The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lauder, A. J.
Right arrow Articles by McKenzie, A. N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lauder, A. J.
Right arrow Articles by McKenzie, A. N. J.
The Journal of Immunology, 2004, 173: 113-122.
Copyright © 2004 by The American Association of Immunologists

Lymphomagenesis, Hydronephrosis, and Autoantibodies Result from Dysregulation of IL-9 and Are Differentially Dependent on Th2 Cytokines1

Angus J. Lauder*, Helen E. Jolin*, Philippa Smith*, José G. van den Berg{dagger}, Alison Jones*, William Wisden2,*, Kenneth G. C. Smith{ddagger}, Ayan Dasvarma*, Padraic G. Fallon§ and Andrew N. J. McKenzie3,*

* Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom; {dagger} Department of Pathology, Academic Medical Center, Amsterdam, The Netherlands; {ddagger} Cambridge Institute for Medical Research and Department of Medicine, University of Cambridge School of Clinical Medicine, Addenbrooke’s Hospital, Cambridge, United Kingdom; and § Immunomodulation Group, Department of Biochemistry, Trinity College, Dublin, Ireland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-9 is an immunoregulatory cytokine implicated in the development of asthma and allergy. To investigate the role of IL-9 in vivo, we have generated transgenic mice in which IL-9 is expressed from its own promoter. Strikingly, overexpression of IL-9 resulted in premature mortality associated with a complex phenotype characterized by the development of autoantibodies, hydronephrosis, and T cell lymphoma. By intercrossing IL-9 transgenic mice with a panel of Th2 cytokine-deficient mice, we demonstrate that these disorders represent distinct phenotypes that can be dissociated by their differential dependence on Th2 cytokines. Autoantibody production was ablated in IL-9 transgenic animals with a combined absence of IL-4, IL-5, and IL-13, coincident with a reduction in peritoneal B-1 cells. Hydronephrosis arose in 75% of IL-9 transgenic animals and was dependent on the presence of IL-4 and IL-13. In contrast, T cell lymphomas developed independently of the other Th2 cytokines, with the generation of rapidly proliferating CD8+ or CD4+CD8+ T cell clones that arose in the thymus before infiltrating both lymphoid and nonlymphoid tissues. Our data highlight potentially important new roles for IL-9, through its regulation of downstream Th2 effector cytokines, in autoantibody production and in hydronephrosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thelper 2 cytokine responses represent a highly complex network of integrated effector functions that appear to have evolved to control infections with extracellular parasites such as helminth worms. Such immune responses are characterized by the expression of IL-4, IL-5, IL-9, and IL-13 by activated CD4+ T cells. Importantly, it is these same responses that are inappropriately activated in allergy and asthma. For these reasons, the functional importance of the Th2 cytokines has been the subject of significant research using both in vitro and in vivo systems, with the recent application of conventional transgenesis and gene targeting proving illuminating. IL-9 is a Th2-derived cytokine that has been reported to regulate T and B cell function. IL-9 was first isolated as a factor capable of sustaining the long-term growth of murine T cell clones (1), but has since been demonstrated to have in vitro activities on mast cells (2), erythroid progenitors (3), and B cell Ig expression (4). Recent studies have also suggested that IL-9 may play a key role in certain disease pathologies. IL-9 has been implicated as a susceptibility factor for asthma, based on mapping studies in mice and human populations (5, 6) and the elevated expression of IL-9 in asthmatic patients (7). IL-9 expression has also been found associated with human leukemias. Hodgkin’s lymphoma cell lines and the neoplastic Reed-Sternberg cells of Hodgkin’s disease tumors have been found to express and respond to IL-9, indicating that IL-9 may play a role in the development of human cancers (8, 9). In addition, injection of syngeneic mice with T cells transfected with an IL-9 cDNA expression vector caused the death of the mice after 3–4 mo due to the development of lymphomas (10). This link between IL-9 and T cell transformation has been further elucidated by the production of transgenic mice overexpressing the IL-9 gene under the control of a ubiquitous promoter. These mice have been reported to develop spontaneous thymic lymphomas, although only at a low incidence (7% by 2 years) (11). These animals have also been shown to produce increased numbers of Mac1+, IgM+, CD5 B-1b cells in the peritoneal cavity, and elevated levels of serum Ig; however, no evidence of autoimmunity was detected (12).

Although IL-9 has been implicated in asthma and allergy, its role in such pathology remains unclear. However, expression of IL-9 transgenes under the control of a lung-specific promoter leads to severe airway inflammation with infiltration of eosinophils and lymphocytes, mast cell hyperplasia, and increased subepithelial collagen deposition (13). Further analysis of mice harboring inducible, lung-specific, IL-9 transgenes indicated that much of the pathology induced by IL-9 expression was in fact due to the downstream effects of the other Th2 cytokines (14). Indeed, data from our own studies using IL-9-deficient mice demonstrated that although IL-9 was critical for the rapid induction of pulmonary goblet cell hyperplasia and mastocytosis following lung challenge, it was functionally redundant thereafter (15).

Because IL-9 is expressed primarily by activated T cells, we have generated transgenic mice in which the mouse IL-9 transgene is regulated by its own promoter elements in conjunction with the human CD2 locus control region (LCR).4 This should allow us to examine the effect of IL-9 overexpression in a more physiological tissue distribution. Strikingly, these mice die prematurely following the development of complex pathology, which includes hydronephrosis, the production of autoantibodies, and a high incidence of T cell lymphomas. By intercrossing with Th2 cytokine-deficient mice, we have determined that the autoantibody phenotype, hydronephrosis, and T cell lymphomas are differentially dependent on Th2 cytokine expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of IL-9 transgenic mice

A 6.0-kb BamHI-digested genomic DNA fragment containing the complete mouse IL-9 gene was cloned into a BamHI site upstream of the human CD2 LCR (16) in the vector GSE1515 (kindly supplied by D. Kioussis, National Institute of Medical Research, London, U.K.). The IL-9 gene and CD2 LCR fusion were isolated as an 11.5-kb NotI fragment and injected into oocytes. Transgenic mice (strain CBA x C57BL/6) were generated using standard protocols (17). Transgenic mice were identified using Southern blot analysis of genomic DNA hybridized with the CD2 LCR or the murine IL-9 cDNA (18). In the experiments presented, transgenic lines IL-9Tg1, IL-9Tg2, and IL-9Tg3 had been backcrossed at least six generations onto strain C57BL/6. IL-9Tg1 mice were crossed with IL-5-deficient mice (IL-5 knockout (KO)) (19) to derive IL-9Tg + IL-5KO offspring, IL-4/13-deficient mice (IL-4/13KO) (20) to derive IL-9Tg + IL-4/13KO offspring, or were crossed with IL-4/5/13-deficient mice (19) to derive IL-9Tg + IL-4/5/13KO. In these experiments, transgenic mice were on an equivalent C57BL/6 x 129 background and were compared with littermate controls. Mice were maintained in a specific pathogen-free animal facility.

RNA/cDNA preparation

The heart, lungs, liver, spleen, kidney, and thymus were removed from 2-mo-old mice, and RNA was prepared using RNAzol (Biogenesis, Poole, U.K.), according to the manufacturer’s instruction. Reverse-transcription reaction: 1 µg of total RNA was reverse transcribed using 5 µg/ml oligo(dT)18 (New England Biolabs, Beverly, MA) and 20 U of superscript reverse transcription (HT Biotechnology, Cambridge, U.K.) in a volume of 20 µl with the supplied reverse-transcription buffer before digestion of the RNA template with 1 U of RNase H (USB, Cleveland, OH).

Real-time RT-PCR for IL-9 mRNA

PCR primers and probes were designed using the Primer express program (PerkinElmer, Wellesley, MA). Multiplex PCR was performed using the Taqman sequence detector (PerkinElmer) with the following hypoxanthine phosphoribosyltransferase (HPRT) and IL-9 primers/probes (reaction concentrations indicated in parentheses). HPRT forward, TTAAGCAGTACAGCCCCAAAATG (0.3 µM); HPRT reverse, CAAACTTGTCTGGAATTTCAAATCC (0.3 µM); HPRT probe, CCTTTTCACCAGCAAGCTTGCAACCTTA (0.125 µM, labeled 5' with fluorescent dye VIC and 3' TAMRA). IL-9 forward, AACGTGACCAGCTGCTTGTGT (0.9 µM); IL-9 reverse, TGGCATTGGTCAGCTGTAACA (0.9 µM); IL-9 probe, CCGTCCCAACTGATGATTGTACCACAC (0.15 µM, labeled 5' FAM and 3' with fluorescent dye TAMRA). IL-9 expression levels were quantified relative to the internal HPRT control before comparison of mRNA levels between the different transgenic lines.

Determination of transgene copy number by genomic DNA PCR

Genomic DNA samples from the different lines were subject to quantitative PCR using primers designed to amplify the IL-9 gene. The c-Maf gene was assessed as a single copy gene control (21). The genomic DNA was tested across a range of dilutions to ensure that the IL-9 and c-Maf DNA were amplified at a comparable rate. The IL-9 transgene copy number was then determined relative to the c-Maf internal control. Analysis of wild-type genomic DNA served as a further control, indicating the expected 1:1 ratio of IL-9 to c-Maf. Primer/Probe design and PCR conditions were as described above. IL-9 genomic forward primer, TTGTTATTTACCAGGATGATTGTACCA (0.3 µM); IL-9 genomic reverse primer, TTCTTTAGGACTTCAACTATCCTTTTCA (0.3 µM); IL-9 genomic probe, AATCAAGACTCTTGCCTGTTTTCCATCGG (0.175 µM, 5' FAM and 3' TAMRA). c-Maf genomic forward primer, AAGAGGCGGACCCTGAAAA (0.6 µM); c-Maf genomic reverse primer, CTGCAGCAGCTGGTTCTTCTC (0.6 µM); c-Maf genomic probe, CGGCTATGCCCAGTCCTGCCG (0.17 µM, 5' FAM and 3' TAMRA).

Flow cytometric analysis

RBC were removed from splenocyte suspensions using a 5-min incubation in lysis solution (150 mM Tris base, 19 mM ammonium chloride, pH 7.2), followed by two washes in medium containing 10% FCS. For each stain, 1 x 106 splenocytes were suspended in 200 µl of FACS medium (PBS, 5% FCS, 0.05% sodium azide). Cells were treated with 2.5 µg/ml anti-mouse CD16/CD32 (FcR{gamma}III/II) (clone 2.4G2; BD Pharmingen, San Diego, CA) for 15 min before staining with FITC-conjugated anti-mouse CD4 (clone L3T4; BD Pharmingen) and PE-conjugated anti-mouse CD8 (clone 53-6.7; BD Pharmingen). The stained cells were washed twice in FACS medium and then analyzed on a FACSCalibur (BD Biosciences, San Jose, CA).

To analyze tumor clonality, splenocytes were stained with PE-conjugated anti-mouse CD4 and anti-mouse CD8, and then with individual Abs from the 15 FITC-conjugated anti-mouse TCR{beta} Abs in a screening panel (BD Pharmingen).

To determine the proliferative status of the cells, splenocytes were washed in PBS and then suspended in permeabilization buffer (PBS, 0.03% saponin (Sigma-Aldrich, St. Louis, MO), 0.1% Na azide) in the presence of 25 µg/ml 7-aminoactinomycin D (Sigma-Aldrich) for 45 min at 37°C. Cell doublets were excluded using a FL3 area vs width gate, and the DNA content of the cells was plotted. All FACS analysis was performed using CellQuest software (BD Biosciences).

Peritoneal B-1 cell analysis

Peritoneal cells were obtained by peritoneal lavage and were incubated with 2.5 µg/ml anti-mouse CD16/CD32 (FcR{gamma}III/II, clone 2.4G2; BD Pharmingen), then stained with PE-conjugated anti-mouse CD5 (clone 53-7.3; BD Pharmingen), FITC-conjugated anti-mouse IgM (clone R6-60.2; BD Pharmingen), and Tri-color-conjugated anti-mouse Mac1 (CD11b; Caltag Laboratories, Burlingame, CA). The percentage of B-1 cells was calculated as the number of B-1 cells (IgM+/Mac1+) present in a total lymphocyte gate. The lymphocyte gate was defined by forward and side scatter profiles to exclude dead cells and larger nonlymphocytic cells. To compare B-1a/B-1b cells, the lymphocyte gate was combined with a B-1 cell gate (IgM+/Mac1+) and the B-1 cells plotted against CD5 expression to differentiate between B-1a (CD5+) and B-1b cells (CD5). To calculate the actual number of B-1a and B-1b cells, the percentage of peritoneal cells that were B-1a and B-1b was multiplied by the total number of cells retrieved from the peritoneal cavity.

Histology and immunocytochemistry

IL-9 transgenic mice from all three lines, varying from diseased to overtly normal, were culled together with age-matched wild-type littermates, and organs were processed for histology, as described (22). The liver, lungs, spleen, thymus, and kidneys were fixed in 10% formaldehyde in saline and paraffin embedded, and serial 4-µm sections were cut. Sections were stained to study tissue integrity and cell infiltration (H&E), mastocytosis (toluidine blue), mucus hyperplasia (periodic acid Schiff), fibrosis (martius scarlet blue), and eosinophilia (Giemsa). All slides were numerically coded, and organs were examined independently by two investigators. Cell infiltrates were further characterized by an investigator unaware of the source of the tissue. Organs from the three transgenic lines were scored arbitrarily: –, normal; +, minor tissue alterations; ++, moderate tissue changes; and +++, advanced tissue disorganization.

Immune complex (IgG) and C3 complement deposition in kidney glomeruli were analyzed by immunofluorescent staining, as described (23). Kidneys from IL-9Tg mice with visible swelling in both kidneys, one kidney affected, or with normal sized kidneys were snap frozen, cryosectioned, and acetone fixed. Kidneys from wild-type littermates were used as controls. Sections were stained with FITC-conjugated goat anti-mouse C3 or IgG (1/1000 dilution; Valeant Pharmaceuticals, Basingstoke, U.K. Germany). Spleen and thymus sections were stained for CD30 expression on cells by immunohistochemistry using a goat anti-mouse CD30+ Ab (R&D Systems, Abingdon, U.K.).

Cell transfer

Tumor cells were freshly prepared from the thymus of IL-9 transgenic mice that had developed lymphoma. A homogeneous single-cell suspension was prepared, and 1 x 106 cells were injected i.p. into 10 C57BL/6 mice. All injected mice developed swollen abdomens between 16 and 21 days postinjection due to increased peritoneal cellularity and enlargement of lymph nodes.

Serum Ab ELISA

IgG autoantibodies against nuclear Ags (ANA) and dsDNA were assayed using ELISA kits (Alpha Diagnostic International, San Antonio, TX), according to the manufacturer’s protocol. OD values were determined simultaneously for the IL-9 transgenic and wild-type controls, and all plates contained a positive control to ensure that samples were in the linear range. ELISA for serum Abs was performed, as described previously (24).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Regulated expression of IL-9 transgenes

Because IL-9 is produced primarily by activated T cells, we wished to assess the role of IL-9 overexpression by the T cell compartment. To achieve this goal, we generated a number of novel IL-9 transgenic mouse lines using a construct in which the native mouse IL-9 gene, including ~1 kb of upstream sequence, was fused to the human CD2 locus control region (Fig. 1A). This construct is therefore regulated by the endogenous mouse IL-9 promoter, while the CD2 LCR has been used to successfully enhance T cell-specific expression of transgenes by overcoming position-dependent integration effects (16). Using oocyte injection, several transgenic founders were generated, and these varied in the number of integrated copies of the IL-9 transgene. Three founders were used to establish independent transgenic lines denoted IL-9Tg1, IL-9Tg2, and IL-9Tg3. The IL-9 transgene was present at a high copy number in all three lines: IL-9Tg1 (41 ± 6 copies), IL-9Tg2 (27 ± 4 copies), and IL-9Tg3 (93 ± 13 copies). As anticipated from previous studies, transgene expression was copy number dependent (16, 25), with IL-9 mRNA levels highest in the IL-9Tg3 line. All transgenic lines expressed elevated levels of IL-9 mRNA in a spectrum of tissues, with levels ranging from 10- to 20,000-fold higher than the corresponding wild-type tissues (Fig. 1B). Although apparently high, these levels are comparable with the increases in IL-9 gene transcription in the lymph nodes of wild-type mice following helminth infection (data not shown). Furthermore, measurement of IL-9 in serum demonstrated a mean level of 97.5 pg/ml IL-9 in the IL-9Tg1 line (n = 6, SEM 41 pg/ml) and a mean level of 270 pg/ml IL-9 in the IL-9Tg3 line (n = 9, SEM 72 pg/ml) when compared with wild-type IL-9 levels with a mean of 9 pg/ml (n = 8, SEM 11 pg/ml; most wild-type samples had no detectable IL-9 or levels at the limit of detection, i.e., 20–30 pg/ml) (data not shown). It is noteworthy that the use of the IL-9 gene and promoter recapitulates the expression profile observed in the wild-type tissues, with the highest levels detected in the thymus, spleen, and lung.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Construction and expression pattern of the IL-9 transgene. A, Map of the mouse IL-9/human CD2 transgene construct. {blacksquare}, Indicate IL-9 exons; human CD2 LCR is indicated by shaded lozenge. B, Total RNA from tissues of IL-9 transgenic and wild-type littermate mice was reverse transcribed to generate cDNA, and the expression levels of IL-9 were calculated by comparison of IL-9 with an HPRT internal control performed in the same real-time PCR. The bars represent the fold increase in IL-9 mRNA compared with the level found in wild-type kidney, which was assigned a value of 1. Tissue samples include: 1, kidney; 2, spleen; 3, thymus; 4, lung; 5, heart; 6, liver.

 
Unexpectedly, we observed high mortality in all three of the IL-9 transgenic lines. In each of the lines, greater than 85% of the transgenic animals displayed symptoms of disease, and these animals were examined to determine the nature of the disorder. Gross examination revealed a complex multiorgan disease characterized by marked enlargement of lymphoid organs and disruption of tissue integrity.

T cell lymphomas develop in IL-9 transgenic mice

We found that a large proportion of the IL-9 transgenic animals had a severe lymphoproliferative disorder resulting in highly enlarged lymphoid tissues (Fig. 2A) and lymphoid infiltration into other tissues. FACS analysis revealed that in all three transgenic lines, the enlarged lymphoid tissues were due to expansion of either CD4/CD8 double-positive or CD8 single-positive T lymphocytes (Fig. 2B). The surface marker phenotype of the lymphomas was not restricted to a particular transgenic line, as both CD4/CD8 double-positive and CD8 single-positive lymphomas were found in all three (see Table I). No examples of CD4 single-positive lymphomas have been detected. The cells were highly proliferative with ~20% of isolated tumor cells in the S/G2/M phase of the cell cycle (Fig. 2C). No alterations were observed in the B-2 cell compartment (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. IL-9 transgene expression results in formation of T cell lymphomas. A, Macroscopic images illustrating the gross increase in size of IL-9 transgenic lymphomas compared with wild-type lymphoid organs. B, FACS analysis of splenocytes from wild-type spleens and IL-9 transgenic mice stained with anti-mouse CD4 conjugated to PE and anti-mouse CD8 conjugated to CyChrome. C, Proliferative status of wild-type splenocytes and IL-9 transgenic splenocytes. Splenocytes were permeabilized by saponin treatment and then stained with the DNA-binding dye 7-aminoactinomycin D. The histograms show cellular DNA content, with the indicated percentage value representing the proportion of cells in S/G2/M phase of the cell cycle. D, Analysis of TCR clonality using a V{beta}TCR-screening panel. Splenocytes from an IL-9 transgenic lymphoma were stained with anti-mouse CD4 conjugated to PE, anti-mouse CD8 conjugated to PE, and a single anti-mouse TCR{beta} conjugated to FITC. The V{beta} specificity of the TCR Ab is indicated on the plots. E, Three further lymphomas analyzed for TCR{beta} chain expression.

 

View this table:
[in this window]
[in a new window]
 
Table I. Disease phenotype of IL-9 transgenic linesa

 
Expansion of the T cell compartment could be due to polyclonal proliferation, or to transformation and monoclonal expansion. That the expanded T cell populations seen in these mice were proliferating rapidly, were infiltrating tissues, and were either CD4/8 double positive or CD8 single positive strongly suggested the latter was most likely. This was confirmed by screening the cells with a panel of TCR{beta}-specific Abs. In a wild-type mouse, each {alpha}{beta} T cell expresses a single TCR{beta} chain with between 1 and 15% of {alpha}{beta} T cells expressing any given {beta}-chain (data not shown). Analysis of IL-9 lymphomas revealed that a large proportion of the T cells expressed the same TCR{beta} chain, indicating that the infiltrates were monoclonal. In the example shown in Fig. 2D, 90% of the T cells from a grossly enlarged spleen stained positive with the V{beta}5.1/5.2-specific Ab, clearly indicating clonal expansion. Analysis of seven different lymphomas indicated that they were all clonal, but, as expected, the V{beta}TCR chain usage changed between different lymphomas (Fig. 2E). Furthermore, successful transplantation of tumor cells from IL-9 transgenic mice, by i.p. injection into wild-type syngeneic animals, demonstrated formally that the observed lymphomas resulted from tumoral transformation.

Because IL-9 expression has been associated with Hodgkin’s disease, we looked for two characteristics of this disease, Reed-Sternberg-like cells and CD30 expression (26). Neither was found in any lymphoma (data not shown). In addition, FACS analysis revealed normal B cell numbers.

Collectively, these data demonstrate that these IL-9 transgenic mice develop T cell lymphomas with some of the phenotypic features of T lymphoblastic lymphoma. Their incidence ranges from ~40% in the IL-9Tg1 line to ~85% of the IL-9 transgenic animals in the higher copy number IL-9Tg3 line (Table I). Animals were diagnosed with lymphomas between the ages of 7 wk to 1 year, with the mean age of onset between 16 and 20 wk (Table I). IL-9Tg3 animals developed lymphomas more rapidly than the other lines, probably due to their higher levels of IL-9 expression.

Widespread tissue disruption due to lymphoma in IL-9 transgenic mice

To characterize the pathology of the lymphomas, a histological examination of a range of tissues was undertaken. Spleen, thymus, lung, and liver samples from both apparently healthy and diseased animals were examined histologically, revealing progressive disease in all tissues examined. This was characterized by an initial perivascular infiltrate progressing to more extensive infiltration and tissue disruption (Fig. 3). Infiltration in the thymus of IL-9 transgenic mice was associated with prominent tingible body macrophages containing lymphocyte debris, and with almost complete replacement of normal thymic tissue by lymphoma (Fig. 3, A–C). Similarly, in the spleen, the normal red and white pulp structure (Fig. 3D) was replaced with a homogenous lymphocytic infiltrate (Fig. 3, E and F). In the liver, widespread lymphocyte infiltration resulted in marked disorganization of the normal hepatic architecture (Fig. 3, G–I). When compared with the lungs of wild-type mice (Fig. 3J), IL-9 transgenic lungs displayed perivascular, alveolar, and interstitial lymphocytic lymphomatous infiltrates (Fig. 3, K and L).



View larger version (151K):
[in this window]
[in a new window]
 
FIGURE 3. Tissue pathology of IL-9 transgenic mice with lymphomas. Representative H&E-stained sections of thymus (AC), spleen (D–F), liver (G–I), and lungs (J–L) from mice. Organs from wild-type mice are shown in A, D, G, and J, and all other panels are from IL-9 transgenic mice. Original magnifications are as follows: plates A, B, D, E, G, H, J, and K, x100; plates C, F, I, and L, x400.

 
Hydronephrosis develops in IL-9 transgenic mice

Strikingly, in addition to the high incidence of lymphoma, a large number of the IL-9 transgenic mice developed hydronephrosis (enlarged fluid-filled kidneys usually caused by distal obstruction to urinary flow; Fig. 4A). Normal mice rarely develop hydronephrosis, with a reported incidence of only 0.5–1.5% in certain inbred C57BL strains (27), and we have observed no hydronephrosis in wild-type littermates of the IL-9 transgenic mice. Seventy-five percent of the IL-9Tg1 animals displayed either unilateral or bilateral hydronephrosis, either as the only abnormality noted (43%) or in conjunction with lymphoma (32%) (Table I). This suggested that the hydronephrosis was not secondary to urinary obstruction by lymphomas. Hydronephrosis was also observed in the other IL-9 transgenic lines (Table I), indicating that the defect was due to the IL-9 transgene and not to a specific integration effect. The lower incidence of hydronephrosis observed in IL-9Tg3 animals may reflect the more rapid onset of lymphoma (mean age of onset 16 wk) in this line, which pre-empts the development of kidney disease (mean age of onset 27 wk).



View larger version (81K):
[in this window]
[in a new window]
 
FIGURE 4. Macroscopic and histological examination of hydronephrotic kidney disorder in IL-9 transgenic mice. A, Macroscopic images of wild-type and IL-9 transgenic mouse kidneys showing unilateral or bilateral hydronephrosis in the transgenic kidneys. B, Mast cells (dark blue) present underneath renal capsule and in renal parenchyma (toluidine blue staining, x400). C, Mast cells (dark blue) subserosally at the ureter. The urothelium already shows papillary proliferation with influx of mast cells (toluidine blue staining, x100). D and E, Hydronephrosis and papillary proliferation at the pyelum and ureter (H&E, x10). F, Influx of eosinophils (red, H&E, x200). G, Mast cells (dark blue, toluidine blue staining, x100).

 
Hydronephrosis occurs due to obstruction of urinary flow distal to the renal pelvis (i.e., at the level of the ureter, bladder, or urethra) or occasionally in association with reflux nephropathy. The fact that unilateral hydronephrosis was frequently seen, and that the bladder and distal ureter were normal, while the pelvis (and sometimes proximal ureter) was dilated, points to the proximal ureter or pelviureteric junction as the site of obstruction. No urinary calculi or other internal obstruction was noted (e.g., sloughed papillae, transitional cell tumors), no extrinsic compression was seen (hydronephrosis occurred in the absence of lymphoma), and no developmental defects were observed. No infections of the urine were observed (data not shown). A potential mechanism for ureteric obstruction was suggested by histological examination of sections of the kidneys and ureters of IL-9 transgenic mice. The earliest detectable anomalies observed in the kidneys and ureters of IL-9 transgenic mice were an abnormal infiltrate of mast cells (Fig. 4, B, C, and G). Similar mast cell infiltrates have also been reported previously in another IL-9 transgenic line, but were not associated with hydronephrosis (28). In kidneys with more advanced tissue damage, there was eosinophil infiltration, more profound inflammation associated with epithelial hypertrophy and protrusion into the lumen, and eventual fibrosis (data not shown) and ureteric stenosis (Fig. 4, B–G). Significantly, the IL-9 transgene on a mouse background with a combined deletion of IL-4, IL-5, and IL-13 (IL-9Tg x IL-4/5/13KO) failed to develop hydronephrosis (n = 30, aged up to 60 wk), even though the mean age of onset is 27 wk in IL-9 transgenic mice. In contrast, the absence of IL-5 alone (IL-9Tg x IL-5KO) did not prevent hydronephrosis in the presence of the IL-9 transgene. To date, we have not observed hydronephrosis in IL-9Tg x IL-4/13KO mice up to 10–12 mo of age (n = 20), although their IL-9Tg IL-4/13+/– and IL-9Tg IL-4/13+/+ littermates have developed hydronephrosis. Thus, hydronephrosis appears to be dependent on the presence of IL-9 and IL-4/IL-13, whereas IL-5 is not essential. Mast cell infiltration is still seen in the absence of IL-4, IL-5, and IL-13, indicating that it alone is not sufficient to drive the ureteric pathology that causes hydronephrosis (data not shown). However, mast cells have been shown to produce Th2 cytokines (29), and it is possible that these cells may be required for the release of IL-4/IL-13 during the initiation of disease, leading to inflammation and subsequent fibrosis (19).

Elevated serum autoantibodies, increased B-1 cells, and glomerular immune-complex deposition in IL-9 transgenic mice

Because overexpression of Th2 cytokines can lead to both increased Ab titers (30), and in some cases autoimmunity (31), we assayed the levels of serum Ig isotypes and autoantibodies in IL-9 transgenic mice. IL-9 transgenic mice had highly elevated levels of IgA and IgE, and moderate increases in IgG1, IgG2b, and IgM (Fig. 5A). The sera from IL-9 transgenic and wild-type littermates were also assayed for ANA or autoantibodies against dsDNA. To account for possible differences due to age, each transgenic mouse was paired with a wild-type littermate. The fold increase in autoantibodies (as determined by OD reading) was then calculated from the transgenic and wild-type littermate values. Of the 22 pairs analyzed, in 18 cases the transgenic animals had higher levels of ANA and of autoantibodies against dsDNA (Fig. 5B). The average increase in ANA in the IL-9 transgenic mice was 3.6-fold compared with wild-type levels, and for anti-dsDNA autoantibodies it was 5.5-fold. These 18 transgenic animals included apparently healthy transgenic animals, and mice with hydronephrosis and/or lymphomas. If only the animals with hydronephrosis are included in the analysis, then the increase in autoantibody levels rises to 3.8-fold for ANA (n = 10) and to 7.4-fold for anti-dsDNA autoantibodies (n = 12). Furthermore, analysis of 10 age-matched and apparently healthy IL-9 transgenic mice (4 mo of age) as compared with 10 wild-type controls demonstrated a statistically significant increase in ANA in the transgenic mice (n = 10, unpaired t test p = 0.0063). However, within such cohorts, some IL-9 transgenic mice did not produce autoantibodies. These results suggest that while the up-regulation of IL-9 predisposes to autoantibodies, an additional factor is required to induce their production. Given the complexity of the phenotypes observed in the IL-9 transgenic mice, it is possible that the events underlying lymphoma or hydronephrosis may modulate autoantibody expression. Glomerular deposition of IgG is commonly seen in mouse models that develop high levels of autoantibodies. Immunohistochemical examination of sections of transgenic kidneys before the apparent onset of hydronephrosis revealed significant glomerular deposition of IgG and C3 (Fig. 5C). However, this Ab deposition did not lead to glomerulonephritis or proteinuria (data not shown), and it is possible that Ab deposition may reflect a secondary event associated with the inflammatory processes observed in hydronephrosis or lymphoma.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. Autoantibody production and elevated B-1 cells in IL-9 transgenic mice. A, Comparison of serum Ig levels between wild-type and IL-9 transgenic mice. Each point represents the value obtained from the serum of an individual mouse. B, Comparison of autoantibody levels between wild-type and IL-9 transgenic mice. Each point represents the fold increase in autoantibody levels between an IL-9 transgenic mouse and an age-matched wild-type littermate. Top panel, Shows autoantibody levels against a mixture of antinuclear Ags; bottom panel, represents dsDNA autoantibody levels. C, Fluorescence images obtained by staining frozen kidney sections from wild-type and IL-9 transgenic mouse with FITC-conjugated anti-IgG (top panels) and FITC-conjugated anti-C3 (bottom panel). The field of view in each picture is filled by a single glomerular structure. D, FACS analysis of B-1 cells from wild-type and IL-9 transgenic peritoneal cells. The B-1 cells (IgM+/Mac1+) from the top panels were gated, and their expression of CD5 is illustrated in the lower panels. A representative FACS plot is displayed for each mouse genotype.

 
The B-1 subset of B cells constitutes the major population of lymphocytes in the peritoneal cavity and a minor population of splenic B cells. They differ phenotypically and functionally from conventional B-2 cells and have been implicated in the generation of autoantibodies (32). B-1 cells have a restricted range of receptor specificities, often against bacterial Ags, and are involved in the early innate responses to bacterial infections (33). Vink et al. (12) have reported that transgenic expression of IL-9 increases the numbers of peritoneal B-1 cells. However, they failed to show a link with autoantibody production. FACS analysis on peritoneal lavage confirmed that increased expression of IL-9 results in increased proportions of B-1 cells (IgM+/Mac1+) in the peritoneal cavity of IL-9 transgenic mice (Fig. 5D). Calculation of the actual number of cells by combining cell counts with FACS data revealed that IL-9 transgenic mice have ~5 times more B-1 cells than their wild-type counterparts (data not shown). Thus, an increase in B-1 cell numbers in the IL-9 transgenic mice was associated with elevated autoantibody production.

Analysis of cytokine-deficient mice has indicated a role for Th2 cytokines in the generation of the B-1 subset (19, 34) (A. J. Lauder and A. N. J. McKenzie, manuscript in preparation), and so we wished to determine whether ablation of Th2 cytokines could reverse IL-9-induced autoantibody production. We therefore crossed our IL-9 transgenic mice with mice lacking one or more of the other Th2 cytokines. To determine whether IL-5 was promoting autoantibody production, as reported by Tominaga et al. (35), IL-9 transgenic mice were crossed with mice lacking IL-5 (IL-5KO). However, the absence of IL-5 failed to abrogate IL-9-mediated autoantibody production (Fig. 6A). IL-4 has also been linked to autoantibody production (31), and we therefore crossed IL-9 transgenic mice with mice lacking IL-4 and the related cytokine IL-13 (IL-4/13KO). Deletion of these two cytokines also failed to impair autoantibody production in IL-9 transgenic mice (Fig. 6B). Finally, IL-9 transgenic mice were crossed with mice lacking the three Th2 cytokines, IL-4, IL-5, and IL-13. Combined ablation of IL-4, IL-5, and IL-13 prevented the appearance of autoantibodies in the IL-9 transgenic mice (Fig. 6C). Elevated expression of IL-9 leads to hypergammaglobulinemia, and therefore IL-9 could be acting by enhancing production of all Abs, including autoantibodies. To address this possibility, we assessed whether the combined deletion of the Th2 cytokines had resulted in a significant fall in the level of total serum Ig induced by the IL-9 transgene. We found that there was no significant difference in the levels of total serum Ig in those mice harboring the IL-9 transgene in the presence of IL-4, IL-5, and IL-13, and IL-9 transgenic mice in the absence of IL-4, IL-5, and IL-13 (Fig. 6D). Both of these groups of IL-9 transgenic mice had levels of total serum Ig significantly higher than wild type. These data suggest that the combined absence of IL-4, IL-5, and IL-13 in the presence of the IL-9 transgene results in the preferential ablation of autoantibodies even in the presence of hypergammaglobulinemia.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. Inhibition of IL-9-mediated autoantibody production by compound deletion of IL-4, IL-5, and IL-13. A, Comparison of IgG autoantibody levels between wild-type (Wt), IL-9 transgenic (IL-9Tg), IL-9 transgenic x IL-5-deficient mice (IL-9Tg IL-5KO), and IL-5-deficient mice (IL-5KO). B, Comparison of IgG autoantibody levels between wild-type (wt), IL-9 transgenic (IL-9tg), IL-9 transgenic x IL-4/13-deficient mice (9Tg4/13KO), and IL-4/13-deficient mice (IL-4/13KO). C, Comparison of IgG autoantibody levels between wild-type (Wt), IL-9 transgenic (IL-9Tg), IL-9Tg x IL-4-, IL-5-, IL-13-deficient (9Tg4/5/13KO), and IL-4-, IL-5-, IL-13-deficient (IL-4/5/13KO) mice. In all cases, each point represents the IgG serum autoantibody level from a single mouse as an absorbance value determined by ANA ELISA. D, Comparison of total serum Ig levels between wild-type (WT), IL-9Tg (9Tg), IL-9Tg x IL-4/5/13KO (9Tg4/5/13KO), and IL-4/5/13KO (4/5/13KO) mice. Bars indicate the mean and SE calculated from 7–20 mice of each genotype.

 
The effect of the IL-9 transgene on B-1 cell numbers was partially reversed by its combination with the deletion of IL-4, IL-5, and IL-13 (IL-9Tg x IL-4/5/13KO), restoring them to levels similar to those observed in wild-type mice (Fig. 7). However, the IL-9Tg x IL-4/5/13KO mice did have more B-1 cells than IL-4/5/13KO mice, implying that there are both IL-4-, IL-5-, IL-13-dependent, and IL-4-, IL-5-, IL-13-independent pathways through which IL-9 is able to modulate B-1 cells. Importantly, the IL-9Tg, IL-4/5/13KO, and the interbred IL-9Tg x IL4/5/13KO mice all had normal B-2 populations, indicating a preferential role for Th2 cytokines in the maintenance of B-1 populations (data not shown). Thus, deletion of IL-4, IL-5, and IL-13 not only decreases IL-9-mediated autoantibody production, but also reduces IL-9-mediated B-1 cell expansion. These data support a role for Th2 cytokines in the generation of autoantibodies possibly through the regulation of B-1 cells.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 7. Th2 cytokine deletion blocks the IL-9-mediated enhancement of B-1 cell numbers. A, FACS analysis of peritoneal cavity cells from wild-type, IL-9 transgenic (IL-9Tg), IL-9Tg x IL-4-, IL-5-, IL-13-deficient (IL-9Tg IL-4/5/13KO), and IL-4-, IL-5-, IL-13-deficient (IL-4/5/13KO) mice. Cells were stained with anti-mouse IgM and anti-mouse Mac1 Abs and the B-1 cells (IgM+/Mac1+) indicated by the box. B, The actual numbers of B-1a and B-1b cells (B-1a cells stained positive for CD5, whereas B-1b cells are CD5 negative) were calculated by combining the proportion of cells determined by FACS analysis with the cell counts performed on the peritoneal lavages.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-9 has been linked previously to a number of disease conditions, including susceptibility to T cell lymphomas and asthma (5, 6, 10, 11). The data presented in this work describe new roles for IL-9 in the induction of autoantibodies and hydronephrosis, and demonstrate that dysregulated T cell expression of IL-9 leads to the development of T cell lymphoma with a high penetrance. Significantly, these phenotypes were found to be distinct, relying differentially on the expression of additional Th2 cytokines. These results underscore the role of IL-9 as an upstream factor in the development of these pathologies, similar to its described role in pulmonary disease (14).

Expression of IL-9 has been detected in Hodgkin’s lymphoma cell lines and in the neoplastic Reed-Sternberg cells of primary Hodgkin’s tumors, indicating that IL-9 may play a role in the development of human cancers (8, 9). We have demonstrated that T cell-specific expression of IL-9 under the control of its own promoter and in conjunction with the human CD2 LCR results in a high penetrance of T cell lymphoma with up to 85% of animals affected. These animals spontaneously develop T cell lymphomas without exposure to mutagens, confirming a link between dysregulated IL-9 expression and the development of cancer. The potent tumorigenic effect of T cell-specific IL-9 expression observed in our study contrasts with systemic overexpression of IL-9, which results in only a low incidence of T cell lymphoma (11). Furthermore, lung-specific expression of IL-9 under the control of the rat Clara cell protein, CC10, promoter results in a broad asthma-like phenotype with no sign of tumorigenesis (13). Thus, the high incidence of lymphoma observed in our IL-9 transgenic mice may reflect the tissue specificity of IL-9 expression or possibly differences in the genetic backgrounds on which the various IL-9 transgenic lines have been founded. IL-9 was originally cloned as a T cell growth factor, the expression of which was restricted almost exclusively to activated T cells (36, 37). Clearly, continuous high-level expression of the IL-9 gene in the thymus leads to the selective outgrowth of T cell clones that are either CD8+ or CD4+CD8+ and arise independently of IL-4, IL-5, or IL-13, presumably due to a second-hit mutation. These new lines of IL-9 transgenic mice may prove useful in understanding the transformation events that occur where abnormal IL-9 expression has been detected (8, 9). Importantly, by intercrossing the IL-9 transgenic mice with compound Th2 cytokine-deficient mice, future studies will be able to analyze the T cell lymphomas in the absence of conflicting Th2 inflammatory responses.

A striking, but unexpected phenotype observed in our IL-9 transgenic mice was the development of hydronephrosis. Such a phenotype has not been previously associated with IL-9 overexpression, and represents a novel link between immune-regulatory cytokines and hydronephrosis. Hydronephrosis was observed in up to 75% of transgenic animals and developed independently of lymphoma. Histological analysis of the IL-9 transgenic mice suggests that inflammation and hypertrophy of the urothelium could lead to fibrosis, ureteric, or pelvi-ureteric junction stenosis, and thus to obstruction and hydronephrosis. Significantly, this process requires the presence of IL-4 and/or IL-13, whereas IL-5 does not appear essential. Because IL-4 and IL-13 are pleiotropic cytokines, they may be mediating their effects through multiple pathways, including the activation and recruitment of T cells and eosinophils (19). A further possibility is that IL-13, which has been shown to regulate fibrosis (38, 39), may predispose to inappropriate collagen deposition in the ureter, resulting in obstruction. Interestingly, transgenic mice expressing TGF-{beta}, another profibrotic factor, also exhibited hydronephrosis (40), although with lower penetrance than we have observed in the IL-9 transgenic mice. The IL-9 transgenic mice should prove an interesting model for examining the potential roles of Th2 cytokines in urothelial pathology.

It is of note that while the observation that hydronephrosis occurs in IL-9 transgenic mice might appear to be an obscure one, it may have significance in the etiology of certain diseases associated with urinary tract obstruction and renal failure. An interesting example is infection with the helminth parasite Schistosoma hematobium, the cause of urinary schistosomiasis. Schistosomiasis infections are associated with elevated Th2 cytokines, including IL-9, and the resulting pathology involves eosinophil-rich granulomatous inflammation surrounding parasite eggs trapped in various organs, including the urinary tract. During S. hematobium infections, parasite eggs induce inflammation, with progressive scarring in the bladder and/or upper urinary tract, leading to hydronephrosis. In sub-Saharan Africa alone, it has been estimated that 150,000 people infected with S. hematobium die per year from obstructive renal failure, with 18.9 million infected people developing hydronephrosis (41). The hydronephrosis seen in the IL-9 transgenics prepared in this study may be generated by pathological processes with similarities to the parasite-induced hydronephrosis in urinary schistosomiasis, providing insight into, and a model for, an important clinical problem.

Another cause of urinary obstruction in humans, with similarities to those observed in IL-9 transgenic mice, is eosinophilic cystitis (42). This is an uncommon condition in which inflammation of the bladder, and occasionally ureter (43), results in scarring and often obstruction and hydronephrosis. It is associated in some cases with allergic responses, hyper-IgE, and eosinophilic syndromes (42, 44). These associations, together with the similar ureteric pathology seen in IL-9 transgenics, suggest a potential role for IL-9 in initiation of this condition as well.

In agreement with previous reports (11, 12), our IL-9 transgenic mice show increased levels of serum Igs and expansion of peritoneal B-1 cells (data not shown). However, by contrast, we also observed an increase in circulating autoantibodies in our lines of IL-9 transgenic mice. Although the Th2 cytokines, IL-4 and IL-5, have both been linked to autoantibody production, a role for IL-9 in this process has not been reported (12, 31, 35). We were therefore interested to determine whether the production of autoantibodies in our IL-9 transgenic mice was dependent upon other Th2 cytokines. IL-9 has been shown to synergize with IL-4 in the production of IgE and IgG1 (4), and IL-4 was therefore a potential candidate in IL-9-mediated autoantibody production. Autoantibody production in the IL-9 transgenic mice was shown to be independent of IL-4 and IL-13, indicating that IL-9 must induce autoantibodies by a different mechanism. The development of autoantibodies in these IL-9 transgenic mice was also shown to be independent of IL-5. By contrast, the compound disruption of IL-4, IL-5, and IL-13 resulted in the ablation of autoantibodies, indicating that Th2 cytokines act in combination in the development of IL-9-mediated autoantibody production. Significantly, by intercrossing IL-9 transgenic mice with cytokine-deficient mice, we also demonstrate that the combined deletion of IL-4, IL-5, and IL-13 reduces B-1 cell numbers to levels similar to those found in the wild-type mice, indicating that IL-9-induced B-1 cell expansion is at least partially dependent on the other Th2 cytokines, and that the reduction in B-1 cells correlates with the absence of autoantibodies. Peritoneal B-1 cells are known to produce natural Abs that have been shown to act in the innate immune response by opsonizing bacteria and facilitating their destruction (45, 46). These natural Abs help control bacterial and other infections until the adaptive immune response is initiated. Although these B cell subsets can clearly be beneficial in innate defense against pathogens, in some cases B-1 cells are known to secrete autoantibodies and contribute to autoimmune disease (47). B-1 cells have been shown to produce autoreactive Abs in rheumatoid arthritis (48), and in some models ablation of B-1 cells can prevent autoimmunity (49, 50). Thus, IL-9 appears to act by enhancing the effects of the other Th2 cytokines in their regulation of B-1 cell numbers and of hypergammaglobulinemia. Although we always detected elevated numbers of peritoneal B-1 cells in IL-9 transgenic mice, there were occasions when this did not correlate with increased levels of serum autoantibodies. Due to the complexity of the syndrome observed in these IL-9 transgenic mice, the significance of this observation is unclear, but may indicate that another event(s) is required before the autoantibody levels increase detectably. Why the systemic expression of IL-9 did not lead to autoantibodies is not clear (12); however, it should be emphasized that in our transgenic lines, IL-9 expression is driven by the mouse IL-9 promoter, and this presumably facilitates the production of IL-9 by T cells in close apposition with B cells, possibly creating a more effective mechanism for driving autoantibody production.

Our results clearly demonstrate that overexpression of IL-9 can lead to profound pathological consequences, resulting in an increased probability of developing T cell lymphoma, hydronephrosis, and autoantibody production. Using a panel of cytokine-deficient mice, we have demonstrated that the IL-9-induced development of lymphomas occurs independently of IL-4, IL-5, and IL-13 (Table II). By contrast, we have also demonstrated that IL-9 is differentially dependent on IL-4, IL-5, and IL-13 for the induction of hydronephrosis and autoantibody production (Table II). The IL-9 transgenic mice should prove interesting for the future investigation of the role of this cytokine in disease processes.


View this table:
[in this window]
[in a new window]
 
Table II. IL-9-induced pathologies are differentially dependent on Th2 cytokine expressiona

 


    Acknowledgments
 
We thank David Matthews and Sarah Bell for helpful discussions and advice on the manuscript, D. Kioussis for the gift of the human CD2 LCR vector, Dr. Tony Warford for comments on tissue histology, and the Medical Research Council Small Animal Barrier Unit staff for technical assistance.


    Footnotes
 
1 This work was supported by the British Medical Research Council and a Leukemia Research Fund grant (to A.J.L., A.D., and P.S.). P.G.F. is supported by the Wellcome Trust and by Science Foundation Ireland. Back

2 Current address: Department of Clinical Neurobiology, University of Heidelberg, Im Neuenheimer Feld 364, 69120 Heidelberg, Germany. Back

3 Address correspondence and reprint requests to Dr. Andrew N. J. McKenzie, Medical Research Council Laboratory of Molecular Biology, Hills Road, Cambridge, CB2 2QH, U.K. E-mail address: anm{at}mrc-lmb.cam.ac.uk Back

4 Abbreviations used in this paper: LCR, locus control region; ANA, anti-nuclear Ab; HPRT, hypoxanthine phosphoribosyltransferase; KO, knockout. Back

Received for publication September 18, 2003. Accepted for publication April 26, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Van Snick, J., A. Goethals, J. C. Renauld, E. Van Roost, C. Uyttenhove, M. R. Rubira, R. L. Moritz, R. J. Simpson. 1989. Cloning and characterization of a cDNA for a new mouse T cell growth factor (P40). J. Exp. Med. 169:363.[Abstract/Free Full Text]
  2. Hultner, L., C. Druez, J. Moeller, C. Uyttenhove, E. Schmitt, E. Rude, P. Dormer, J. Van Snick. 1990. Mast cell growth-enhancing activity (MEA) is structurally related and functionally identical to the novel mouse T cell growth factor P40/TCGFIII (interleukin 9). Eur. J. Immunol. 20:1413.[Medline]
  3. Bourette, R. P., J. Royet, G. Mouchiroud, E. Schmitt, J. P. Blanchet. 1992. Murine interleukin 9 stimulates the proliferation of mouse erythroid progenitor cells and favors the erythroid differentiation of multipotent FDCP-mix cells. Exp. Hematol. 20:868.[Medline]
  4. Petit-Frere, C., B. Dugas, P. Braquet, J. M. Mencia-Huerta. 1993. Interleukin-9 potentiates the interleukin-4-induced IgE and IgG1 release from murine B lymphocytes. Immunology 79:146.[Medline]
  5. Marsh, D. G., J. D. Neely, D. R. Breazeale, B. Ghosh, L. R. Freidhoff, E. Ehrlich-Kautzky, C. Schou, G. Krishnaswamy, T. H. Beaty. 1994. Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 264:1152.[Abstract/Free Full Text]
  6. Nicolaides, N. C., K. J. Holroyd, S. L. Ewart, S. M. Eleff, M. B. Kiser, C. R. Dragwa, C. D. Sullivan, L. Grasso, L. Y. Zhang, C. J. Messler, et al 1997. Interleukin 9: a candidate gene for asthma. Proc. Natl. Acad. Sci. USA 94:13175.[Abstract/Free Full Text]
  7. Shimbara, A., P. Christodoulopoulos, A. Soussi-Gounni, R. Olivenstein, Y. Nakamura, R. C. Levitt, N. C. Nicolaides, K. J. Holroyd, A. Tsicopoulos, J. J. Lafitte, et al 2000. IL-9 and its receptor in allergic and nonallergic lung disease: increased expression in asthma. J. Allergy Clin. Immunol. 105:108.[Medline]
  8. Merz, H., F. A. Houssiau, K. Orscheschek, J. C. Renauld, A. Fliedner, M. Herin, H. Noel, M. Kadin, H. K. Mueller-Hermelink, J. Van Snick, et al 1991. Interleukin-9 expression in human malignant lymphomas: unique association with Hodgkin’s disease and large cell anaplastic lymphoma. Blood 78:1311.[Abstract/Free Full Text]
  9. Gruss, H. J., M. A. Brach, H. G. Drexler, K. J. Bross, F. Herrmann. 1992. Interleukin 9 is expressed by primary and cultured Hodgkin and Reed-Sternberg cells. Cancer Res. 52:1026.[Abstract/Free Full Text]
  10. Uyttenhove, C., C. Druez, J. C. Renauld, M. Herin, H. Noel, J. Van Snick. 1991. Autonomous growth and tumorigenicity induced by P40/interleukin 9 cDNA transfection of a mouse P40-dependent T cell line. J. Exp. Med. 173:519.[Abstract/Free Full Text]
  11. Renauld, J. C., N. van der Lugt, A. Vink, M. van Roon, C. Godfraind, G. Warnier, H. Merz, A. Feller, A. Berns, J. Van Snick. 1994. Thymic lymphomas in interleukin 9 transgenic mice. Oncogene 9:1327.[Medline]
  12. Vink, A., G. Warnier, F. Brombacher, J. C. Renauld. 1999. Interleukin 9-induced in vivo expansion of the B-1 lymphocyte population. J. Exp. Med. 189:1413.[Abstract/Free Full Text]
  13. Temann, U. A., G. P. Geba, J. A. Rankin, R. A. Flavell. 1998. Expression of interleukin 9 in the lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, and bronchial hyperresponsiveness. J. Exp. Med. 188:1307.[Abstract/Free Full Text]
  14. Temann, U. A., P. Ray, R. A. Flavell. 2002. Pulmonary overexpression of IL-9 induces Th2 cytokine expression, leading to immune pathology. J. Clin. Invest. 109:29.[Medline]
  15. Townsend, J. M., G. P. Fallon, J. D. Matthews, P. Smith, E. H. Jolin, N. A. McKenzie. 2000. IL-9-deficient mice establish fundamental roles for IL-9 in pulmonary mastocytosis and goblet cell hyperplasia but not T cell development. Immunity 13:573.[Medline]
  16. Greaves, D. R., F. D. Wilson, G. Lang, D. Kioussis. 1989. Human CD2 3'-flanking sequences confer high-level, T cell-specific, position-independent gene expression in transgenic mice. Cell 56:979.[Medline]
  17. Hogan, B., R. Beddington, F. Costantini, E. Lacey. 1994. Manipulation of the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  18. Simpson, R. J., R. L. Moritz, M. R. Rubira, J. J. Gorman, J. Van Snick. 1989. Complete amino acid sequence of a new murine T-cell growth factor P40. Eur. J. Biochem. 183:715.[Medline]
  19. Fallon, P. G., H. E. Jolin, P. Smith, C. L. Emson, M. J. Townsend, R. Fallon, A. N. McKenzie. 2002. IL-4 induces characteristic Th2 responses even in the combined absence of IL-5, IL-9, and IL-13. Immunity 17:7.[Medline]
  20. McKenzie, G. J., P. G. Fallon, C. L. Emson, R. K. Grencis, A. N. J. McKenzie. 1999. Simultaneous disruption of interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type 2-mediated responses. J. Exp. Med. 189:1565.[Abstract/Free Full Text]
  21. Ho, I. C., M. R. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  22. Fallon, P. G., P. Smith, E. J. Richardson, F. J. Jones, H. C. Faulkner, J. Van Snick, J. C. Renauld, R. K. Grencis, D. W. Dunne. 2000. Expression of interleukin-9 leads to Th2 cytokine-dominated responses and fatal enteropathy in mice with chronic Schistosoma mansoni infections. Infect. Immun. 68:6005.[Abstract/Free Full Text]
  23. Clynes, R., C. Dumitru, J. V. Ravetch. 1998. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 279:1052.[Abstract/Free Full Text]
  24. McKenzie, G. J., C. L. Emson, S. E. Bell, S. Anderson, P. Fallon, G. Zurawski, R. Murray, R. Grencis, A. N. McKenzie. 1998. Impaired development of Th2 cells in IL-13-deficient mice. Immunity 9:423.[Medline]
  25. Emson, C. L., S. E. Bell, A. Jones, W. Wisden, A. N. J. McKenzie. 1998. Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13. J. Exp. Med. 188:399.[Abstract/Free Full Text]
  26. Stein, H., H. D. Foss, H. Durkop, T. Marafioti, G. Delsol, K. Pulford, S. Pileri, B. Falini. 2000. CD30+ anaplastic large cell lymphoma: a review of its histopathologic, genetic, and clinical features. Blood 96:3681.[Abstract/Free Full Text]
  27. Taylor, D. M., H. Fraser. 1973. Hydronephrosis in inbred strains of mice with particular reference to the BRVR strain. Lab. Anim. 7:229.[Abstract/Free Full Text]
  28. Godfraind, C., J. Louahed, H. Faulkner, A. Vink, G. Warnier, R. Grencis, J. C. Renauld. 1998. Intraepithelial infiltration by mast cells with both connective tissue-type and mucosal-type characteristics in gut, trachea, and kidneys of IL-9 transgenic mice. J. Immunol. 160:3989.[Abstract/Free Full Text]
  29. Plaut, M., J. H. Pierce, C. J. Watson, J. Hanley-Hyde, R. P. Nordan, W. E. Paul. 1989. Mast cell lines produce lymphokines in response to cross-linkage of Fc{epsilon}RI or to calcium ionophores. Nature 339:64.[Medline]
  30. Finkelman, F. D., J. Holmes, I. M. Katona, J. F. Urban, Jr, M. P. Beckmann, L. S. Park, K. A. Schooley, R. L. Coffman, T. R. Mosmann, W. E. Paul. 1990. Lymphokine control of in vivo immunoglobulin isotype selection. Annu. Rev. Immunol. 8:303.[Medline]
  31. Erb, K. J., B. Ruger, M. von Brevern, B. Ryffel, A. Schimpl, K. Rivett. 1997. Constitutive expression of interleukin (IL)-4 in vivo causes autoimmune-type disorders in mice. J. Exp. Med. 185:329.[Abstract/Free Full Text]
  32. Hardy, R. R., K. Hayakawa. 2001. B cell development pathways. Annu. Rev. Immunol. 19:595.[Medline]
  33. Martin, F., A. M. Oliver, J. F. Kearney. 2001. Marginal zone and B1 B cells unite in the early response against T-independent blood-borne particulate antigens. Immunity 14:617.[Medline]
  34. Kopf, M., F. Brombacher, P. D. Hodgkin, A. J. Ramsay, E. A. Milbourne, W. J. Dai, K. S. Ovington, C. A. Behm, G. Kohler, I. G. Young, K. I. Matthaei. 1996. IL-5-deficient mice have a developmental defect in CD5+ B-1 cells and lack eosinophilia but have normal antibody and cytotoxic T cell responses. Immunity 4:15.[Medline]
  35. Tominaga, A., S. Takaki, N. Koyama, S. Katoh, R. Matsumoto, M. Migita, Y. Hitoshi, Y. Hosoya, S. Yamauchi, Y. Kanai, et al 1991. Transgenic mice expressing a B cell growth and differentiation factor gene (interleukin 5) develop eosinophilia and autoantibody production. J. Exp. Med. 173:429.[Abstract/Free Full Text]
  36. Uyttenhove, C., R. J. Simpson, J. Van Snick. 1988. Functional and structural characterization of P40, a mouse glycoprotein with T-cell growth factor activity. Proc. Natl. Acad. Sci. USA 85:6934.[Abstract/Free Full Text]
  37. Renauld, J. C., A. Goethals, F. Houssiau, E. Van Roost, J. Van Snick. 1990. Cloning and expression of a cDNA for the human homolog of mouse T cell and mast cell growth factor P40. Cytokine 2:9.[Medline]
  38. Chiaramonte, M. G., D. D. Donaldson, A. W. Cheever, T. A. Wynn. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response. J. Clin. Invest. 104:777.[Medline]
  39. Fallon, P. G., E. J. Richardson, G. J. McKenzie, A. N. McKenzie. 2000. Schistosome infection of transgenic mice defines distinct and contrasting pathogenic roles for IL-4 and IL-13: IL-13 is a profibrotic agent. J. Immunol. 164:2585.[Abstract/Free Full Text]
  40. Clouthier, D. E., S. A. Comerford, R. E. Hammer. 1997. Hepatic fibrosis, glomerulosclerosis, and a lipodystrophy-like syndrome in PEPCK-TGF-{beta}1 transgenic mice. J. Clin. Invest. 100:2697.[Medline]
  41. Van der Werf, M. J., S. J. de Vlas, S. Brooker, C. W. Looman, N. J. Nagelkerke, J. D. Habbema, D. Engels. 2003. Quantification of clinical morbidity associated with schistosome infection in sub-Saharan Africa. Acta Trop. 86:125.[Medline]
  42. Verhagen, P. C., P. G. Nikkels, T. P. de Jong. 2001. Eosinophilic cystitis. Arch. Dis. Child. 84:344.[Abstract/Free Full Text]
  43. Spark, R. P., D. M. Gleason, C. D. DeBenedetti, J. H. Gigax. 1991. Is eosinophilic ureteritis an entity? 2 case reports and review. J. Urol. 145:1256.[Medline]
  44. Matsuura, H., M. Sakurai, K. Arima. 2003. Recurrent eosinophilic cystitis with peripheral eosinophilia and hyperimmunoglobulinemia E. Urol. Int. 70:327.[Medline]
  45. Briles, D. E., C. Forman, S. Hudak, J. L. Claflin. 1982. Anti-phosphorylcholine antibodies of the T15 idiotype are optimally protective against Streptococcus pneumoniae. J. Exp. Med. 156:1177.[Abstract/Free Full Text]
  46. Casali, P., E. W. Schettino. 1996. Structure and function of natural antibodies. Curr. Top. Microbiol. Immunol. 210:167.[Medline]
  47. Rothstein, T. L.. 2002. Cutting edge commentary: two B-1 or not to be one. J. Immunol. 168:4257.[Abstract/Free Full Text]
  48. Burastero, S. E., P. Casali, R. L. Wilder, A. L. Notkins. 1988. Monoreactive high affinity and polyreactive low affinity rheumatoid factors are produced by CD5+ B cells from patients with rheumatoid arthritis. J. Exp. Med. 168:1979.[Abstract/Free Full Text]
  49. Murakami, M., T. Tsubata, R. Shinkura, S. Nisitani, M. Okamoto, H. Yoshioka, T. Usui, S. Miyawaki, T. Honjo. 1994. Oral administration of lipopolysaccharides activates B-1 cells in the peritoneal cavity and lamina propria of the gut and induces autoimmune symptoms in an autoantibody transgenic mouse. J. Exp. Med. 180:111.[Abstract/Free Full Text]
  50. Murakami, M., H. Yoshioka, T. Shirai, T. Tsubata, T. Honjo. 1995. Prevention of autoimmune symptoms in autoimmune-prone mice by elimination of B-1 cells. Int. Immunol. 7:877.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
V. Steenwinckel, J. Louahed, C. Orabona, F. Huaux, G. Warnier, A. McKenzie, D. Lison, R. Levitt, and J.-C. Renauld
IL-13 Mediates In Vivo IL-9 Activities on Lung Epithelial Cells but Not on Hematopoietic Cells
J. Immunol., March 1, 2007; 178(5): 3244 - 3251.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Okazaki, Y. Otaka, J. Wang, H. Hiai, T. Takai, J. V. Ravetch, and T. Honjo
Hydronephrosis associated with antiurothelial and antinuclear autoantibodies in BALB/c-Fcgr2b-/-Pdcd1-/- mice
J. Exp. Med., December 19, 2005; 202(12): 1643 - 1648.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lauder, A. J.
Right arrow Articles by McKenzie, A. N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lauder, A. J.
Right arrow Articles by McKenzie, A. N. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS