|
|
||||||||



* Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom;
Department of Pathology, Academic Medical Center, Amsterdam, The Netherlands;
Cambridge Institute for Medical Research and Department of Medicine, University of Cambridge School of Clinical Medicine, Addenbrookes Hospital, Cambridge, United Kingdom; and
Immunomodulation Group, Department of Biochemistry, Trinity College, Dublin, Ireland
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although IL-9 has been implicated in asthma and allergy, its role in such pathology remains unclear. However, expression of IL-9 transgenes under the control of a lung-specific promoter leads to severe airway inflammation with infiltration of eosinophils and lymphocytes, mast cell hyperplasia, and increased subepithelial collagen deposition (13). Further analysis of mice harboring inducible, lung-specific, IL-9 transgenes indicated that much of the pathology induced by IL-9 expression was in fact due to the downstream effects of the other Th2 cytokines (14). Indeed, data from our own studies using IL-9-deficient mice demonstrated that although IL-9 was critical for the rapid induction of pulmonary goblet cell hyperplasia and mastocytosis following lung challenge, it was functionally redundant thereafter (15).
Because IL-9 is expressed primarily by activated T cells, we have generated transgenic mice in which the mouse IL-9 transgene is regulated by its own promoter elements in conjunction with the human CD2 locus control region (LCR).4 This should allow us to examine the effect of IL-9 overexpression in a more physiological tissue distribution. Strikingly, these mice die prematurely following the development of complex pathology, which includes hydronephrosis, the production of autoantibodies, and a high incidence of T cell lymphomas. By intercrossing with Th2 cytokine-deficient mice, we have determined that the autoantibody phenotype, hydronephrosis, and T cell lymphomas are differentially dependent on Th2 cytokine expression.
| Materials and Methods |
|---|
|
|
|---|
A 6.0-kb BamHI-digested genomic DNA fragment containing the complete mouse IL-9 gene was cloned into a BamHI site upstream of the human CD2 LCR (16) in the vector GSE1515 (kindly supplied by D. Kioussis, National Institute of Medical Research, London, U.K.). The IL-9 gene and CD2 LCR fusion were isolated as an 11.5-kb NotI fragment and injected into oocytes. Transgenic mice (strain CBA x C57BL/6) were generated using standard protocols (17). Transgenic mice were identified using Southern blot analysis of genomic DNA hybridized with the CD2 LCR or the murine IL-9 cDNA (18). In the experiments presented, transgenic lines IL-9Tg1, IL-9Tg2, and IL-9Tg3 had been backcrossed at least six generations onto strain C57BL/6. IL-9Tg1 mice were crossed with IL-5-deficient mice (IL-5 knockout (KO)) (19) to derive IL-9Tg + IL-5KO offspring, IL-4/13-deficient mice (IL-4/13KO) (20) to derive IL-9Tg + IL-4/13KO offspring, or were crossed with IL-4/5/13-deficient mice (19) to derive IL-9Tg + IL-4/5/13KO. In these experiments, transgenic mice were on an equivalent C57BL/6 x 129 background and were compared with littermate controls. Mice were maintained in a specific pathogen-free animal facility.
RNA/cDNA preparation
The heart, lungs, liver, spleen, kidney, and thymus were removed from 2-mo-old mice, and RNA was prepared using RNAzol (Biogenesis, Poole, U.K.), according to the manufacturers instruction. Reverse-transcription reaction: 1 µg of total RNA was reverse transcribed using 5 µg/ml oligo(dT)18 (New England Biolabs, Beverly, MA) and 20 U of superscript reverse transcription (HT Biotechnology, Cambridge, U.K.) in a volume of 20 µl with the supplied reverse-transcription buffer before digestion of the RNA template with 1 U of RNase H (USB, Cleveland, OH).
Real-time RT-PCR for IL-9 mRNA
PCR primers and probes were designed using the Primer express program (PerkinElmer, Wellesley, MA). Multiplex PCR was performed using the Taqman sequence detector (PerkinElmer) with the following hypoxanthine phosphoribosyltransferase (HPRT) and IL-9 primers/probes (reaction concentrations indicated in parentheses). HPRT forward, TTAAGCAGTACAGCCCCAAAATG (0.3 µM); HPRT reverse, CAAACTTGTCTGGAATTTCAAATCC (0.3 µM); HPRT probe, CCTTTTCACCAGCAAGCTTGCAACCTTA (0.125 µM, labeled 5' with fluorescent dye VIC and 3' TAMRA). IL-9 forward, AACGTGACCAGCTGCTTGTGT (0.9 µM); IL-9 reverse, TGGCATTGGTCAGCTGTAACA (0.9 µM); IL-9 probe, CCGTCCCAACTGATGATTGTACCACAC (0.15 µM, labeled 5' FAM and 3' with fluorescent dye TAMRA). IL-9 expression levels were quantified relative to the internal HPRT control before comparison of mRNA levels between the different transgenic lines.
Determination of transgene copy number by genomic DNA PCR
Genomic DNA samples from the different lines were subject to quantitative PCR using primers designed to amplify the IL-9 gene. The c-Maf gene was assessed as a single copy gene control (21). The genomic DNA was tested across a range of dilutions to ensure that the IL-9 and c-Maf DNA were amplified at a comparable rate. The IL-9 transgene copy number was then determined relative to the c-Maf internal control. Analysis of wild-type genomic DNA served as a further control, indicating the expected 1:1 ratio of IL-9 to c-Maf. Primer/Probe design and PCR conditions were as described above. IL-9 genomic forward primer, TTGTTATTTACCAGGATGATTGTACCA (0.3 µM); IL-9 genomic reverse primer, TTCTTTAGGACTTCAACTATCCTTTTCA (0.3 µM); IL-9 genomic probe, AATCAAGACTCTTGCCTGTTTTCCATCGG (0.175 µM, 5' FAM and 3' TAMRA). c-Maf genomic forward primer, AAGAGGCGGACCCTGAAAA (0.6 µM); c-Maf genomic reverse primer, CTGCAGCAGCTGGTTCTTCTC (0.6 µM); c-Maf genomic probe, CGGCTATGCCCAGTCCTGCCG (0.17 µM, 5' FAM and 3' TAMRA).
Flow cytometric analysis
RBC were removed from splenocyte suspensions using a 5-min incubation in lysis solution (150 mM Tris base, 19 mM ammonium chloride, pH 7.2), followed by two washes in medium containing 10% FCS. For each stain, 1 x 106 splenocytes were suspended in 200 µl of FACS medium (PBS, 5% FCS, 0.05% sodium azide). Cells were treated with 2.5 µg/ml anti-mouse CD16/CD32 (FcR
III/II) (clone 2.4G2; BD Pharmingen, San Diego, CA) for 15 min before staining with FITC-conjugated anti-mouse CD4 (clone L3T4; BD Pharmingen) and PE-conjugated anti-mouse CD8 (clone 53-6.7; BD Pharmingen). The stained cells were washed twice in FACS medium and then analyzed on a FACSCalibur (BD Biosciences, San Jose, CA).
To analyze tumor clonality, splenocytes were stained with PE-conjugated anti-mouse CD4 and anti-mouse CD8, and then with individual Abs from the 15 FITC-conjugated anti-mouse TCR
Abs in a screening panel (BD Pharmingen).
To determine the proliferative status of the cells, splenocytes were washed in PBS and then suspended in permeabilization buffer (PBS, 0.03% saponin (Sigma-Aldrich, St. Louis, MO), 0.1% Na azide) in the presence of 25 µg/ml 7-aminoactinomycin D (Sigma-Aldrich) for 45 min at 37°C. Cell doublets were excluded using a FL3 area vs width gate, and the DNA content of the cells was plotted. All FACS analysis was performed using CellQuest software (BD Biosciences).
Peritoneal B-1 cell analysis
Peritoneal cells were obtained by peritoneal lavage and were incubated with 2.5 µg/ml anti-mouse CD16/CD32 (FcR
III/II, clone 2.4G2; BD Pharmingen), then stained with PE-conjugated anti-mouse CD5 (clone 53-7.3; BD Pharmingen), FITC-conjugated anti-mouse IgM (clone R6-60.2; BD Pharmingen), and Tri-color-conjugated anti-mouse Mac1 (CD11b; Caltag Laboratories, Burlingame, CA). The percentage of B-1 cells was calculated as the number of B-1 cells (IgM+/Mac1+) present in a total lymphocyte gate. The lymphocyte gate was defined by forward and side scatter profiles to exclude dead cells and larger nonlymphocytic cells. To compare B-1a/B-1b cells, the lymphocyte gate was combined with a B-1 cell gate (IgM+/Mac1+) and the B-1 cells plotted against CD5 expression to differentiate between B-1a (CD5+) and B-1b cells (CD5). To calculate the actual number of B-1a and B-1b cells, the percentage of peritoneal cells that were B-1a and B-1b was multiplied by the total number of cells retrieved from the peritoneal cavity.
Histology and immunocytochemistry
IL-9 transgenic mice from all three lines, varying from diseased to overtly normal, were culled together with age-matched wild-type littermates, and organs were processed for histology, as described (22). The liver, lungs, spleen, thymus, and kidneys were fixed in 10% formaldehyde in saline and paraffin embedded, and serial 4-µm sections were cut. Sections were stained to study tissue integrity and cell infiltration (H&E), mastocytosis (toluidine blue), mucus hyperplasia (periodic acid Schiff), fibrosis (martius scarlet blue), and eosinophilia (Giemsa). All slides were numerically coded, and organs were examined independently by two investigators. Cell infiltrates were further characterized by an investigator unaware of the source of the tissue. Organs from the three transgenic lines were scored arbitrarily: , normal; +, minor tissue alterations; ++, moderate tissue changes; and +++, advanced tissue disorganization.
Immune complex (IgG) and C3 complement deposition in kidney glomeruli were analyzed by immunofluorescent staining, as described (23). Kidneys from IL-9Tg mice with visible swelling in both kidneys, one kidney affected, or with normal sized kidneys were snap frozen, cryosectioned, and acetone fixed. Kidneys from wild-type littermates were used as controls. Sections were stained with FITC-conjugated goat anti-mouse C3 or IgG (1/1000 dilution; Valeant Pharmaceuticals, Basingstoke, U.K. Germany). Spleen and thymus sections were stained for CD30 expression on cells by immunohistochemistry using a goat anti-mouse CD30+ Ab (R&D Systems, Abingdon, U.K.).
Cell transfer
Tumor cells were freshly prepared from the thymus of IL-9 transgenic mice that had developed lymphoma. A homogeneous single-cell suspension was prepared, and 1 x 106 cells were injected i.p. into 10 C57BL/6 mice. All injected mice developed swollen abdomens between 16 and 21 days postinjection due to increased peritoneal cellularity and enlargement of lymph nodes.
Serum Ab ELISA
IgG autoantibodies against nuclear Ags (ANA) and dsDNA were assayed using ELISA kits (Alpha Diagnostic International, San Antonio, TX), according to the manufacturers protocol. OD values were determined simultaneously for the IL-9 transgenic and wild-type controls, and all plates contained a positive control to ensure that samples were in the linear range. ELISA for serum Abs was performed, as described previously (24).
| Results |
|---|
|
|
|---|
Because IL-9 is produced primarily by activated T cells, we wished to assess the role of IL-9 overexpression by the T cell compartment. To achieve this goal, we generated a number of novel IL-9 transgenic mouse lines using a construct in which the native mouse IL-9 gene, including
1 kb of upstream sequence, was fused to the human CD2 locus control region (Fig. 1A). This construct is therefore regulated by the endogenous mouse IL-9 promoter, while the CD2 LCR has been used to successfully enhance T cell-specific expression of transgenes by overcoming position-dependent integration effects (16). Using oocyte injection, several transgenic founders were generated, and these varied in the number of integrated copies of the IL-9 transgene. Three founders were used to establish independent transgenic lines denoted IL-9Tg1, IL-9Tg2, and IL-9Tg3. The IL-9 transgene was present at a high copy number in all three lines: IL-9Tg1 (41 ± 6 copies), IL-9Tg2 (27 ± 4 copies), and IL-9Tg3 (93 ± 13 copies). As anticipated from previous studies, transgene expression was copy number dependent (16, 25), with IL-9 mRNA levels highest in the IL-9Tg3 line. All transgenic lines expressed elevated levels of IL-9 mRNA in a spectrum of tissues, with levels ranging from 10- to 20,000-fold higher than the corresponding wild-type tissues (Fig. 1B). Although apparently high, these levels are comparable with the increases in IL-9 gene transcription in the lymph nodes of wild-type mice following helminth infection (data not shown). Furthermore, measurement of IL-9 in serum demonstrated a mean level of 97.5 pg/ml IL-9 in the IL-9Tg1 line (n = 6, SEM 41 pg/ml) and a mean level of 270 pg/ml IL-9 in the IL-9Tg3 line (n = 9, SEM 72 pg/ml) when compared with wild-type IL-9 levels with a mean of 9 pg/ml (n = 8, SEM 11 pg/ml; most wild-type samples had no detectable IL-9 or levels at the limit of detection, i.e., 2030 pg/ml) (data not shown). It is noteworthy that the use of the IL-9 gene and promoter recapitulates the expression profile observed in the wild-type tissues, with the highest levels detected in the thymus, spleen, and lung.
|
T cell lymphomas develop in IL-9 transgenic mice
We found that a large proportion of the IL-9 transgenic animals had a severe lymphoproliferative disorder resulting in highly enlarged lymphoid tissues (Fig. 2A) and lymphoid infiltration into other tissues. FACS analysis revealed that in all three transgenic lines, the enlarged lymphoid tissues were due to expansion of either CD4/CD8 double-positive or CD8 single-positive T lymphocytes (Fig. 2B). The surface marker phenotype of the lymphomas was not restricted to a particular transgenic line, as both CD4/CD8 double-positive and CD8 single-positive lymphomas were found in all three (see Table I). No examples of CD4 single-positive lymphomas have been detected. The cells were highly proliferative with
20% of isolated tumor cells in the S/G2/M phase of the cell cycle (Fig. 2C). No alterations were observed in the B-2 cell compartment (data not shown).
|
|
-specific Abs. In a wild-type mouse, each 
T cell expresses a single TCR
chain with between 1 and 15% of 
T cells expressing any given
-chain (data not shown). Analysis of IL-9 lymphomas revealed that a large proportion of the T cells expressed the same TCR
chain, indicating that the infiltrates were monoclonal. In the example shown in Fig. 2D, 90% of the T cells from a grossly enlarged spleen stained positive with the V
5.1/5.2-specific Ab, clearly indicating clonal expansion. Analysis of seven different lymphomas indicated that they were all clonal, but, as expected, the V
TCR chain usage changed between different lymphomas (Fig. 2E). Furthermore, successful transplantation of tumor cells from IL-9 transgenic mice, by i.p. injection into wild-type syngeneic animals, demonstrated formally that the observed lymphomas resulted from tumoral transformation. Because IL-9 expression has been associated with Hodgkins disease, we looked for two characteristics of this disease, Reed-Sternberg-like cells and CD30 expression (26). Neither was found in any lymphoma (data not shown). In addition, FACS analysis revealed normal B cell numbers.
Collectively, these data demonstrate that these IL-9 transgenic mice develop T cell lymphomas with some of the phenotypic features of T lymphoblastic lymphoma. Their incidence ranges from
40% in the IL-9Tg1 line to
85% of the IL-9 transgenic animals in the higher copy number IL-9Tg3 line (Table I). Animals were diagnosed with lymphomas between the ages of 7 wk to 1 year, with the mean age of onset between 16 and 20 wk (Table I). IL-9Tg3 animals developed lymphomas more rapidly than the other lines, probably due to their higher levels of IL-9 expression.
Widespread tissue disruption due to lymphoma in IL-9 transgenic mice
To characterize the pathology of the lymphomas, a histological examination of a range of tissues was undertaken. Spleen, thymus, lung, and liver samples from both apparently healthy and diseased animals were examined histologically, revealing progressive disease in all tissues examined. This was characterized by an initial perivascular infiltrate progressing to more extensive infiltration and tissue disruption (Fig. 3). Infiltration in the thymus of IL-9 transgenic mice was associated with prominent tingible body macrophages containing lymphocyte debris, and with almost complete replacement of normal thymic tissue by lymphoma (Fig. 3, AC). Similarly, in the spleen, the normal red and white pulp structure (Fig. 3D) was replaced with a homogenous lymphocytic infiltrate (Fig. 3, E and F). In the liver, widespread lymphocyte infiltration resulted in marked disorganization of the normal hepatic architecture (Fig. 3, GI). When compared with the lungs of wild-type mice (Fig. 3J), IL-9 transgenic lungs displayed perivascular, alveolar, and interstitial lymphocytic lymphomatous infiltrates (Fig. 3, K and L).
|
Strikingly, in addition to the high incidence of lymphoma, a large number of the IL-9 transgenic mice developed hydronephrosis (enlarged fluid-filled kidneys usually caused by distal obstruction to urinary flow; Fig. 4A). Normal mice rarely develop hydronephrosis, with a reported incidence of only 0.51.5% in certain inbred C57BL strains (27), and we have observed no hydronephrosis in wild-type littermates of the IL-9 transgenic mice. Seventy-five percent of the IL-9Tg1 animals displayed either unilateral or bilateral hydronephrosis, either as the only abnormality noted (43%) or in conjunction with lymphoma (32%) (Table I). This suggested that the hydronephrosis was not secondary to urinary obstruction by lymphomas. Hydronephrosis was also observed in the other IL-9 transgenic lines (Table I), indicating that the defect was due to the IL-9 transgene and not to a specific integration effect. The lower incidence of hydronephrosis observed in IL-9Tg3 animals may reflect the more rapid onset of lymphoma (mean age of onset 16 wk) in this line, which pre-empts the development of kidney disease (mean age of onset 27 wk).
|
Elevated serum autoantibodies, increased B-1 cells, and glomerular immune-complex deposition in IL-9 transgenic mice
Because overexpression of Th2 cytokines can lead to both increased Ab titers (30), and in some cases autoimmunity (31), we assayed the levels of serum Ig isotypes and autoantibodies in IL-9 transgenic mice. IL-9 transgenic mice had highly elevated levels of IgA and IgE, and moderate increases in IgG1, IgG2b, and IgM (Fig. 5A). The sera from IL-9 transgenic and wild-type littermates were also assayed for ANA or autoantibodies against dsDNA. To account for possible differences due to age, each transgenic mouse was paired with a wild-type littermate. The fold increase in autoantibodies (as determined by OD reading) was then calculated from the transgenic and wild-type littermate values. Of the 22 pairs analyzed, in 18 cases the transgenic animals had higher levels of ANA and of autoantibodies against dsDNA (Fig. 5B). The average increase in ANA in the IL-9 transgenic mice was 3.6-fold compared with wild-type levels, and for anti-dsDNA autoantibodies it was 5.5-fold. These 18 transgenic animals included apparently healthy transgenic animals, and mice with hydronephrosis and/or lymphomas. If only the animals with hydronephrosis are included in the analysis, then the increase in autoantibody levels rises to 3.8-fold for ANA (n = 10) and to 7.4-fold for anti-dsDNA autoantibodies (n = 12). Furthermore, analysis of 10 age-matched and apparently healthy IL-9 transgenic mice (4 mo of age) as compared with 10 wild-type controls demonstrated a statistically significant increase in ANA in the transgenic mice (n = 10, unpaired t test p = 0.0063). However, within such cohorts, some IL-9 transgenic mice did not produce autoantibodies. These results suggest that while the up-regulation of IL-9 predisposes to autoantibodies, an additional factor is required to induce their production. Given the complexity of the phenotypes observed in the IL-9 transgenic mice, it is possible that the events underlying lymphoma or hydronephrosis may modulate autoantibody expression. Glomerular deposition of IgG is commonly seen in mouse models that develop high levels of autoantibodies. Immunohistochemical examination of sections of transgenic kidneys before the apparent onset of hydronephrosis revealed significant glomerular deposition of IgG and C3 (Fig. 5C). However, this Ab deposition did not lead to glomerulonephritis or proteinuria (data not shown), and it is possible that Ab deposition may reflect a secondary event associated with the inflammatory processes observed in hydronephrosis or lymphoma.
|
5 times more B-1 cells than their wild-type counterparts (data not shown). Thus, an increase in B-1 cell numbers in the IL-9 transgenic mice was associated with elevated autoantibody production. Analysis of cytokine-deficient mice has indicated a role for Th2 cytokines in the generation of the B-1 subset (19, 34) (A. J. Lauder and A. N. J. McKenzie, manuscript in preparation), and so we wished to determine whether ablation of Th2 cytokines could reverse IL-9-induced autoantibody production. We therefore crossed our IL-9 transgenic mice with mice lacking one or more of the other Th2 cytokines. To determine whether IL-5 was promoting autoantibody production, as reported by Tominaga et al. (35), IL-9 transgenic mice were crossed with mice lacking IL-5 (IL-5KO). However, the absence of IL-5 failed to abrogate IL-9-mediated autoantibody production (Fig. 6A). IL-4 has also been linked to autoantibody production (31), and we therefore crossed IL-9 transgenic mice with mice lacking IL-4 and the related cytokine IL-13 (IL-4/13KO). Deletion of these two cytokines also failed to impair autoantibody production in IL-9 transgenic mice (Fig. 6B). Finally, IL-9 transgenic mice were crossed with mice lacking the three Th2 cytokines, IL-4, IL-5, and IL-13. Combined ablation of IL-4, IL-5, and IL-13 prevented the appearance of autoantibodies in the IL-9 transgenic mice (Fig. 6C). Elevated expression of IL-9 leads to hypergammaglobulinemia, and therefore IL-9 could be acting by enhancing production of all Abs, including autoantibodies. To address this possibility, we assessed whether the combined deletion of the Th2 cytokines had resulted in a significant fall in the level of total serum Ig induced by the IL-9 transgene. We found that there was no significant difference in the levels of total serum Ig in those mice harboring the IL-9 transgene in the presence of IL-4, IL-5, and IL-13, and IL-9 transgenic mice in the absence of IL-4, IL-5, and IL-13 (Fig. 6D). Both of these groups of IL-9 transgenic mice had levels of total serum Ig significantly higher than wild type. These data suggest that the combined absence of IL-4, IL-5, and IL-13 in the presence of the IL-9 transgene results in the preferential ablation of autoantibodies even in the presence of hypergammaglobulinemia.
|
|
| Discussion |
|---|
|
|
|---|
Expression of IL-9 has been detected in Hodgkins lymphoma cell lines and in the neoplastic Reed-Sternberg cells of primary Hodgkins tumors, indicating that IL-9 may play a role in the development of human cancers (8, 9). We have demonstrated that T cell-specific expression of IL-9 under the control of its own promoter and in conjunction with the human CD2 LCR results in a high penetrance of T cell lymphoma with up to 85% of animals affected. These animals spontaneously develop T cell lymphomas without exposure to mutagens, confirming a link between dysregulated IL-9 expression and the development of cancer. The potent tumorigenic effect of T cell-specific IL-9 expression observed in our study contrasts with systemic overexpression of IL-9, which results in only a low incidence of T cell lymphoma (11). Furthermore, lung-specific expression of IL-9 under the control of the rat Clara cell protein, CC10, promoter results in a broad asthma-like phenotype with no sign of tumorigenesis (13). Thus, the high incidence of lymphoma observed in our IL-9 transgenic mice may reflect the tissue specificity of IL-9 expression or possibly differences in the genetic backgrounds on which the various IL-9 transgenic lines have been founded. IL-9 was originally cloned as a T cell growth factor, the expression of which was restricted almost exclusively to activated T cells (36, 37). Clearly, continuous high-level expression of the IL-9 gene in the thymus leads to the selective outgrowth of T cell clones that are either CD8+ or CD4+CD8+ and arise independently of IL-4, IL-5, or IL-13, presumably due to a second-hit mutation. These new lines of IL-9 transgenic mice may prove useful in understanding the transformation events that occur where abnormal IL-9 expression has been detected (8, 9). Importantly, by intercrossing the IL-9 transgenic mice with compound Th2 cytokine-deficient mice, future studies will be able to analyze the T cell lymphomas in the absence of conflicting Th2 inflammatory responses.
A striking, but unexpected phenotype observed in our IL-9 transgenic mice was the development of hydronephrosis. Such a phenotype has not been previously associated with IL-9 overexpression, and represents a novel link between immune-regulatory cytokines and hydronephrosis. Hydronephrosis was observed in up to 75% of transgenic animals and developed independently of lymphoma. Histological analysis of the IL-9 transgenic mice suggests that inflammation and hypertrophy of the urothelium could lead to fibrosis, ureteric, or pelvi-ureteric junction stenosis, and thus to obstruction and hydronephrosis. Significantly, this process requires the presence of IL-4 and/or IL-13, whereas IL-5 does not appear essential. Because IL-4 and IL-13 are pleiotropic cytokines, they may be mediating their effects through multiple pathways, including the activation and recruitment of T cells and eosinophils (19). A further possibility is that IL-13, which has been shown to regulate fibrosis (38, 39), may predispose to inappropriate collagen deposition in the ureter, resulting in obstruction. Interestingly, transgenic mice expressing TGF-
, another profibrotic factor, also exhibited hydronephrosis (40), although with lower penetrance than we have observed in the IL-9 transgenic mice. The IL-9 transgenic mice should prove an interesting model for examining the potential roles of Th2 cytokines in urothelial pathology.
It is of note that while the observation that hydronephrosis occurs in IL-9 transgenic mice might appear to be an obscure one, it may have significance in the etiology of certain diseases associated with urinary tract obstruction and renal failure. An interesting example is infection with the helminth parasite Schistosoma hematobium, the cause of urinary schistosomiasis. Schistosomiasis infections are associated with elevated Th2 cytokines, including IL-9, and the resulting pathology involves eosinophil-rich granulomatous inflammation surrounding parasite eggs trapped in various organs, including the urinary tract. During S. hematobium infections, parasite eggs induce inflammation, with progressive scarring in the bladder and/or upper urinary tract, leading to hydronephrosis. In sub-Saharan Africa alone, it has been estimated that 150,000 people infected with S. hematobium die per year from obstructive renal failure, with 18.9 million infected people developing hydronephrosis (41). The hydronephrosis seen in the IL-9 transgenics prepared in this study may be generated by pathological processes with similarities to the parasite-induced hydronephrosis in urinary schistosomiasis, providing insight into, and a model for, an important clinical problem.
Another cause of urinary obstruction in humans, with similarities to those observed in IL-9 transgenic mice, is eosinophilic cystitis (42). This is an uncommon condition in which inflammation of the bladder, and occasionally ureter (43), results in scarring and often obstruction and hydronephrosis. It is associated in some cases with allergic responses, hyper-IgE, and eosinophilic syndromes (42, 44). These associations, together with the similar ureteric pathology seen in IL-9 transgenics, suggest a potential role for IL-9 in initiation of this condition as well.
In agreement with previous reports (11, 12), our IL-9 transgenic mice show increased levels of serum Igs and expansion of peritoneal B-1 cells (data not shown). However, by contrast, we also observed an increase in circulating autoantibodies in our lines of IL-9 transgenic mice. Although the Th2 cytokines, IL-4 and IL-5, have both been linked to autoantibody production, a role for IL-9 in this process has not been reported (12, 31, 35). We were therefore interested to determine whether the production of autoantibodies in our IL-9 transgenic mice was dependent upon other Th2 cytokines. IL-9 has been shown to synergize with IL-4 in the production of IgE and IgG1 (4), and IL-4 was therefore a potential candidate in IL-9-mediated autoantibody production. Autoantibody production in the IL-9 transgenic mice was shown to be independent of IL-4 and IL-13, indicating that IL-9 must induce autoantibodies by a different mechanism. The development of autoantibodies in these IL-9 transgenic mice was also shown to be independent of IL-5. By contrast, the compound disruption of IL-4, IL-5, and IL-13 resulted in the ablation of autoantibodies, indicating that Th2 cytokines act in combination in the development of IL-9-mediated autoantibody production. Significantly, by intercrossing IL-9 transgenic mice with cytokine-deficient mice, we also demonstrate that the combined deletion of IL-4, IL-5, and IL-13 reduces B-1 cell numbers to levels similar to those found in the wild-type mice, indicating that IL-9-induced B-1 cell expansion is at least partially dependent on the other Th2 cytokines, and that the reduction in B-1 cells correlates with the absence of autoantibodies. Peritoneal B-1 cells are known to produce natural Abs that have been shown to act in the innate immune response by opsonizing bacteria and facilitating their destruction (45, 46). These natural Abs help control bacterial and other infections until the adaptive immune response is initiated. Although these B cell subsets can clearly be beneficial in innate defense against pathogens, in some cases B-1 cells are known to secrete autoantibodies and contribute to autoimmune disease (47). B-1 cells have been shown to produce autoreactive Abs in rheumatoid arthritis (48), and in some models ablation of B-1 cells can prevent autoimmunity (49, 50). Thus, IL-9 appears to act by enhancing the effects of the other Th2 cytokines in their regulation of B-1 cell numbers and of hypergammaglobulinemia. Although we always detected elevated numbers of peritoneal B-1 cells in IL-9 transgenic mice, there were occasions when this did not correlate with increased levels of serum autoantibodies. Due to the complexity of the syndrome observed in these IL-9 transgenic mice, the significance of this observation is unclear, but may indicate that another event(s) is required before the autoantibody levels increase detectably. Why the systemic expression of IL-9 did not lead to autoantibodies is not clear (12); however, it should be emphasized that in our transgenic lines, IL-9 expression is driven by the mouse IL-9 promoter, and this presumably facilitates the production of IL-9 by T cells in close apposition with B cells, possibly creating a more effective mechanism for driving autoantibody production.
Our results clearly demonstrate that overexpression of IL-9 can lead to profound pathological consequences, resulting in an increased probability of developing T cell lymphoma, hydronephrosis, and autoantibody production. Using a panel of cytokine-deficient mice, we have demonstrated that the IL-9-induced development of lymphomas occurs independently of IL-4, IL-5, and IL-13 (Table II). By contrast, we have also demonstrated that IL-9 is differentially dependent on IL-4, IL-5, and IL-13 for the induction of hydronephrosis and autoantibody production (Table II). The IL-9 transgenic mice should prove interesting for the future investigation of the role of this cytokine in disease processes.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Clinical Neurobiology, University of Heidelberg, Im Neuenheimer Feld 364, 69120 Heidelberg, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Andrew N. J. McKenzie, Medical Research Council Laboratory of Molecular Biology, Hills Road, Cambridge, CB2 2QH, U.K. E-mail address: anm{at}mrc-lmb.cam.ac.uk ![]()
4 Abbreviations used in this paper: LCR, locus control region; ANA, anti-nuclear Ab; HPRT, hypoxanthine phosphoribosyltransferase; KO, knockout. ![]()
Received for publication September 18, 2003. Accepted for publication April 26, 2004.
| References |
|---|
|
|
|---|
RI or to calcium ionophores. Nature 339:64.[Medline]
1 transgenic mice. J. Clin. Invest. 100:2697.[Medline]
This article has been cited by other articles:
![]() |
V. Steenwinckel, J. Louahed, C. Orabona, F. Huaux, G. Warnier, A. McKenzie, D. Lison, R. Levitt, and J.-C. Renauld IL-13 Mediates In Vivo IL-9 Activities on Lung Epithelial Cells but Not on Hematopoietic Cells J. Immunol., March 1, 2007; 178(5): 3244 - 3251. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okazaki, Y. Otaka, J. Wang, H. Hiai, T. Takai, J. V. Ravetch, and T. Honjo Hydronephrosis associated with antiurothelial and antinuclear autoantibodies in BALB/c-Fcgr2b-/-Pdcd1-/- mice J. Exp. Med., December 19, 2005; 202(12): 1643 - 1648. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |