but not glomerular injury, in nephrotoxic serum nephritis. J. Clin. Invest. 103:73.[Medline]
  26. Tesch, G. H., S. Maifert, A. Schwarting, B. J. Rollins, V. R. Kelley. 1999. Monocyte chemoattractant protein 1-dependent leukocytic infiltrates are responsible for autoimmune disease in MRL-Fas(lpr) mice. J. Exp. Med. 190:1813.[Abstract/Free Full Text]
  27. Maier, H., R. Ostraat, S. Parenti, D. Fitzsimmons, L. J. Abraham, C. W. Garvie, J. Hagman. 2003. Requirements for selective recruitment of Ets proteins and activation of mb-1/Ig-{alpha} gene transcription by Pax-5 (BSAP). Nucleic Acids Res. 31:5483.[Abstract/Free Full Text]
  28. Xie, C., X. J. Zhou, X. Liu, C. Mohan. 2003. Enhanced susceptibility to end-organ disease in the lupus-facilitating NZW mouse strain. Arthritis Rheum. 48:1080.[Medline]
  29. Peng, S. L., J. Moslehi, J. Craft. 1997. Roles of interferon-{gamma} and interleukin-4 in murine lupus. J. Clin. Invest. 99:1936.[Medline]
  30. Lawson, B. R., G. J. Prud’homme, Y. Chang, H. A. Gardner, J. Kuan, D. H. Kono, A. N. Theofilopoulos. 2000. Treatment of murine lupus with cDNA encoding IFN-{gamma}R/Fc. J. Clin. Invest. 106:207.[Medline]
  31. Theofilopoulos, A. N., B. R. Lawson. 1999. Tumor necrosis factor and other cytokines in murine lupus. Ann. Rheum. Dis. 58:(Suppl. 1):I49.
  32. Nose, M., M. Nishihara, J. Kamogawa, M. Terada, S. Nakatsuru. 2000. Genetic basis of autoimmune disease in MRL/lpr mice: dissection of the complex pathological manifestations and their susceptibility loci. Rev. Immunogenet. 2:154.[Medline]
  33. Gilkeson, G. S., J. S. Mudgett, M. F. Seldin, P. Ruiz, A. A. Alexander, M. A. Misukonis, D. S. Pisetsky, J. B. Weinberg. 1997. Clinical and serologic manifestations of autoimmune disease in MRL-lpr/lpr mice lacking nitric oxide synthase type 2. J. Exp. Med. 186:365.[Abstract/Free Full Text]
  34. Pereira, R., C. T. Quang, I. Lesault, H. Dolznig, H. Beug, J. Ghysdael. 1999. FlI-1 inhibits differentiation and induces proliferation of primary erythroblasts. Oncogene 18:1597.[Medline]
  35. Hodge, D. R., D. Li, S. M. Qi, W. L. Farrar. 2002. IL-6 induces expression of the Fli-1 proto-oncogene via STAT3. Biochem. Biophys. Res. Commun. 292:287.[Medline]
  36. Juang, Y. T., K. Tenbrock, M. P. Nambiar, M. F. Gourley, G. C. Tsokos. 2002. Defective production of functional 98-kDa form of Elf-1 is responsible for the decreased expression of TCR {zeta}-chain in patients with systemic lupus erythematosus. J. Immunol. 169:6048.[Abstract/Free Full Text]
  37. Tsokos, G. C., M. P. Nambiar, Y.-T. Juang. 2003. Activation of the Ets transcription factor Elf-1 requires phosphorylation and glycosylation: defective expression of activated Elf-1 is involved in the decreased TCR {zeta} chain gene expression in patients with systemic lupus erythematosus. Ann. NY Acad. Sci. 987:240.[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Elkareh, S. M. Periyasamy, A. Shidyak, S. Vetteth, J. Schroeder, V. Raju, I. M. Hariri, N. El-Okdi, S. Gupta, L. Fedorova, et al.
Marinobufagenin induces increases in procollagen expression in a process involving protein kinase C and Fli-1: implications for uremic cardiomyopathy
Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1219 - F1226.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. K. Zhang, O. Moussa, A. LaRue, S. Bradshaw, I. Molano, D. D. Spyropoulos, G. S. Gilkeson, and D. K. Watson
The Transcription Factor Fli-1 Modulates Marginal Zone and Follicular B Cell Development in Mice
J. Immunol., August 1, 2008; 181(3): 1644 - 1654.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
X. K. Zhang and D. K. Watson
The FLI-1 Transcription Factor Is a Short-Lived Phosphoprotein in T Cells
J. Biochem., March 1, 2005; 137(3): 297 - 302.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X. K.
Right arrow Articles by Gilkeson, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X. K.
Right arrow Articles by Gilkeson, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS