The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krotkova, A.
Right arrow Articles by Eichmann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krotkova, A.
Right arrow Articles by Eichmann, K.
The Journal of Immunology, 2004, 173: 25-32.
Copyright © 2004 by The American Association of Immunologists

Delayed and Restricted Expression Limits Putative Instructional Opportunities of V{gamma}1.1/V{gamma}2 {gamma}{delta} TCR in {alpha}{beta}/{gamma}{delta} Lineage Choice in the Thymus

Anna Krotkova, Emma Smith, Gabi Nerz, Ingrid Falk and Klaus Eichmann1

Max-Planck-Institut für Immunbiologie, Freiburg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Development of {alpha}{beta} and {gamma}{delta} T cells depends on productive rearrangement of the appropriate TCR genes and their subsequent expression as proteins. TCR{beta} and TCR{gamma}{delta} proteins first appear in DN3 and DN4 thymocytes, respectively. So far, it is not clear whether this is due to a delayed expression of TCR{gamma}{delta} proteins or to a more rapid progression to DN4 of thymocytes expressing TCR{gamma}{delta}. The answer to this question bears on the distinction between instructive and stochastic models of {alpha}{beta}/{gamma}{delta} lineage decision. To study this question, we first monitored initial TCR protein expression in wild-type and TCR transgenic mice in reaggregate thymic organ cultures. A TCR{beta} transgene was expressed in nearly all DN3 and DN4 cells, accelerated DN3 to DN4 transition, and strongly diminished the number of cells that express TCR{gamma}{delta} proteins. In contrast, TCR{gamma}{delta} transgenes were expressed only in a fraction of DN4 cells, did not accelerate DN3 to DN4 transition, and did not reduce the number of DN4 cells expressing TCR{beta} proteins. The TCR{beta} transgene partially inhibited endogenous TCR{gamma} rearrangements, whereas the TCR{gamma}{delta} transgenes did not inhibit endogenous TCR{beta} rearrangements. Second, we analyzed frequencies of productive TCR{beta} and TCR{gamma}{delta} V(D)J junctions in DN3 and DN4 subsets. Most importantly, frequencies of productive TCR{gamma}{delta} rearrangements (V{delta}5, V{gamma}1.1, and V{gamma}2) appeared unselected in DN3. The results suggest a late and restricted expression of the corresponding {gamma}{delta}TCR, severely limiting their putative instructional opportunities in {alpha}{beta}/{gamma}{delta} divergence.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Based on two classes of specific TCRs, T lymphocytes are divided into two major populations, {alpha}{beta} and {gamma}{delta} T cells. The specificity of both types of TCRs is determined by the rearrangement of V(D)J gene segments during T cell ontogeny. Flexibility in this process can endow the TCRs with pronounced diversity. Due to the process of random rearrangements two of three V(D)J recombinations lead to "out-of-frame" products, since they disrupt the reading frame starting at the ATG initiation codon of the V gene segment. The remaining V(D)J junctions produced in this manner (33%) are "in-frame" and can potentially encode functional TCR proteins.

Both {alpha}{beta} and {gamma}{delta} lineages develop within the thymus and arise from a common progenitor population. Early stages of thymocyte maturation occur in the CD3-negative, CD4/CD8-double negative (DN)2 population and have been defined by surface phenotype, TCR gene rearrangement status, and developmental potential. DN thymocytes are subdivided into four populations based on the expression of CD25/CD44 surface markers: DN1 (CD44+/CD25), DN2 (CD44+/CD25+), DN3 (CD44/CD25+), DN4 (CD44/CD25) (1). TCR rearrangements start at the DN2 stage with TCR{delta} and TCR{gamma} genes followed by TCR{beta} (2, 3). Most rearrangements at all three loci take place and are completed at the DN3 stage (2, 3). Thereafter, pathways of {alpha}{beta} and {gamma}{delta} development are quite distinct. In {alpha}{beta} T cells the TCR{beta} protein combines with the pre-TCR{alpha} chain (pT{alpha}) to form the pre-TCR (4, 5) that stimulates proliferation and maturation to the CD4/CD8 double positive (DP) stage where TCR{alpha} rearrangement occurs (6), mature {alpha}{beta}TCR are synthesized and their repertoire is selected depending on MHC/peptide interactions (7). T cells with {gamma}{delta}TCR develop in two waves using different V{gamma} genes, the first restricted to the fetus (V{gamma}3 and V{gamma}4) and the second beginning prenatally and continuing into adulthood (V{gamma}2, V{gamma}5, V{gamma}1.1, and V{gamma}1.2; nomenclature for TCR{gamma} genes as in Ref. 8). Most {gamma}{delta} T cells rarely express CD4 or CD8{alpha}{beta} coreceptors (9), have no requirement for classical MHC molecules for Ag recognition (10), do not depend on pT{alpha} expression for maturation (4), and proliferate less than {alpha}{beta} T cells (11).

The developmental stage of {alpha}{beta}/{gamma}{delta} lineage separation is unknown and the mechanisms that govern {alpha}{beta} vs {gamma}{delta} lineage decision in T cell development are still poorly understood. It is clear that successful development of both types of T cells depends on productive rearrangements of the relevant TCR genes that have to be in-frame and without stop codons in their V(D)J junction. However, it is still not known whether the TCRs play a key role in instructing lineage commitment or merely support the development of precursors already committed in other ways. According to instructive models, initial expression of the TCR{gamma}{delta} or the pre-TCR per se is sufficient to direct bipotent precursor cells to become {gamma}{delta} or {alpha}{beta} T cells, respectively. In contrast, stochastic models postulate that {alpha}{beta}/{gamma}{delta} cell fate is predetermined independently of TCR rearrangements.

Intracellular TCR{beta} proteins are first detected in DN3 cells, whereas intracellular TCR{gamma} and -{delta} proteins are first detected in DN4 cells (11, 12). Given that TCR{delta} and -{gamma} genes commence rearrangement before TCR{beta} (2, 3), it seems unexpected that their expression should be programmed in such a way that TCR{gamma}{delta} genes get expressed after TCR{beta} genes. Alternatively, DN3 cells that happen to express a {gamma}{delta}TCR may rapidly down-regulate CD25, whereas DN3 cells that express a pre-TCR down-regulate CD25 with some delay. In this paper, we attempt to distinguish between such alternative mechanisms. On the one hand, we analyzed the expression of clonotypic TCR proteins in DN3/DN4 subsets of TCR transgenic (tg) mice in which all precursor thymocytes possess either a productive TCR{beta} gene, or a pair of productive TCR{gamma}{delta} genes, or both. Previous studies on various TCR tg mice (reviewed in Ref. 13) have so far not addressed the initial phase of expression of TCR proteins. We used reaggregate thymic organ cultures (RTOCs) to study newly arising TCR{beta} vs TCR{gamma}{delta} expressing thymocytes. This system allows us to monitor a single wave of differentiation together with the differential proliferation of individual subsets. As a second approach we investigated the selection status of rearranged TCR{beta} and TCR{gamma}{delta} genes in DN3 and DN4 subsets. As a reference for nonselected populations, TCR{delta} and CD3{zeta} x p56lck knockout (KO) mice were included in these analyses. Taken together, our results obtained in RTOC and by V(D)J junction sequencing suggest a late and restricted expression of V{gamma}2 and V{gamma}1.1 resulting in limited instructional opportunities of the corresponding {gamma}{delta} TCR in {alpha}{beta}/{gamma}{delta} divergence.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6 (B6) mice, BALB/c mice, TCR{delta}-deficient mice (14), mice carrying P14 TCR{beta} transgene (15, 16), and double-transgenic mice for P14 TCR{beta} and V{gamma}1.1V{delta}6 TCR{gamma}{delta} were bred in the specific pathogen-free animal facilities of the Max Planck Institute (Freiburg, Germany). TCR{gamma}{delta} transgenic mice (V{gamma}1.1V{delta}6) were kindly provided by Dr. P. Pereira, (Pasteur Institute, Paris, France;17). Mice double-deficient for p56lck and CD3{zeta} were described previously (18). Breedings of the TCR{gamma}{delta} and TCR{beta} transgenic mice were monitored by DNA-PCR analysis using primers described in original papers (15, 16, 17, 18). All mice were sacrificed at 4- to 6-wk of age.

Antibodies

The following mAbs, unlabeled or labeled with either FITC, PE, APC, or biotin, were purchased from BD PharMingen (San Diego, CA): anti-CD4 (H129.19), anti-CD8 (53-6.7), anti-TCR{beta} (H57-597), anti-CD44 (IM7), anti-CD25 (M1/70), anti-NK1.1 (PK136), anti-Ly9.1 (30C7), anti-Thy1.2 (53-2.1), anti-TCRV{gamma}2 (UC3-10A6), anti-TCR{delta} (GL-3), and anti-CD3{epsilon} (145-2C11). The hybridoma secreting the Ab specific for TCR V{gamma}1 (2.11) was kindly provided by Dr. P. Pereira, (Paris, France; Ref. 19). Anti-TCRV{gamma}1 (2.11) mAb was purified and labeled with FITC in our own laboratory. Streptavidin-Red670 was used for biotin-labeled mAb.

Flow cytometry and thymocyte isolation

Thymic lobes were harvested from mice, teased, and ground into single-cell suspensions. DN cells were enriched by Automax (Miltenyi Biotec, Bonn, Germany) depletion of DP thymocytes. DN3 thymocytes positive and negative for intracellular TCR{beta} protein were sorted by negative gating of enriched DN cells for CD4, CD8, CD44, CD3, and NK1.1 (all PE), combined with intracellular staining for TCR{beta} (APC) and surface staining for CD25 (FITC). To obtain DN4 cells, thymocytes were negatively gated for CD4, CD8, CD44, CD25, CD3, and NK1.1 (all PE) and separated into four subpopulations using intracellular staining for TCR{gamma}{delta} (pooled anti-TCRV{gamma}2, anti TCRV{gamma}1.1, anti-TCR{delta} all FITC) and TCR{beta} (APC). Thymocytes were sorted on a MoFlow Instrument (DakoCytomation, Freiburg, Germany). Nonspecific binding of mAbs to FcRs was reduced by preincubation with supernatant of anti-FcR mAb 2.4G2 before the staining for 20 min. For surface staining, cells were incubated with saturating amounts of directly conjugated mAbs for 20 min, washed twice, and incubated, when necessary, with streptavidin-Red670. Intracellular staining was done on cells fixed with paraformaldehyde and permeabilized with saponin (Sigma-Aldrich, Heidelberg, Germany) as described (20, 21). Controls for cell surface staining used isotype-matched mAbs labeled with the same fluorochrome; controls for intracellular stainings used blocking with an excess of the same unlabeled mAb. Three- and four-color analyses used a FACSCalibur using CellQuest software (BD Biosciences, Mountain View, CA).

RTOC

RTOC were performed according to Anderson et al. (22) as previously described (12). Stroma cells from day 15 BALB/c embryos (5 x 105) were reaggregated with a similar number of sorted DN3 thymocytes from adult B6 wild-type (WT) or genetically modified mice. Labeling of sorted DN3 cells with CFSE (Molecular Probes, Eugene, OR) was performed as described (12, 23). Analyses used staining protocols as described above and negative gating for Ly9.1, to exclude BALB/c-derived thymocytes.

PCR, cloning, and sequencing of TCR VDJ junctions

DNA was prepared from the sorted populations by the proteinase K-phenol/chloroform method and recovered by ethanol precipitation. DNA was amplified in final volume of 25 ml containing PCR buffer (1 x), 0.5 mM each primer, 200 mM each dNTP (Pharmacia, Freiburg, Germany), and 0.2 U Supertaq (HT Biotechnology, Cambridge, U.K.). Each of the 35 cycles consisted of 20 s at 94°C, 30 s at 55°C (for all TCR{gamma}{delta} primer pairs), and then 45 s at 72°C. PCR was performed using a Peltier Thermal Cycler (MJ Research, Cambridge, MA). TCRV{beta}8DJ{beta}7 and TCRV{beta}5DJ{beta}7 junctions were amplified using primers and conditions described in (24, 25, 26). The sequence of the oligonucleotides used as primers for PCR amplification of {gamma}{delta} junctions are as follows: V{gamma}1.1 (ACACAGCTATACATTGGTACCGGC), V{gamma}2 (AGAGTTTCTATTATATGTCCT TGC), J{gamma}1 (TACTATGAGCTTAGTTCCTTCTGC), J{gamma}4 (TACTACGAGCTTTGTCCCTTTGGC), V{delta}5 (GGTCAGTGTCTGGGATGCAGACGC), J{delta}1 (CACAGTCACTTGGGTTCCTTGTCC) (nomenclature for TCR{delta} genes as in Ref. 27).

PCR products from amplification of TCRV{beta}8DJ{beta}7 and TCRV{beta}5DJ{beta}7 junctions were subjected to gel electrophoresis in Tris-acetate-EDTA buffer and bands corresponding to TCRV{beta}8DJ{beta}1 and TCRV{beta}5DJ{beta}1 were purified using the Qiagen gel extraction kit (Qiagen, Hilden, Germany). PCR products from amplification of TCRV{gamma}J{gamma} and TCRV{delta}DJ{delta} junctions were purified using the Qiagen PCR purification kit (Qiagen). All PCR products were cloned into the PCR-XL-TOPO vector (Invitrogen, San Diego, CA) and subjected to automated DNA sequencing using an ABI 310 Genetic Analyser (PerkinElmer, Wellesley, MA). Groups of identical sequences were counted as single sequences. SDs of the percentages of productive junctions were determined using the following equations: variance2 = 1/N x p x (1 – p); variance x 1.96 = SD. Where N is the total number of sequences analyzed, p is the proportion of productive rearrangements, and 1 – p is the proportion of nonproductive rearrangements.

Analysis of TCR{beta} and TCR{gamma} gene rearrangements by semiquantitative PCR

Total genomic DNA was isolated from DN3 cells of B6, TCR{beta}, and TCR{gamma}{delta} transgenic mice, and from TCR{beta}+ and TCR{beta} subsets of B6 DN3 cells, as described above. DNA was amplified using the same PCR conditions as for sequencing. Primers were V{beta}8DJ{beta}2 (24, 25, 26), V{gamma}1.1J{gamma}4, and V{gamma}2J{gamma}1 (listed above). DNA concentrations were determined photometrically and then adjusted according to the strength of the signals for the insulin gene that displays as two PCR products using previously described primers (18). After adjustment, PCRs were performed in serial DNA concentrations (60, 40, and 20 ng). PCR products were subjected to gel electrophoresis in Tris-acetate-EDTA buffer with 1.6% agarose and visualized by staining with ethidium bromide as described (26).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Possible mechanisms to account for the sequential detection of TCR{beta} and TCR{gamma}{delta} proteins in DN3 and DN4 cells, respectively

We could envisage three different models to account for the sequential detection of clonotypic TCR proteins in thymic development. In model A, DN3 cells are already precommitted for either the {alpha}{beta} or {gamma}{delta} lineages, and {gamma}{delta}-committed cells down-regulate CD25 more rapidly than cells committed to the {alpha}{beta} lineage. Model B assumes that DN3 cells are still uncommitted. DN3 cells with productively rearranged TCR{gamma}{delta} genes express the corresponding {gamma}{delta}TCR and immediately shut down CD25. In contrast, DN3 cells with a productive TCR{beta} rearrangement express the pre-TCR and down-regulate CD25 with some delay. Both models, therefore, allow expression of TCR{gamma}{delta} proteins to take place before, or simultaneously with, the pre-TCR. Model C assumes that TCR gene expression is programmed in such a way that TCR{beta} genes are expressed before and TCR{gamma}{delta} genes are expressed after down-regulation of CD25. Only in model C is there a true delay between TCR{gamma}{delta} gene rearrangements and expression. Models A–C make different predictions with respect to the proportions and kinetics of appearance of DN3/DN4 cells that express clonotypic TCR proteins in WT and TCR tg mice, and with respect to the selection of productive TCR V(D)J genes before and after TCR protein expression.

Analysis of thymocyte development from the DN3 stage onwards using RTOCs

The kinetics of emergence of thymocytes that express TCR{beta}/{gamma}{delta} proteins is best analyzed in a single wave of differentiation and proliferation in vitro, thus avoiding the dynamic complexities of the steady state as well as possible competitive effects in vivo. We have previously shown that purified DN3 cells develop in RTOC into four subsets of DN4 cells that intracellulary express only TCR{beta} protein ({beta}+/{gamma}{delta}, both TCR{gamma} and {delta} proteins ({beta}/{gamma}{delta}+), all three clonotypic TCR proteins ({beta}+/{gamma}{delta}+), or none of the three ({beta}/{gamma}{delta}) (12). The DN4 subsets generated in RTOC are essentially similar to that seen in vivo (11, 12). To determine the number of cell divisions in this system, DN3 thymocytes were labeled with CSFE, placed into RTOC at day 0, and analyzed daily until day 6 as shown in Fig. 1. DN4 cells as well as the first DP cells were generated by day 2. DN3 cells have disappeared and most DN4 cells have progressed into the DP population by day 6. CSFE patterns suggest that cells leave the DN3 stage after 0–3 (days 2 and 3) or 0–4 (days 4–6) divisions. Cells exit the DN4 stage after a minimum of 1 (day 2) and a maximum of 6 cell divisions (days 4–6). Thus, the DN4 stage in our RTOC system lasts for 1–3 cell divisions. To reach the DP stage from DN3, cells undergo between 1 and 2 (day 2) and 6 and 7 (day 6) divisions.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 1. Proliferation of thymocytes developing from DN3 cells in RTOC. DN3 cells of B6 mice were sorted, labeled with CSFE, and placed into RTOC, as described in Materials and Methods. After the indicated number of days, cultures were harvested and analyzed as indicated in the figure. Gating strategies were as described in Materials and Methods. Events above the vertical bars in the CSFE histograms indicate cells that have not divided. Numbers of cell divisions are indicated.

 
To analyze the proliferative history of the four different DN4 subsets, gates were set on cells with defined numbers of cell divisions and then analyzed for cells expressing the different clonotypic TCR proteins. Results obtained on days 4 (not shown) and 6 (Fig. 2) of RTOCs were essentially the same. To better visualize the {beta}+/{gamma}{delta}+ and {beta}/{gamma}{delta}+ populations, the data of a TCR{gamma}{delta} tg mouse are shown as WT mice yielded qualitatively very similar results. DN4 cells with 0–1 divisions were predominantly TCR protein-negative ({beta}/{gamma}{delta}), cells with 2–4 divisions mainly expressed TCR{gamma}{delta}, and cells with 5 and more divisions predominantly expressed TCR{beta}. Interestingly, the proliferative profile of {beta}+/{gamma}{delta}+ DN4 cells resembled that of {beta}/{gamma}{delta}+ cells more than that of {beta}+/{gamma}{delta} cells. The results suggest that, during DN3 to DN4 maturation, {beta}+/{gamma}{delta} cells divided about twice as often as {beta}/{gamma}{delta}+ and {beta}+/{gamma}{delta}+ cells. However, there was a broad overlap among the four subsets all of which were found across the entire range of cell divisions.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Proliferation of DN4 cell subsets derived from DN3 cells in RTOC and defined by TCR protein expression. DN3 cells of TCR{gamma}{delta} tg mice were sorted, labeled with CSFE, and placed into RTOC, as described in Fig. 1. On day 6, cultures were harvested and analyzed by 4-color flow cytometry using a pool of mAb to CD4, CD8, CD44, CD25, and NK1.1, for negative gating and intracellular staining (IC) for TCR{gamma}{delta} (pooled anti-TCRV{gamma}2, anti TCRV{gamma}1.1, and anti-TCR{delta}) and TCR{beta}. Two parameter dot plots are shown as indicated for three DN4 subsets gated according to decreasing CSFE levels (see Fig. 1). Percentages of subsets are given in the insets.

 
Emergence of DN4 cells expressing intracellular TCR{beta} and/or TCR{gamma}{delta} proteins in RTOC from DN3 cells of WT and TCR tg mice

RTOC experiments were set up with purified DN3 cells from WT, TCR{beta} tg (V{beta}8), TCR{gamma}{delta} tg (V{gamma}1.1,V{delta}6), and TCR{beta}/{gamma}{delta} double-tg mice. V{gamma}1.1 represents one of the two V{gamma} genes frequently expressed in DN4 cells of WT mice (11). Transcripts of the V{gamma}1.1 tg are seen in DN2 and DN3 cells, whereas comparable levels of endogenous V{gamma}1.1 mRNA are first seen in DN3 (P. Pereira, unpublished observations). Transcripts of the TCR{beta} tg are present in DN3 cells at WT V{beta}8 levels (Ref. 26 , and our unpublished observations). TCR{beta} tg protein levels are lower than that of endogenous TCR{beta} genes, but sufficient for their allelic exclusion (Ref. 26 ; see also Fig. 4A). Cultures were analyzed daily on days 2–6 using intracellular staining for TCR proteins in DN3 and DN4 populations as shown for selected days in Fig. 3A. Absolute cell numbers were calculated for the four DN4 subsets ({beta}+/{gamma}{delta}, {beta}+/{gamma}{delta}+, {beta}/{gamma}{delta}+, and {beta}/{gamma}{delta})at all time points and are represented in Fig. 3B.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 4. Semiquantitative PCR of rearranged TCRV{gamma}1.1, TCRV{gamma}2, and TCRV{beta}8 genes in DN3 cells of B6 (WT), TCR{gamma}{delta} tg, and TCR{beta} tg mice (A), and of TCRV{gamma}1.1 and TCRV{gamma}2 genes in isolated TCR{beta}+ and TCR{beta} DN3 cells of B6 mice (B). DNA was isolated, adjusted to similar concentrations, subjected to PCR amplification at the indicated concentrations using primers specific for the TCR genes and for the insulin gene, and subjected to agarose electrophoresis, as described in Materials and Methods. The V{gamma}1.1 PCR amplifies the transgene in TCR{gamma}{delta} tg thymocytes but endogenous V{gamma}1.1 rearrangements in B6 and TCR{beta} tg thymocytes. The V{gamma}2 and V{beta}8 PCRs amplify only endogenous rearrangements in all three strains. The six V{beta}8 bands represent rearrangements to J{beta}1.1-6 from top to bottom; the appearance of only some of the bands is an indication for small numbers of rearrangements in the sample.

 


View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of intracellular TCR{beta} and TCR{gamma}{delta} proteins in DN3 and DN4 cells of B6, TCR{gamma}{delta} tg, TCR{beta} tg, and TCR{beta}/{gamma}{delta} tg mice developed in RTOC. DN3 cells were isolated from the four different strains of mice and placed into RTOC, as described in Materials and Methods. At days 2–6, cultures were harvested and analyzed by four-color flow cytometry using a pool of mAb to CD4, CD8, CD44, and NK1.1 for negative gating, anti-CD25, and intracellular staining (IC) for TCR{gamma}{delta} (pooled anti-TCRV{gamma}2, anti TCRV{gamma}1.1, and anti-TCR{delta}) and TCR{beta}. A, Two-parameter dot plots and single parameter histograms are shown as indicated on day 3 (TCR{beta} tg and TCR{beta}/{gamma}{delta} tg) or day 4 (B6 and TCR{gamma}{delta} tg). Quadrants differ as experiments were done on different occasions. The blocking control using unlabeled pooled anti-{gamma}{delta} mAb in excess is included in bold in the histograms. Percentages of subsets after substraction of control values are shown in the insets, absolute cell numbers recovered per lobe are given on top in bold, absolute numbers of DN3 and DN4 cells above each frame. B, Absolute cell numbers were calculated for the four DN4 subsets on each day of RTOC. B6, {diamond}; TCR{gamma}{delta} tg, {blacktriangleup}; TCR{beta} tg, {square}; and TCR{beta}/{gamma}{delta} tg, •.

 
As shown in Fig. 3A, the transgenic TCR{gamma}{delta} proteins appeared with similar timing as their endogenous counterparts, i.e., DN3 subsets of tg mice failed to express TCR{gamma}{delta} proteins. While TCR{beta} protein was expressed in about one-third of WT DN3 cells, it was found in the majority of TCR{beta} tg DN3 cells, thus including early DN3 cells that are TCR{beta} negative in WT mice. DN4 cells generated from DN3 cells of TCR{gamma}{delta} tg mice in RTOC displayed all four subsets of TCR protein expression observed in WT mice, including {beta}+/{gamma}{delta} cells. In contrast, in the TCR{beta} tg mouse, {beta}+/{gamma}{delta}+ cells were seen but the {beta}/{gamma}{delta}+ subset failed to develop. TCR{beta}/{gamma}{delta} double-tg mice generated almost no {beta}/{gamma}{delta}+ cells as well. While some DN4 cells fail to express any TCR proteins in WT mice and in the presence of TCR{gamma}{delta} transgenes, this population was minimal in TCR{beta} tg and TCR{beta}/{gamma}{delta} double-tg mice. Together, these data suggest that the majority if not all DN3 and DN4 cells are permissive for expression of TCR{beta} genes, whereas expression of TCR{gamma}{delta} genes is restricted to a fraction of DN4 cells.

With respect to the timing of appearance, {beta}+/{gamma}{delta} and {beta}/{gamma}{delta}+ DN4 cells emerged with strikingly parallel kinetics (Fig. 3B). In WT mice, both populations increased until day 4 of RTOC, while in TCR{gamma}{delta} tg mice, they increased until day 3 followed by a plateau until day 4. In addition, there was no acceleration in appearance of the {gamma}{delta}+ DN4 populations in the TCR{gamma}{delta} tg compared with WT mice. In contrast, the TCR{beta} tg accelerated the appearance of {beta}+/{gamma}{delta} and {beta}+/{gamma}{delta}+ DN4 cells such that most of these cells were generated before day 2, with some further increase in {beta}+/{gamma}{delta} cells until day 3. These results are inconsistent with models A and B which predict that cells expressing endogenous or tg TCR{gamma}{delta} proteins exit more rapidly from the DN3 population than cells expressing TCR{beta}. TCR{beta} and -{gamma}{delta} transgenes also had nonreciprocal influences on the sizes of DN4 subsets. TCR{gamma}{delta} tg mice showed significantly increased absolute numbers of total {gamma}{delta}+ DN4 cells while the {beta}+/{gamma}{delta} DN4 population was not consistently decreased in these mice. Moreover, similar absolute numbers of DN4 cells expressed the TCR{beta} tg in the presence and absence of TCR{gamma}{delta} tg. This suggests that the TCR{gamma}{delta} transgenes are unable to divert significant numbers of DN3 cells to develop into {gamma}{delta}+ DN4 cells and is, therefore, inconsistent with predictions by model B. In contrast, the increase in {beta}+/{gamma}{delta} DN4 cells of the TCR{beta} tg mouse was associated with a strongly diminished population of total {gamma}{delta}+ DN4 cells (sum of {beta}/{gamma}{delta}+ and {beta}+/{gamma}{delta}+), whereas in TCR{beta}/{gamma}{delta} double-tg mice, the number of total {gamma}{delta}+ DN4 cells was similar to that in TCR{gamma}{delta} tg mice. For explanation, we tested the hypothesis that the TCR{beta} transgene had an inhibitory effect on endogenous TCR{gamma} rearrangements. Indeed, as shown in Fig. 4A, the TCR{beta} transgene partially inhibited endogenous V{gamma}1.1 to J{gamma}4 and V{gamma}2 to J{gamma}1 rearrangements in comparison to WT mice, thus accounting for the reduction of the total {gamma}{delta}+ DN4 population in TCR{beta} tg, but not in TCR{beta}/{gamma}{delta} double-tg mice. Yet, in TCR{gamma}{delta} tg mice, rearrangements at the TCR{beta} locus were not inhibited. Consistent with model C, these data indicate that the TCR{beta} transgene is expressed when TCR{gamma} rearrangements are still ongoing, while the TCR{gamma}{delta} transgenes are expressed after completion of TCR{beta} rearrangement.

Since TCR{gamma} and TCR{beta} rearrangements overlap to some extent in WT mice, it was possible that endogenous TCR{beta} proteins would also inhibit endogenous TCR{gamma} rearrangements by pre-TCRinduced down-regulation of RAG1 and RAG2. However, only a small degree of inhibition of TCR{gamma} rearrangements is seen in TCR{beta}+ DN3 cells compared with TCR{beta} DN3 cells of WT mice (Fig. 4B), implying that most TCR{gamma} genes finish rearrangement before endogenous TCR{beta} genes are expressed. Thus, suppression of TCR{gamma} rearrangements by productive TCR{beta} genes may have a limited quantitative role in normal mice.

TCR{gamma}{delta} gene selection status in DN3/DN4 populations of WT, TCR{delta} KO, and CD3{zeta} x p56lck KO mice

Before expression of clonotypic TCR proteins, thymocyte subpopulations should be unselected as reflected by frequencies of productive TCR gene rearrangements near 33%. Upon expression of TCR proteins and TCR-dependent further developmental progression, the remaining thymocyte population becomes depleted of productive rearrangements. Thymocytes of KO mice with compromised TCR should maintain nonselected frequencies. Frequencies of productive TCR V(D)J gene rearrangements were analyzed in purified {beta} or {beta}+ subsets of DN3 thymocytes that do not express TCR{gamma}{delta} proteins and in the four DN4 subsets purified according to intracellular expression of TCR{gamma}{delta} and TCR{beta} proteins. As a reference for nonselected frequencies, we included TCR{delta} KO mice which are unable to generate a {gamma}{delta} TCR (14), and CD3{zeta} x p56lck KO mice which do not produce a functional CD3 complex (18). Sequencing analysis of TCR{gamma}{delta} rearrangements included V{gamma}1.1J{gamma}4 and V{gamma}2J{gamma}1 gene segments, together accounting for >80% of all TCR{gamma} chains expressed in DN4 cells (11) and V{delta}5J{delta}1 rearrangements.

In DN3 cells of WT mice, productive junctions of V{delta}5(D)J{delta}1 and of V{gamma}1.1J{gamma}4 appeared to occur at nonselected frequencies, i.e., not significantly different from 33% (Tables I and II). Proportions of productive V{gamma}2J{gamma}1 rearrangements in WT DN3 cells were between 9 and 17% (Table III). This is due to an in-frame stop codon at the 3' end of the V{gamma}2 gene that needs to be deleted in order for the rearrangement to be productive, and the observed frequencies are therefore, consistent with absence of selection. TCR{beta} expression does not seem to influence the TCR{gamma}{delta} selection status at this stage. No statistically significant differences were detected in comparison to the results on the two KO strains that define the range of results in the absence of selection. Together, TCR{gamma}{delta} rearrangements appear to be nonselected in DN3 cells. This is clearly inconsistent with model B that predicts depletion of productive TCR{gamma}{delta} rearrangements in DN3 cells.


View this table:
[in this window]
[in a new window]
 
Table I. Proportions of productive TCR V{delta}5 rearrangements in DN3 and DN4 subsets

 

View this table:
[in this window]
[in a new window]
 
Table II. Proportions of productive TCR V{gamma}1.1 rearrangements in DN3 and DN4 subsets

 

View this table:
[in this window]
[in a new window]
 
Table III. Proportions of productive TCR V{gamma}2 rearrangements in DN3 and DN4 subsets

 
Frequencies of productive V{gamma}J{gamma} and V{delta}(D)J{delta} junctions in the {gamma}{delta} DN4 populations of WT mice were not significantly different from that in DN3, and did not differ from {gamma}{delta} DN4 cells of TCR{delta} KO mice. DN4 cells of CD3{zeta} x p56lck double-deficient mice were not subdivided and also showed unselected frequencies of productive V{gamma} and V{delta} junctions. As expected, the DN4 populations expressing TCR{gamma}{delta} proteins were clearly positively selected for productive rearrangements of these genes, i.e., frequencies of productive TCR{gamma}{delta} genes were significantly higher than 33%.

TCR{beta} gene selection status in DN3/DN4 populations of WT, TCR{delta} KO, and CD3{zeta} x p56lck KO mice

Productive V{beta}8DJ{beta}1 and V{beta}5DJ{beta}1 rearrangements were strongly depleted from TCR{beta} DN3 cells and fully enriched in TCR{beta}+ DN3 cells, including that of the KO mice (Table IV). These data corroborate our conclusion from TCR{beta} tg mice that virtually all DN3 cells are permissive for expression of productively rearranged TCR{beta} genes. In DN4 cells, in-frame rearrangements of the TCR{beta} genes were, as expected, enriched in both TCR{beta}+ populations and were strongly depleted in the {beta}/{gamma}{delta}+ population. However, intriguingly, the {beta}/{gamma}{delta} subset was found to be positively selected for in-frame TCR{beta} rearrangements. Similarly, TCR{beta} rearrangements were highly positively selected in DN4 cells of TCR{delta} KO mice including the TCR{beta} subset. We think that this is not at variance with our conclusion from TCR{beta} tg mice that most DN4 cells are able to express productive TCR{beta} rearrangements as TCR{beta} protein. We have previously shown that {beta}/{gamma}{delta} DN4 cells contain apoptotic cells (12). Therefore, we suggest that the {beta}/{gamma}{delta} subset consists to a large extent of initially {beta}-selected cells that fail to further develop due to other reasons (see Discussion). TCR{beta} rearrangements were nonselected in the DN4 population of CD3{zeta} x p56lck double-deficient mice, suggesting that the DN4 cells generated in these mice fail to get {beta}-selected owing to compromised CD3 signaling.


View this table:
[in this window]
[in a new window]
 
Table IV. Proportions of productive TCR V{beta} rearrangements in DN3 and DN4 subsets

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The relative timing of TCR{gamma}{delta} and TCR{beta} protein expression in thymocyte differentiation has important consequences for the relative abilities of the pre-TCR or the TCR{gamma}{delta} to influence {alpha}{beta}/{gamma}{delta} lineage decision. The sequential detection of TCR{beta} and TCR{gamma}{delta} proteins in DN3 and DN4 cells, respectively, is consistent with, but does not prove, a delayed expression of TCR{gamma}{delta} proteins compared with TCR{beta} proteins. In this study, we concentrated on V{gamma}1.1 and V{gamma}2 {gamma}{delta} TCR which were previously shown to account for the majority of TCR{gamma}{delta} proteins in DN4 cells in vivo (11) and in DN4 cells that arise from isolated DN3 cells in RTOC (Ref. 12 , and our unpublished observations). We examined three alternative models of {alpha}{beta}/{gamma}{delta} lineage divergence by monitoring, the generation of thymocytes expressing clonotypic TCR proteins in WT and TCR tg mice in RTOCs, and the frequencies of productive TCR{beta} and TCR{gamma}{delta} V(D)J rearrangements in DN subsets before and after TCR{gamma}{delta} protein expression. Table V summarizes the predictions and the results that discriminate between models A, B, and C.


View this table:
[in this window]
[in a new window]
 
Table V. Summary of predictions of models A, B, and C and discriminating experimental resultsa

 
We determined cell proliferation in the different DN4 populations using CFSE-labeled DN3 cells as a RTOC input. On average, DN4 cells expressing only TCR{beta} proteins undergo twice the number of cell divisions of DN4 cells expressing TCR{gamma}{delta} proteins including the {beta}+/{gamma}{delta}+ DP cells, indicating that the latter may have become committed to the {gamma}{delta} lineage. The analyses of TCR tg mice in RTOC experiments provided several informative results (Table V). First, we observed the expression of the TCR{beta} transgene in nearly all DN3 and DN4 cells, whereas expression of the pair of TCR{gamma}{delta} tg was restricted to a subset of DN4 cells. Second, DN4 cells expressing only TCR{beta} proteins and DN4 cells expressing only TCR{gamma}{delta} proteins arose from isolated DN3 cells with parallel kinetics. This was the case in WT mice and in TCR{gamma}{delta} tg mice, and there was no indication for an accelerated appearance of {gamma}{delta}+ DN4 cells in TCR{gamma}{delta} tg mice. In contrast, the TCR{beta} transgene accelerated the appearance of {beta}+/{gamma}{delta} and {beta}+/{gamma}{delta}+ DN4 cells from isolated DN3 cells, consistent with the premature TCR{beta} expression in early DN3 cells. Third, DN4 cells expressing the TCR{beta} protein were not significantly reduced in TCR{gamma}{delta} tg mice, implying that the presence of TCR{gamma}{delta} transgenes does not divert DN3 cells to develop to {gamma}{delta}+ DN4 instead of {beta}+ DN4 cells. In contrast, the TCR{beta} transgene caused considerable inhibition of the development of total DN4 cells expressing TCR{gamma}{delta} proteins in TCR{beta} tg mice compared with WT mice. The latter observations could be accounted for by a partial suppression of TCR{gamma} gene rearrangements by the TCR{beta} transgene (28, 29). Nevertheless, in WT mice, only a small degree of inhibition of TCR{gamma} rearrangement was seen in DN3 cells that express endogenous TCR{beta} protein compared with TCR{beta}-negative DN3 cells, suggesting that most TCR{gamma} rearrangements are completed before endogenous TCR{beta} expression. The suppression of endogenous TCR{gamma} rearrangements in the TCR{beta} tg mouse is therefore, most likely due to the premature expression of the TCR{beta} transgene in early DN3 cells, and has only limited consequences in normal mice. However, our observation that TCR{gamma}{delta} tg do not inhibit endogenous TCR{beta} rearrangements most likely reflects the fact that in normal mice expression of productive TCR{gamma}{delta} genes is delayed until TCR{beta} rearrangements are completed. Taken together, these results do not support models A and B, both of which predict a more rapid development of TCR{gamma}{delta}+ DN4 cells than of TCR{beta}+ DN4 cells from isolated DN3 cells in RTOC in both WT and TCR{gamma}{delta} tg mice. In addition, model B predicts a diminished generation of TCR{beta}+ DN4 cells in TCR{gamma}{delta} tg mice compared with WT mice.

It should be pointed out that the failure to detect intracellular or cell surface TCR proteins by FACS does not exclude the expression of low amounts of these proteins and the presence of functional TCRs at the cell surface. Therefore, we performed a second series of experiments to examine the existence of functional {gamma}{delta} TCR in DN3, independently of the detection of {gamma}{delta} TCR proteins. To this end, we determined the proportions of in-frame V(D)J rearrangements of {gamma} and {delta} loci in DN3 and DN4 subpopulations. Before functional pre-TCR or TCR{gamma}{delta} expression at the cell surface, the frequency of in-frame TCR gene rearrangements should reflect the random rearrangement process in the absence of selection. As most TCR{gamma}{delta} rearrangements are completed in DN3 cells (2, 3), delayed expression of TCR{gamma}{delta} proteins up to the DN4 stage would result in random TCR{gamma} and -{delta} rearrangements in DN3 cells. Alternatively, if expression of TCR{gamma}{delta} proteins takes place in DN3 and immediately drives maturation of these cells to DN4, the DN3 subset should be depleted of productive TCR{gamma}{delta} rearrangements. Our data indicate that the DN3 subset contains nondepleted frequencies of productive TCR{gamma}{delta} rearrangements. The analysis is complicated by the relatively small differences to be expected between random and depleted frequencies on the one hand, and the considerable statistical variation in the case of low proportions of productive genes on the other. Nevertheless, we obtain consistent results for three different V gene segments in a considerable number of independently sorted and analyzed populations, isolated from WT mice and from mice with compromised TCR. Therefore, we are confident that our results are inconsistent with model B that predicts depletion of productive TCR{gamma}{delta} rearrangements from DN3 cells. Taken together, our results from RTOC and junction sequencing lend strong support to model C that postulates a true temporal delay in the expression of TCR{gamma}{delta} proteins compared with TCR{beta} (Table V).

It is important to point out that these results apply to the two V{gamma} genes that predominate in DN4 cells, and may therefore, not be valid for the other two V{gamma} genes rearranged in adult thymus (Vg5 and Vg1.2) and rarely expressed in DN4 cells (30, 31, 32), or for V{gamma}3 and V{gamma}4 that are rearranged prenatally. Indeed, preliminary evidence from our lab suggests that productive V{gamma}5J{gamma}1 and V{gamma}1.2J{gamma}2 segments may be underrepresented in DN3 cells (G. Turchinovich, K. Eichmann, and A. Krotkova, manuscript in preparation). Therefore, it is possible that most cells expressing these V{gamma} genes exit the population at DN3 or even earlier without appearing in DN4. Moreover, it is not excluded that some cells expressing any of the four V{gamma} genes bypass the DN3 subset. However, as most TCR{gamma} and -{delta} rearrangements take place in DN3 (2, 3), we think that this putative maturation pathway may be a minor one.

Sequencing analyses of DN4 thymocytes were performed on four populations subdivided according to the expression of intracellular TCR{gamma}{delta} and TCR{beta} proteins. As expected, the {gamma}{delta}+/{beta} and {gamma}{delta}+/{beta}+ populations were significantly enriched for productive TCR{gamma}{delta} rearrangements, although this was much more pronounced for the TCR{delta} than for the TCR{gamma} genes. This could be due to lack of allelic exclusion in the {gamma} loci (33, 34) and the complexity of the {gamma} locus, which allows any cell with a productively rearranged allele to carry up to five nonproductively rearranged alleles (27, 35, 36). In TCR{gamma}{delta} DN4 populations, independently of TCR{beta} expression, frequencies of productive TCR{gamma} and TCR{delta} V(D)J rearrangements were not significantly different from that in DN3 and DN3/4 cells of WT and TCR{delta} and CD3{zeta} x p56lck KO mice, respectively.

Productive V{beta}(D)J{beta} gene rearrangements were expectedly enriched in DN3 and DN4 populations that express TCR{beta} proteins and were strongly underrepresented in {gamma}{delta}+/{beta} DN4 cells. This finding supports our suggestion based on experiments with TCR tg mice that most DN3 and DN4 cells express TCR{beta} proteins if they harbor a functionally rearranged TCR{beta} gene. However, some DN4 cells fail to express any TCR proteins and this population was strongly enriched for in-frame V{beta}DJ{beta} junctions, indicating that the cells have matured to DN4 in the context of {beta}-selection. The same enrichment was also seen in the corresponding DN4 subset of TCR{delta} KO mice. As we have previously shown, this population contains apoptotic cells and is the endpoint of unsuccessful pre-T cell development (12). We can imagine two nonmutually exclusive mechanisms to explain the presence of productive TCR{beta} rearrangements in this subset. First, this population might contain {gamma}{delta} lineage-committed cells that have productive TCR{beta}, but no productive TCR{gamma}{delta} gene rearrangements, as postulated by stochastic models. Second, some TCR{beta} chains may give rise to pre-TCRs that may not be able to deliver the signals required by DN4 cells for survival and further maturation (12). In either case, such cells might become apoptotic, terminate all TCR protein expression, and thus appear in the {beta}{gamma}{delta} DN4 population.

The data reported here severely constrain putative opportunities of {gamma}{delta} lineage instruction by {gamma}{delta} TCR containing V{gamma}2 and V{gamma}1.1 chains. Indeed, in instructive models, it would be difficult to explain the existence of {gamma}{delta} T cells expressing these V{gamma} genes together with a productive TCR{beta} rearrangement. Nevertheless, we observe such cells among {beta}+/{gamma}{delta}+ DN4 cells (this paper) and peripheral {gamma}{delta} T cells (data not shown) of WT and TCRVg1.1{delta} tg and double-tg mice. Therefore, such cells must be precommitted to the {gamma}{delta} lineage rather than instructed by a {gamma}{delta}TCR. However, our data do not generally exclude instructive mechanisms. For example, it has been suggested that pre-TCR signals inhibit {gamma}{delta} lineage development to interpret the increases in the number of {gamma}{delta} T cells in mice deficient for the pre-TCR (pT{alpha} and TCR{beta} KO mice; Refs. 4 , 37 and 38). Such a mechanism is not at variance with the results presented here.

A sequential expression model based on our data is outlined schematically in Fig. 5. As our data suggest TCR-independent {gamma}{delta}-lineage commitment for at least some of the DN4 cells, we think that some of the DN4 cells are {alpha}{beta}-lineage committed as well. Random TCR gene rearrangements in DN2/DN3 generate four types of DN3 cells: Cells with a productive TCR{beta} gene, cells with a pair of productive TCR{gamma}{delta} genes, cells with all three TCR genes productively rearranged, and cells with no productive TCR gene rearrangement. TCR{beta} proteins are expressed in all DN3 cells that possess a productive TCR{beta} gene, whereas TCR{gamma}{delta} proteins are not expressed in DN3. All DN3 cells mature to DN4, i.e., down-regulate CD25 with similar kinetics, but cells expressing TCR{beta} proteins divide with a faster rate than cells that do not. After entering the DN4 stage, all cells are still permissive for TCR{beta} gene expression but only {gamma}{delta}-lineage-committed DN4 cells are permissive for TCR{gamma}{delta} gene expression. As a consequence, DN4 cells with three productively rearranged TCR genes ({beta}+{gamma}{delta}+) express both TCR{beta} and TCR{gamma}{delta} proteins if they are {gamma}{delta} lineage committed or only TCR{beta} if they lack {gamma}{delta}-lineage commitment. These cells are the source of mature {gamma}{delta} and {alpha}{beta} T cells, respectively, that harbor productive rearrangements of the opposite lineage. Cells that possess productive genes for only one of the two TCRs ({beta}+{gamma}{delta} or {beta}{gamma}{delta}+) express the corresponding TCR protein(s). However, in a certain proportion of these cells, there seems to be a mismatch between lineage commitment and productively rearranged TCR gene(s). In this case, or in case of other developmental impairments, the cells terminate production of all TCR proteins and die. It will be of interest to determine the onset of lineage commitment in this sequence, which could be as late as at the DN3 to DN4 transition or the DN4 stage itself.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. Lineage divergence with sequential TCR{beta} and TCR{gamma}{delta} protein expression in DN3 and DN4 cells, respectively. Original dot plots of TCR{beta}IC vs TCR{gamma}{delta}IC protein expression in DN2-DN4 populations are shown. The proposed fate of the DN4 subsets is indicated. The developmental progression is shown by arrows. Arrow 1, TCR-independent maturation of DN2 cells to DN3. Arrow 2, DN3 cells with a productive TCR{beta} gene express TCR{beta} protein, including cells with productive TCR{gamma}{delta} genes. Arrows 3 and 4, All DN3 cells mature to DN4, TCR{beta}+ cells (arrow 3) divide more often than TCR{beta} cells (arrow 4). Arrow 5, TCR{beta}+ DN4 cells that are {gamma}{delta}-committed and possess a pair of productive TCR{gamma}{delta} genes express, in addition, TCR{gamma}{delta} proteins. Arrow 6, TCR{beta}+ DN4 cells that are {gamma}{delta}-committed and do not possess a pair of productive TCR{gamma}{delta} genes, or are compromised in other ways, terminate TCR protein expression and become apoptotic. Arrow 7, TCR{beta} DN4 cells that are {gamma}{delta}-committed and possess a pair of productive TCR{gamma}{delta} genes express TCR{gamma}{delta} proteins.

 


    Acknowledgments
 
We are grateful to Iain Haidl for critical reading of the manuscript, and to P. Pereira for helpful suggestions and comments, generously supplying mice and reagents and sharing unpublished data. The competent help of A. Wuerch with FACS sorting, and H. Mossmann and P. Wehrstett with mouse breeding are gratefully acknowledged.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Klaus Eichmann, Max-Planck-Institut für Immunbiologie, Stübeweg 51, 79108 Freiburg, Germany. E-mail address: eichmann{at}immunbio.mpg.de Back

2 Abbreviations used in this paper: DN, double negative; DP, double positive; RTOC, reaggregate thymic organ culture; KO, knockout; tg, transgenic; WT, wild type; pT{alpha}, pre-TCR{alpha} chain. Back

Received for publication November 20, 2003. Accepted for publication April 19, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Godfrey, D. I., A. Zlotnik. 1993. Control points in early T cell development. Immunol. Today 14:547.[Medline]
  2. Capone, M., R. D. Hockett, Jr, A. Zlotnik. 1998. Kinetics of T cell receptor {beta}, {gamma}, and {delta} rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44+CD25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522.[Abstract/Free Full Text]
  3. Livak, F., M. Tourigny, D. G. Schatz, H. T. Petrie. 1999. Characterization of TCR gene rearrangements during adult murine T cell development. J. Immunol. 162:2575.[Abstract/Free Full Text]
  4. Fehling, H. J., A. Krotkova, C. Saint-Ruf, H. von Boehmer. 1995. Crucial role of the pre-T cell receptor {alpha} gene in development of {alpha}{beta} but not {gamma}{delta} T cells. Nature 375:795.[Medline]
  5. von Boehmer, H., I. Aifantis, O. Azogui, J. Feinberg, C. Saint-Ruf, C. Zober, C. Garcia, J. Buer. 1998. Crucial function of the pre-T cell receptor (pre-TCR) in TCR{beta} selection, TCR{beta} allelic exclusion, and {alpha}{beta} versus {gamma}{delta} lineage commitment. Immun. Rev. 165:111.[Medline]
  6. Petrie, H. T., D. Livak, D. Burtrum, D. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell proliferation. J. Exp. Med. 182:211.
  7. Sebzda, E., S. Mariathasan, T. Ohteki, R. Jones, M. F. Bachmann, P. S. Ohashi. 1999. Selection of the T cell repertoire. Annu. Rev. Immunol. 17:829.[Medline]
  8. Garman, R. D., P. J. Doherty, D. H. Raulet. 1986. Diversity, rearrangement, and expression of murine T cell {gamma} genes. Cell 45:733.[Medline]
  9. Lefrancois, L.. 1991. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J. Immunol. 147:1746.[Abstract]
  10. Grusby, M. J., H. Auchincloss, Jr, R. Lee, R. S. Johnson, J. P. Spencer, M. Zijlstra, R. Jaenisch, V. E. Papaioannou, L. H. Glimcher. 1993. Mice lacking major histocompatibility complex class I and class II molecules. Proc. Natl. Acad. Sci. USA 90:39137.
  11. Wilson, A., M. Capone, H. R. MacDonald. 1999. Unexpectedly late expression of intracellular CD3{epsilon} and TCR{gamma}{delta} proteins during adult thymus development. Int. Immunol. 11:1641.[Abstract/Free Full Text]
  12. Falk, I., G. Nerz, I. Haidl, A. Krotkova, K. Eichmann. 2001. Immature thymocytes that fail to express TCR{beta} and/or TCR{gamma}{delta} proteins die by apoptotic cell death in the CD44CD25 (DN4) subset. Eur. J. Immunol. 31:3308.[Medline]
  13. Fehling, H. J., S. Gilfillan, R. Ceredig. 1999. {alpha}{beta}/{gamma}{delta} lineage commitment in the thymus of normal and genetically manipulated mice. Adv. Immunol. 71:1.[Medline]
  14. Itohara, S., P. Mombaerts, J. Lafaille, J. Iacomini, A. Nelson, A. R. Clarke, M. L. Hooper, A. Farr, S. Tonegawa. 1993. T cell receptor {delta} gene mutant mice: independent generation of {alpha}{beta} T cells and programmed rearrangements of {gamma}{delta} TCR genes. Cell 72:337.[Medline]
  15. Pircher, H., K. Burki, R. Lang, H. Hengartner, R. M. Zinkernagel. 1989. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen. Nature 342:559.[Medline]
  16. Pircher, H., T. W. Mak, R. Lang, W. Ballhausen, E. Ruedi, H. Hengartner, R. M. Zinkernagel, K. Burki. 1989. T cell tolerance to Mlsa encoded antigens in T cell receptor V{beta}8.1 chain transgenic mice. EMBO J. 8:719.[Medline]
  17. Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, J. P. DiSanto. 1997. The common cytokine receptor {gamma} chain controls survival of {gamma}{delta} T cells. J. Exp. Med. 186:1277.[Abstract/Free Full Text]
  18. Würch, A., J. Biro, A. J. Potocnik, I. Falk, H. Mossmann, K. Eichmann. 1998. Requirement of CD3 complex-associated signaling functions for expression of rearranged T cell receptor {beta} VDJ genes in early thymic development. J. Exp. Med. 188:1669.[Abstract/Free Full Text]
  19. Pereira, P., D. J. Gerber, S. Y. Huang, S. Tonegawa. 1995. Ontogenic development and tissue distribution of V{gamma}1-expressing T lymphocytes in normal mice. J. Exp. Med. 182:1921.[Abstract/Free Full Text]
  20. Levelt, C. N., A. Ehrfeld, K. Eichmann. 1993. Regulation of thymocyte development through CD3. I. Time point of ligation of CD3{epsilon} determines clonal deletion or induction of developmental program. J. Exp. Med. 177:707.[Abstract/Free Full Text]
  21. Levelt, C. N., R. Carsetti, K. Eichmann. 1993. Regulation of thymocyte development through CD3. II. Expression of T cell receptor {beta} CD3{epsilon} and maturation to the CD4+8+ stage are highly correlated in individual thymocytes. J. Exp. Med. 178:1867.[Abstract/Free Full Text]
  22. Anderson, G., J. J. Owen, N. C. Moore, E. J. Jenkinson. 1994. Characteristics of an in vitro system of thymocyte positive selection. J. Immunol. 153:1915.[Abstract]
  23. Richter, A., M. Lohning, A. Radbruch. 1999. Instruction for cytokine expression in T helper lymphocytes in relation to proliferation and cell cycle progression. J. Exp. Med. 190:1439.[Abstract/Free Full Text]
  24. Mallick, C. A., E. C. Dudley, J. L. Viney, M. J. Owen, A. C. Hayday. 1993. Rearrangement and diversity of T cell receptor {beta} chain genes in thymocytes: a critical role for the {beta} chain in development. Cell 73:513.[Medline]
  25. Anderson, S. J., K. M. Abraham, T. Nakayama, A. Singer, R. M. Perlmutter. 1992. Inhibition of T cell receptor {beta} chain gene rearrangement by overexpression of the non-receptor protein tyrosine kinase p56lck. EMBO J. 11:4877.[Medline]
  26. Biro, J., A. Würch, A. J. Potocnik, I. Falk, H. Mossmann, K. Eichmann. 1999. Regulation of T cell receptor (TCR) {beta} gene expression by CD3 complex signaling in immature thymocytes: implications for TCR{beta} allelic exclusion. Proc. Natl. Acad. Sci. USA 96:3882.[Abstract/Free Full Text]
  27. Raulet, D. H.. 1989. The structure, function, and molecular genetics of the {gamma}{delta} T cell receptor. Annu. Rev. Immunol. 7:175.[Medline]
  28. Krotkova, A., H. von Boehmer, H. J. Fehling. 1997. Allelic exclusion in pT{alpha}-deficient mice: no evidence for cell surface expression of two T cell receptor (TCR)-{beta} chains, but less efficient inhibition of endogenous V{beta}-(D)J{beta} rearrangements in the presence of a functional TCR{beta} transgene. J. Exp. Med. 186:76.
  29. Terrence, K., C. P. Pavlovich, E. O. Matechak, B. J. Fowlkes. 2000. Premature expression of T cell receptor (TCR) {alpha}{beta} suppresses TCR{gamma}{delta} gene rearrangement but permits development of {gamma}{delta} lineage T cells. J. Exp. Med. 192:537.[Abstract/Free Full Text]
  30. Bandeira, A., S. Itohara, M. Bonneville, O. Burlen-Defranoux, T. Mota-Santos, A. Coutinho, S. Tonegawa. 1991. Extrathymic origin of intestinal intraepithelial lymphocytes bearing T cell antigen receptor {gamma}{delta}. Proc. Natl. Acad. Sci. USA 88:43.[Abstract/Free Full Text]
  31. Guy-Grand, D., N. Cerf-Bensussan, B. Malissen, M. Malassis-Seris, C. Briottet, P. Vassalli. 1991. Two gut intraepithelial CD8+ lymphocyte populations with different T cell receptors: a role for the gut epithelium in T cell differentiation. J. Exp. Med. 173:471.[Abstract/Free Full Text]
  32. Pereira, P., D. Gerber, A. Regnault, S. Y. Huang, V. Hermitte, A. Coutinho, S. Tonegawa. 1996. Rearrangement and expression of V{gamma}1, V{gamma}2, and V{gamma}3 TCR{gamma} genes in C57BL/6 mice. Int. Immunol. 8:83.[Abstract/Free Full Text]
  33. Sleckman, B. P., B. Khor, R. Monroe, F. W. Alt. 1998. Assembly of productive T cell receptor {delta} variable region genes exhibits allelic inclusion. J. Exp. Med. 188:1465.[Abstract/Free Full Text]
  34. Davodeau, F., M. A. Peyrat, I. Houde, M. M. Hallet, G. De Libero, H. Vie, M. Bonneville. 1993. Surface expression of two distinct functional antigen receptors on human T cells. Science 260:1800.[Abstract/Free Full Text]
  35. Vernooij, B. T., J. A. Lenstra, K. Wang, L. Hood. 1993. Organization of the murine T cell receptor {gamma} locus. Genomics 17:566.[Medline]
  36. Hayday, A. C., H. Saito, S. D. Gillies, D. M. Kranz, G. Tanigawa, H. N. Eisen, S. Tonewaga. 1985. Structure, organization, and somatic rearrangements of T cell {gamma} genes. Cell 40:259.[Medline]
  37. Mombaerts, P., A. R. Clarke, M. L. Hooper, S. Tonegawa. 1991. Creation of a large genomic deletion at the T cell antigen receptor {beta}-subunit locus in mouse embryonic stem cells by gene targeting. Proc. Natl. Acad. Sci. USA 88:3084.[Abstract/Free Full Text]
  38. Aifantis, L., O. Azogui, J. Feinberg, C. Saint-Ruf, J. Buer, H. von Boehmer. 1998. On the role of T cell receptor in {alpha}{beta} versus {gamma}{delta} T lineage commitment. Immunity 9:649.[Medline]



This article has been cited by other articles:


Home page
JEMHome page
T. Kreslavsky, A. I. Garbe, A. Krueger, and H. von Boehmer
T cell receptor-instructed {alpha}{beta} versus {gamma}{delta} lineage commitment revealed by single-cell analysis
J. Exp. Med., May 12, 2008; 205(5): 1173 - 1186.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. E. Busse, A. Krotkova, and K. Eichmann
The TCR{beta} Enhancer Is Dispensable for the Expression of Rearranged TCR{beta} Genes in Thymic DN2/DN3 Populations but Not at Later Stages
J. Immunol., September 1, 2005; 175(5): 3067 - 3074.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krotkova, A.
Right arrow Articles by Eichmann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krotkova, A.
Right arrow Articles by Eichmann, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS