|
|
||||||||

* Department of Biology, University of North Carolina, Charlotte, NC 28223; and
Department of Surgery, Carolinas Medical Center, Charlotte, NC 28232
| Abstract |
|---|
|
|
|---|
B activation, as demonstrated by increased nuclear localization of the p65 (RelA) subunit of NF-
B in these cells. Interestingly, we demonstrate that substance P augments B. burgdorferi-induced expression of mRNA encoding two PGE2 receptors, E-prostanoid receptor subtypes 2 and 4, as well as each receptor protein. In addition, these effects are mediated via interactions between substance P and its high affinity receptor, as evidenced by the absence of augmented PGE2 synthesis in the presence of a specific neurokinin-1 receptor antagonist or in cells genetically deficient in the expression of these receptors. Taken together, the present demonstration that substance P can exacerbate B. burgdorferi-induced inflammatory responses in microglia in vitro may indicate a role for this neuropeptide in the development of CNS inflammation observed during human neuroborreliosis. | Introduction |
|---|
|
|
|---|
Microglia are resident immune cells of the CNS (3) and, like macrophages and dendritic cells, are of myeloid lineage. Consequently, these cells are likely to play an important role in either development of protective immune responses or progression of damaging inflammation during CNS disease states (12, 13, 14). Microglia respond to traumatic injury, or the presence of infectious organisms, by migrating to the site of injury where they proliferate. Microglia become activated at the site of challenge and assume many of the immune effector functions typically associated with macrophages. For example, they are known to be facultative phagocytes, and express Ag-presenting MHC class II molecules (15). Importantly, microglia can also be induced to produce key proinflammatory molecules such as TNF-
and IL-6 (16, 17). As such, these cells are ideally suited to detect and respond to pathogens that infiltrate the CNS. Recent studies by our laboratory have demonstrated the presence of functional NK-1R on murine microglia (18, 19). However, the ability of SP to modulate microglial responses to microbial challenge has not been investigated.
Lyme disease is a multisystemic infection that involves a variety of organ systems, including the CNS (20, 21). The invasion of the CNS by Borrelia burgdorferi, the causative agent of Lyme disease, can lead to damaging inflammation associated with marked levels of proinflammatory molecules such as IL-6 and TNF-
(22, 23). The majority of clinical symptoms of Lyme disease are due to the localized presence of B. burgdorferi in various tissues (24). Such infections have been associated with the up-regulation of the important inflammatory enzyme, cyclooxygenase-2 (COX-2) (25).
In the present study, we have investigated the ability of the neuropeptide SP to augment B. burgdorferi-induced microglial responses. We demonstrate that SP markedly augments B. burgdorferi-induced expression of mRNA encoding the key inflammatory enzyme COX-2 by cultured murine microglia. Importantly, this increase in the expression of mRNA encoding COX-2 translated into increased secretion of the prostanoid, PGE2. This induction is associated with an augmented increase in the nuclear localization of the key transcriptional activator, NF-
B. In addition, we demonstrate that SP synergizes with B. burgdorferi to augment levels of expression of mRNA encoding the PGE2 receptors, E-prostanoid receptor subtypes 2 and 4 (EP2 and EP4), as well as enhanced receptor protein expression.
Taken together, the ability of SP to augment B. burgdorferi-induced microglial responses in vitro may provide a possible explanation whereby this bacterium can elicit inflammatory responses within the CNS during neuroborreliosis.
| Materials and Methods |
|---|
|
|
|---|
SP receptor-deficient mice, bred for >10 generations onto a C57BL/6 background, were derived at the University of Iowa Medical Center (Iowa City, IA) (26). These mice were originally derived from induced mutations made by insertion of the lacZ gene into exon 1 of the SP receptor (5). SP receptor-deficient mice were routinely screened by PCR to confirm disruption of the SP receptor, as previously described (5, 27), using the positive and negative strand primers CCAACACCTCCAAGACTTCTG and GCCACAGCTATGGAGTAGAT for wild type, and TCCAGACTGCCTTGGGAAAA and GCCACAGCTGTCATGGAGTAGAT for SP receptor deficiency, respectively.
Isolation of primary murine microglia
Murine neonatal brain microglia were isolated, as described previously, by our laboratory (18, 19, 28). Briefly, six to eight neonatal BALB/c or C57BL/6 (NK-1R/) mouse brains per preparation were dissected free of meninges and large blood vessels, and minced with sterile surgical scissors. The minced tissue was forced through a wire screen and briefly incubated with 0.01% trypsin-0.005% EDTA for 5 min. The cell suspension was then washed, and this mixed glial culture was maintained in RPMI 1640 containing 10% FBS and gentamicin for 2 wk. A microglia culture was obtained from this mixed glial culture by shaking flasks for 1 h at 200 rpm in an orbital shaker (New Brunswick Scientific, Edison, NJ) and allowing the transferred dislodged cells to adhere to new tissue culture vessels for 1 h. The medium was then removed, and fresh RPMI 1640 with 10% FBS and 20% conditioned medium from LADMAC cells (ATCC number CRL-2430) was added as a source of CSF-1 to maintain microglia cultures for 1 wk, as described previously (29). Cells isolated in this manner were previously demonstrated to be >95% authentic microglia due to their characteristic morphology and the presence of the microglia cell surface markers CD11b and F4/80, as determined by FACS analysis (19).
Preparation of B. burgdorferi Ags
A clonal low passage of B. burgdorferi strain N40 was used throughout these studies (30). Spirochetes were grown in Barbour-Stoenner-Kelly II medium (31). Cells were centrifuged at 10,000 x g and washed three times with PBS. After the final wash, bacteria were resuspended in PBS and pulsed three times with a cell sonicator for 20 s at 25-s intervals. B. burgdorferi Ags isolated in this manner have been previously demonstrated to be free of detectable levels of LPS (25). Isolated microglia were exposed to 1 µg/ml B. burgdorferi cell lysate, as indicated.
Isolation of RNA and semiquantitative RT-PCR
Total RNA was isolated from microglia using TRIzol reagent (Life Technologies, Gaithersburg, MD), as described previously (18, 19, 28).
PCR was performed to determine the expression of COX-1, COX-2, EP2R, and EP4R. PCR was performed on 5% of the reverse-transcribed cDNA product to quantify expression of the mRNAs encoding COX-2, COX-1, EP2R, EP4R, and G3PDH using 95°C denaturation, 60°C annealing, and 72°C extension temperatures (Robocycler 40; Stratagene, La Jolla, CA) with the first 3 of 28 total cycles having extended denaturation and annealing times, as previously described (18, 28, 32).
Positive and negative strand primers used, respectively, were TCAGCCAGGCAGCAAATCCTT and TAGTCTCTCCTATGAGTATGAGTC to amplify mRNA encoding COX-2 (25) (932-bp fragment), CACCCTCGGTCCTGCTCGCAGAT and GTTGGACCGCACTGTGAGTACCAG to amplify mRNA encoding COX-1 (371-bp fragment), GTGGCCCTGGCTCCCGAAAGT and GGCAAGGAGCATATGGCGAAGGTG to amplify mRNA encoding EP2R (33, 34) (535-bp fragment), TTCCGCTCGTGGTGCGAGTGTTC and GAGGTGGTGTCTGCTTGGGTCAG to amplify mRNA encoding EP4R (35) (423-bp fragment), and CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify mRNA encoding the housekeeping gene, G3PDH (340-bp fragment). PCR primers were derived from the published sequences of COX-1 (35) and G3PDH (36). These primers were designed using Oligo 4.0 primer analysis software (National Biosciences, Plymouth, MA) based on their location in different exons of the genomic sequences for each in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software; IBI, New Haven, CT).
PCR amplification of the housekeeping gene, G3PDH, was performed on cDNA from each sample to insure similar input of RNA and efficiencies of reverse transcription. The identities of the PCR-amplified fragments were verified by size comparison with DNA standards (Promega, Madison, WI).
Quantification of PGE2 secretion in primary microglia culture supernatants
PGE2 levels were determined using a Biotrak enzyme immunoassay system, according to the directions provided by the manufacturer (Amersham Pharmacia Biotech, Piscataway, NJ), as described previously (18). The minimum detectable level in this assay was 2.5 pg/ml.
Western blot analysis for NF-
B p65 (RelA) in microglia nuclear extracts
Western blot analysis for the presence of NF-
B p65 (RelA) in microglia nuclear extracts was performed, as described previously (19, 37). Nuclear extract protein samples from primary microglia were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P transfer membranes (Millipore, Bedford, MA). The primary Ab used was an anti-NF-
B (RelA) subunit polyclonal Ab purchased from Chemicon International (Temecula, CA). After reacting with primary Ab, blots were washed and incubated in the presence of a donkey anti-rabbit IgG Ab conjugated to HRP (Southern Biotechnology Associates, Birmingham, AL). Bound enzyme was detected with the ECL system (Amersham Pharmacia Biotech).
Western blot analysis for EP2 and EP4 receptor expression in microglia whole cell lysates
Western blot analysis for the presence of EP2 and EP4 receptors in microglia whole cell lysates was performed, essentially, as described previously (19). Briefly, whole cell protein samples from primary microglia were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P transfer membranes (Millipore). The primary Ab used was an anti-EP2 or anti-EP4 receptor polyclonal Ab purchased from Cayman Chemical (Ann Arbor, MI). After reacting with primary Ab, blots were washed and incubated in the presence of a donkey anti-rabbit IgG Ab conjugated to HRP (Southern Biotechnology Associates). Bound enzyme was detected with the ECL system (Amersham Pharmacia Biotech).
Confocal microscopy analysis for NF-
B p65 (RelA) in primary microglia
Primary microglia cells were isolated and grown to confluency on glass coverslips in 24-well tissue culture plates. Cells were then washed and fixed in 95% methanol for 30 min at 25°C. After fixing, the cells were blocked with 10% nonimmune goat serum (Zytec, San Francisco, CA) for an additional 30 min. After washing, cells were incubated with a polyclonal rabbit anti-mouse Ab (Chemicon International) directed against the p65 subunit of NF-
B (RelA) or an Ab directed against an irrelevant Ag for 1 h at room temperature. Cells were then washed three times with PBS before the addition of a secondary donkey anti-rabbit IgG Ab conjugated to tetramethylrhodamine isothiocyanate (Molecular Probes, Eugene, OR) for an additional hour. Cells were then washed three times with PBS and mounted on glass slides using the ProLong AntiFade kit, according to the manufacturers instructions (Molecular Probes), and analyzed by confocal microscopy (Olympus, Mellville, NY) using a x60 objective.
Densitometric analyses
Densitometric analyses of RT-PCR products were performed using NIH Image (obtained from the National Institutes of Health website: http://rsb.info.nih.gov/nih-image). Each image was imported into NIH Image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting.
| Results |
|---|
|
|
|---|
To begin to determine whether SP is capable of modulating microglial responses, we investigated the effect of SP and B. burgdorferi stimulation on levels of expression of mRNA encoding the enzyme, COX-2, in primary murine microglia. Microglia were cultured in the presence or absence of B. burgdorferi Ags (Bb) at a dose below that previously shown to elicit maximal inflammatory responses by cultured microglia (1 µg/ml) (18), and with or without SP (1 nM) at a dose that has previously been demonstrated to activate the transcription factor NF-
B in cultured microglia (19). At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-2 mRNA expression. As shown in Fig. 1A, stimulation with Bb or SP alone failed to induce the expression of mRNA encoding COX-2 after 4 h, although these agents did elicit modest elevations in mRNA encoding COX-2 after 8 h (1.3- and 2.2-fold increases, as measured by densitometric analysis, respectively) (Fig. 1A). Intriguingly, simultaneous exposure of microglia to Bb and SP resulted in a marked increase in the levels of expression of mRNA encoding COX-2 as rapidly as 4 h posttreatment (46-fold increase, as measured by densitometric analysis) (Fig. 1A). This effect of SP on Bb-induced COX-2 mRNA expression was sustained after 8 h (12.5-fold increase, as measured by densitometric analysis), but abated after 12 h posttreatment (Fig. 1A).
|
To further confirm the NK-1R-mediated ability of SP to augment the levels of expression of mRNA encoding COX-2, we isolated microglia from mice genetically deficient in the expression of the SP receptor (NK-1R/ mice). NK-1R/ microglia were cultured in the presence or absence of Bb Ags (1 µg/ml), SP (1 nM), or both stimuli together. At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-2 mRNA expression. As shown in Fig. 1B, stimulation with Bb alone failed to elicit increased levels of expression of mRNA encoding COX-2, consistent with experiments using wild-type microglia (Fig. 1A). As expected, the lack of SP/SP receptor interactions in these cells resulted in a loss of synergistic increases in levels of expression of mRNA encoding COX-2 in the presence of Bb and SP (Fig. 1B), confirming a NK-1R-mediated ability of SP to augment B. burgdorferi-induced microglial responses. Taken together, these results demonstrate the ability of the neuropeptide, SP, to enhance and specifically augment B. burgdorferi-induced microglial responses in vitro.
Levels of mRNA encoding COX-1 are constitutive and are unaffected by B. burgdorferi and SP stimulation
COX-1 has been shown to be constitutively expressed in a variety of tissues, including the CNS. To determine whether the ability of SP to augment B. burgdorferi-induced COX expression is restricted to the inducible form of the enzyme (COX-2), we investigated the effect of SP and B. burgdorferi stimulation on levels of expression of mRNA encoding COX-1 in primary murine microglia. Microglia were cultured in the presence or absence of B. burgdorferi Ags (Bb) (1 µg/ml), SP (1 nM), or both stimuli together. At the indicated times posttreatment, RNA was isolated, and semiquantitative RT-PCR was performed for the presence of COX-1 mRNA expression. As shown in Fig. 2, levels of mRNA expression encoding COX-1 are not significantly altered from constitutive expression, in both wild-type microglia and microglia isolated from NK-1R/ mice (Fig. 2). Taken together, these results demonstrate that, in contrast to COX-2, levels of expression of COX-1 mRNA are independent of Bb and SP treatment.
|
Recently, studies from our laboratory have demonstrated the ability of B. burgdorferi Ags to elicit the production of significant levels of PGE2 by cultured microglia (18). To address whether the effect of SP on B. burgdorferi-induced COX-2 mRNA expression translates into increased secretion of PGE2, a specific capture ELISA was performed to detect the presence of this prostanoid in microglial culture supernatants. Culture supernatants of untreated primary microglia or microglia treated with B. burgdorferi (Bb) alone (1 µg/ml), SP alone (1 nM), or both stimuli together were harvested 4 h posttreatment and assayed for PGE2 production. As shown in Fig. 3A, treatment of microglia with Bb or SP alone failed to elicit detectable levels of PGE2 production by these cells. Importantly, simultaneous exposure to both Bb and SP resulted in a marked increase in PGE2 secretion by microglia (Fig. 3A) compared with untreated cells or cells exposed to either stimulus alone (Fig. 3A). The effect of SP- on Bb-induced PGE2 production was dependent on SP/SP receptor interactions, as shown by its sensitivity to the presence of the specific SP receptor antagonist, L-703,606 (10 nM) (Fig. 3A), which by itself or in combination with Bb or SP had no significant effect on the production of this prostanoid by microglia (Fig. 3A). In addition, to confirm the specificity of the effects of SP on Bb-mediated PGE2 production, similar experiments were performed using microglia derived from NK-1R-deficient mice. As shown in Fig. 3B, treatment of microglia with B. burgdorferi alone or SP alone failed to elicit detectable levels of PGE2 production by these cells. Importantly, exposure to both Bb and SP simultaneously had no effect on levels of PGE2 secretion by these cells after 4 h (Fig. 3B) or 8 h (data not shown), confirming the importance of SP/SP receptor interactions in augmenting B. burgdorferi-induced microglial responses (Fig. 3B). For comparison purposes and to ensure the functionality of the assay, culture supernatants from primary microglia were harvested 4 h after stimulation with B. burgdorferi (5 Bb) at a concentration previously demonstrated to maximally induce PGE2 production by cultured microglia (5 µg/ml) (18) and is shown in Fig. 3B.
|
B, in murine microglia
Given the ability of both B. burgdorferi and SP to elicit activation of NF-
B in murine microglia (18, 19), we hypothesized that simultaneous stimulation of cultured microglia with B. burgdorferi and SP would result in a marked increase in the activation of NF-
B when compared with untreated cells or cells treated with either stimulus alone.
Microglia were untreated or treated with B. burgdorferi (Bb) Ags (1 µg/ml), SP (1 nM), or both stimuli together for 30 min and assayed for the cellular localization of the p65 (RelA) subunit of NF-
B via confocal microscopy. As shown in Fig. 4, treatment with either Bb or SP alone failed to elicit increased levels of RelA in the nucleus when compared with untreated microglia cells (Fig. 4, AC). In contrast, microglia cells exposed to Bb and SP simultaneously exhibited a robust increase in the expression of RelA in the nucleus (Fig. 4D). Furthermore, this increase in the levels of nuclear RelA was dependent on the actions of SP through its receptor, as evidenced by the ability of L-703,606 (10 nM) to abrogate this response (Fig. 4F), while having no effect by itself when compared with untreated cells (Fig. 4E).
|
B activation, microglial nuclear extracts were analyzed for the cellular localization of the p65 (RelA) subunit of NF-
B by Western blot analysis. As shown in Fig. 5, microglia treated simultaneously with both stimuli exhibited a dramatic increase in the level of RelA present in the nucleus when compared with either treatment alone (133 vs 45 and 37 arbitrary densitometric units, respectively) (Fig. 5). Importantly, this marked induction was attenuated in the presence of the NK-1R antagonist, L-703,606 (1 nM) (56% inhibition, as measured by densitometric analysis).
|
B activation in cultured microglia, as evidenced by the marked increases in nuclear translocation of the RelA subunit (Figs. 4 and 5). SP markedly increases levels of mRNA encoding the PGE2 receptors, EP2 and EP4, as well as each receptor protein, in B. burgdorferi-challenged microglia
PGE2 has been demonstrated to exert its effects on a variety of cell types by binding to one or a combination of four subtypes of receptor designated, EP1, EP2, EP3, and EP4. Importantly, the interaction between PGE2 and the EP receptor subtypes 2 and 4 has previously been demonstrated to modulate macrophage effector functions (38, 39) as well as potentiate inflammatory disease progression (40). Microglia cells were untreated or exposed to B. burgdorferi (Bb) Ags (1 µg/ml), SP (1 nM), or both stimuli together. RNA was isolated 4 h later, and semiquantitative RT-PCR was performed for the presence of mRNA encoding the EP2 and EP4 receptors. As shown in Fig. 6A, neither receptor subtype was constitutively expressed by untreated murine microglia. Importantly, Bb treatment alone resulted in an increase in the levels of expression of mRNA encoding the EP2 receptor (18-fold increase, as measured by densitometric analysis), while failing to elicit detectable increases in expression of mRNA encoding the EP4 receptor (Fig. 6A). Similarly, SP treatment alone evoked increases in the levels of expression of mRNA encoding both the EP2 and EP4 receptor, compared with untreated cells (49- and 49-fold increases, as measured by densitometric analysis, respectively) (Fig. 6A). In contrast, the combined presence of B. burgdorferi and SP elicited synergistic increases in the levels of mRNA encoding both the EP2 and EP4 receptors (194- and 96-fold increases, as measured by densitometric analysis, respectively) (Fig. 6A). Furthermore, this effect was dependent, in part, on the actions of SP through its receptor, as shown by the ability of L-703,606 (10 nM) pretreatment to inhibit this effect (96 and 64% inhibition, as measured by densitometric analysis, respectively) (Fig. 6A).
|
Taken together, these data demonstrate that Bb and SP act in concert to augment the expression of the EP receptor subtypes, 2 and 4, by primary murine microglia.
| Discussion |
|---|
|
|
|---|
(41, 42). Furthermore, SP can induce a respiratory burst in macrophages, resulting in the production of reactive oxygen intermediates (43). Although SP by itself can promote production of proinflammatory molecules, there is also evidence that this neuropeptide can augment LPS-mediated proinflammatory cytokine production (8, 9, 44) and can inhibit the production of anti-inflammatory cytokines (45). However, much less is known about the role of this neuropeptide in the initiation and/or maintenance of inflammatory responses at the site of its most ubiquitous distribution, the CNS. We have recently demonstrated the presence of authentic NK-1R on isolated cultures of murine microglia, resident myeloid cells of the CNS. Importantly, we showed the functional nature of such expression by demonstrating the ability of nanomolar concentrations of SP to elicit activation of NF-
B, a transcription factor that plays a role in inflammatory cytokine production (19). However, to date, the ability of SP to augment proinflammatory responses of microglia has not been investigated. In the present study, we have demonstrated that SP augments prostanoid synthesis in response to a bacterial CNS pathogen. Specifically, we show that SP augments the ability of B. burgdorferi, the causative agent of Lyme disease, to elevate expression of mRNA encoding the key proinflammatory enzyme, COX-2. This effect translated into robust increases in the secretion of the prostanoid PGE2. Furthermore, this effect is a result of SP acting via its specific receptor, as indicated by the ability of L-703,606, a specific NK-1R antagonist, to abrogate these responses, and the absence of this effect in mice genetically deficient in the expression of NK-1R. Interestingly, SP increases the expression of the two prostanoid receptors associated with inflammatory effects, EP2 and EP4 receptors. In addition, we demonstrate that SP augments the levels of nuclear RelA in B. burgdorferi-stimulated microglia, suggesting a possible mechanism whereby SP augments B. burgdorferi-induced microglial responses.
Injury to the CNS in the form of trauma and/or infection can result in the initiation of robust inflammatory responses. Such responses may either be protective or result in progressive damage to brain tissue (12, 13, 14). Lyme neuroborreliosis occurs as a result of neurologic involvement during chronic Lyme disease, and has been shown to be associated with increased levels of proinflammatory molecules such as IL-6, and TNF-
within the CNS (22, 23).
In this study, we show that SP can exacerbate B. burgdorferi-induced production of the inflammatory mediator, PGE2, by microglia in vitro. Furthermore, the ability of SP to enhance the expression of EP2 and EP4 receptors on microglia raises the possibility that augmented PGE2 secretion may act in an autocrine manner to further potentiate microglial function. As such, it is tempting to attribute these effects to the ability of SP to elicit activation of NF-
B, a transcription factor that plays a role in the induction of inflammatory molecules, such as COX-2 and PGE2. In such a scenario, SP may function to markedly augment inflammatory responses during human CNS infections.
Although the role of PGs within the CNS is not well defined, studies have demonstrated that prostanoids are required to maintain homeostasis and plasticity in developing nervous tissues (46). However, a compelling body of evidence demonstrates that during inflammation, the levels of prostanoid production can change dramatically, indicating a role for these lipid mediators in the progression of inflammatory responses (46). It is, perhaps, not surprising that microglia cells constitutively produce PGE2, possibly through the actions of COX-1. However, levels of microglial-derived PGE2 were sensitive to both Bb and SP treatment and correlated with the induction of COX-2 by these cells. These results are consistent with other studies that demonstrate low constitutive prostanoid production that can be increased within minutes by inflammatory stimuli acting on constitutively expressed prostanoid synthetic enzymes (47). PGE2 can exert a variety of effects on many tissues through the interaction of this prostanoid with one of its four receptors. Although EP2 and EP4 receptors have been shown to modulate the function of cells such as macrophages (40, 48), and their expression can be induced by bacterial cell wall components such as LPS (49), the ultimate outcome of PGE2/EP receptor interactions is largely unknown. The presence of such receptors on microglia and the ability of Bb and SP to augment their expression may indicate a role for PGE2/EP receptor interactions during Bb-induced inflammation.
In summary, the present study identifies the neuropeptide, SP, as being a potent modulator of microglial responses in vitro and may contribute to an understanding of how this spirochete can initiate the damaging inflammation associated with Lyme neuroborreliosis.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ian Marriott, Department of Biology, 9201 University City Boulevard, University of North Carolina, Charlotte, NC 28223. E-mail address: imarriot{at}email.uncc.edu ![]()
3 Abbreviations used in this paper: SP, substance P; COX, cyclooxygenase; NK-1, neurokinin-1; EP, E-prostanoid receptor subtype. ![]()
Received for publication December 5, 2003. Accepted for publication February 25, 2004.
| References |
|---|
|
|
|---|
release by human blood monocytes and macrophages. J. Neuroimmunol. 82:126.[Medline]
up-regulate substance P receptor expression in murine peritoneal macrophages. J. Immunol. 165:182.
1 mRNAs are induced in rat facial nucleus following motoneuron axotomy. Eur. J. Neurosci. 5:775.[Medline]
-herpesvirus 68. J. Immunol. 170:2605.
herpesvirus-68 infects microglia and induces high levels of pro-inflammatory cytokine production. J. Neuroimmunol. 136:75.[Medline]
regulation of class II transactivator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling-1 protein. J. Immunol. 166:2260.
B independent of elevations in intracellular calcium in murine macrophages and dendritic cells. J. Neuroimmunol. 102:163.[Medline]
-induced TGF-
1 production by cultured murine macrophages. Cell. Immunol. 183:113.[Medline]
This article has been cited by other articles:
![]() |
A. Vojdani and J. Lambert The Role of Th17 in Neuroimmune Disorders: Target for CAM Therapy. Part II Evid. Based Complement. Altern. Med., July 21, 2009; (2009) nep063v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chernova, J.-P. Lai, H. Li, L. Schwartz, F. Tuluc, H. M. Korchak, S. D. Douglas, and L. E. Kilpatrick Substance P (SP) enhances CCL5-induced chemotaxis and intracellular signaling in human monocytes, which express the truncated neurokinin-1 receptor (NK1R) J. Leukoc. Biol., January 1, 2009; 85(1): 154 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Chauhan, D. G. Sterka Jr., D. L. Gray, K. L. Bost, and I. Marriott Neurogenic Exacerbation of Microglial and Astrocyte Responses to Neisseria meningitidis and Borrelia burgdorferi J. Immunol., June 15, 2008; 180(12): 8241 - 8249. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rydkina, A. Sahni, R. B. Baggs, D. J. Silverman, and S. K. Sahni Infection of Human Endothelial Cells with Spotted Fever Group Rickettsiae Stimulates Cyclooxygenase 2 Expression and Release of Vasoactive Prostaglandins Infect. Immun., September 1, 2006; 74(9): 5067 - 5074. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-S. Yang, K.-A. Ji, S.-B. Jeon, B.-K. Jin, S. U. Kim, I. Jou, and E. Joe Interleukin-13 Enhances Cyclooxygenase-2 Expression in Activated Rat Brain Microglia: Implications for Death of Activated Microglia J. Immunol., July 15, 2006; 177(2): 1323 - 1329. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-W. Koon, D. Zhao, Y. Zhan, S. H. Rhee, M. P. Moyer, and C. Pothoulakis Substance P Stimulates Cyclooxygenase-2 and Prostaglandin E2 Expression through JAK-STAT Activation in Human Colonic Epithelial Cells. J. Immunol., April 15, 2006; 176(8): 5050 - 5059. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Block, G. Li, L. Qin, X. Wu, Z. Pei, T. Wang, B. Wilson, J. Yang, and J. S. Hong Potent regulation of microglia-derived oxidative stress and dopaminergic neuron survival: substance P vs. dynorphin FASEB J, February 1, 2006; 20(2): 251 - 258. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |