|
|
||||||||
CUTTING EDGE |





* Institut National de la Santé et de la Recherche Médicale, Unité 454, Montpellier, France;
Département de Pharmacologie, Université de Montréal, Canada;
Laboratoire dImmunologie, Centre National de la Recherche Scientifique, Unité Mixte de Recherche, Limoges, France;
Laboratoire Cytokines, Université de Poitiers, France; and
¶ Zymogenetics, Seattle, WA 98102
| Abstract |
|---|
|
|
|---|
1 and
3 germline transcripts, as well as the expression of activation-induced cytidine deaminase, only stimulation with both anti-CD40 mAb and rIL-21 resulted in the production of S
/Sµ switch circular DNA. These results show that IL-21, in addition to promoting growth and differentiation of committed B cells, is a specific switch factor for the production of IgG1 and IgG3. | Introduction |
|---|
|
|
|---|
CSR is invariably preceded by the transcription of specific germline transcripts, which is under the control of promoters upstream of each switch region. The activity of germline promoters is regulated by specific cytokines. For example, it has been demonstrated that IL-4 and IL-10 selectively induce
4/
and
1/
3 germline promoters and switching, respectively, in human B cells. In the presence of appropriate costimulatory signals, this results in the production of the corresponding Ig: IgG4 and IgE (4, 5) or IgG1 and IgG3 (6, 7).
IL-21, a typical four-helix-bundle cytokine with significant homology to IL-2, IL-4, and IL-15, signals via a class I receptor, selectively expressed in lymphoid tissues (8). The IL-21R has homology to the shared
-chain of the IL-2R and the IL-15R (9) and is associated with the common
-chain of the IL-2R (8, 10). IL-21, produced by CD4+, but not CD8+, T cells is important, but not required, for mouse NK cell development and has been shown to inhibit IL-15-mediated expansion of resting NK cells (11). IL-21 inhibits the proliferation of mouse B cells induced by IL-4 and anti-IgM Ab. It has the opposite effect on B cells stimulated with anti-CD40 mAb on which proliferation is increased (8).
In the present study, we have analyzed the capacity of rIL-21 to induce the production of Ig isotypes by human B cells.
| Materials and Methods |
|---|
|
|
|---|
Highly purified (purity, >98%) CD19+ spleen B cells were obtained from human spleen fragments (generously provided by Prof. J.-M. Fabre (Centre Hospitalier Universitaire St. Eloi, Montpellier, France) in accordance with the guidelines of the ethical committee of the Montpellier University Hospitals) by positive selection using specific mAb-coated magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany), as described (12). Purified CD19+ B cells (purity, >98%) were also isolated from PBMC (Etablissement Français du Sang, Montpellier, France) using the Rosettesep procedure (StemCell Technologies, Meylan, France). CD19+CD27 and CD19+CD27+ B cells were obtained by staining with an FITC-conjugated anti-CD27 mAb (BD PharMingen, La Jolla, CA) followed by sorting on a FACSVantage (BD Biosciences, San Jose, CA). Two-color sorting was conducted using an additional PE-labeled mouse anti-human surface IgG mAb (BD Biosciences). Reanalysis of sorted cells showed >99% purity.
Induction of Ig production was conducted as follows: whole CD19+, or sorted CD19+CD27 and CD19+CD27+ human B lymphocytes (106 per milliliter) were cultured with 1 µg/ml anti-CD40 mAb 89 (13), in the presence or absence of combinations of rIL-4, rIL-10 (kind gifts from Dr. F. Brière (Schering-Plough, Dardilly, France) and rIL-21 (see Ref. 8) in flat-bottom 96-well culture plates in IMDM, supplemented with 10% FCS in sextuplate in a final volume of 200 µl. PBMC (106 per milliliter) were cultured with combinations of cytokines, in the absence of anti-CD40 mAb. After 12 days of incubation at 37°C and 5% CO2, culture supernatants were collected, and Ig content was measured by isotype-specific ELISA. For analysis of various transcripts, purified CD19+ B cells were cultured under the same experimental conditions and were harvested for mRNA isolation after 5 or 7 days of culture.
Measurement of Ig production
IgG1, IgG2, IgG3, IgG4, IgE, and IgA secretion was determined by isotype-specific ELISA (12).
cDNA synthesis, RT-PCR analysis, and Northern blotting analysis
Detection of isotype class-specific germline transcripts, activation-induced cytidine deaminase (AID), and spliced I
-Cµ transcripts was conducted by RT-PCR. RNA extraction, reverse transcription, and amplification of cDNA was conducted as described (12). The nucleotide sequences of PCR primers (5'-3') were as follows: C
1, sense I
1, ACGAGGAACATGACTGGATGC, and antisense C
1, TGTGAGTTTTGTCACAAGATTTGGG; C
3, sense I
3, AGGTGGGCAGGCTTCAGGCACCGAT, and antisense C
3, TTGTGTCACCAAGTGGGGTTTTAGC; AID, sense, GAGATTTTTCTGGCCTGAGA, and antisense, CCACTGTCTTCAGCAGAGAT; I
-Cµ, sense, GAGGGAGGAGGAGAGGCCCC, and antisense, AGGAAGTCCTGTGCGAGGCAG; and
-actin, sense, GCTGCTGACCGAGGCCCCCCTGAAC, and antisense, CTCCTTAATGTCACGCACGATTTC.
PCR conditions for germline transcripts consisted of 35 cycles of 30 s at 94°C (25 cycles for
-actin), 1 min at 60°C, and 1 min at 72°C, and for AID, as well as spliced I
-Cµ transcripts, of 32 cycles of 45 s at 94°C, 30 s at 55°C, and 1.5 min at 72°C. Where indicated, PCR products were sequenced on a 3730XL sequencer (Applied Biosystems, Foster City, CA).
| Results and Discussion |
|---|
|
|
|---|
|
|
2% of CD19+CD27 B were surface IgG+ (Fig. 2) and could therefore contribute to the observed IgG1 and IgG3 production. However, removal of surface IgG+ cells by FACS sorting yielded similar results (Table I), excluding the latter possibility. These results indicate that the production of both the IgG1 and IgG3 isotypes directly results from isotype switching, whereas that of IgG2 and IgG4 may be due to the proliferative effect of rIL-21 on isotype-committed CD19+CD27+ B cells. Indeed, rIL-21 was found to induce strong proliferative responses in CD19+CD27+, but not in CD19+CD27 B cell subpopulations (data not shown). This dual effect of rIL-21 with respect to the induction of CSR and of IgG1 and IgG3 production by naive B cells is reminiscent to that of rIL-10, the other cytokine known to promote CSR for the production of these isotypes (6). Finally, the IgG1 and IgG3 production-inducing capacity of IL-21 is not related to the origin of the B cells, because production of both isotypes was observed in cultures of PBMC, as well as anti-CD40 mAb-activated purified peripheral blood-derived B cells, in the presence of this cytokine (data not shown). The appearance of small CH-specific germline RNA transcripts is considered to be an obligatory event, preceding isotype switching in both mouse and human B cells (4, 17). Indeed, C
1 and C
3 sterile transcripts were detectable in B cells that had been stimulated with anti-CD40 mAb and rIL-21 (Fig. 3A). It is of note that B cells stimulated either via the CD40 molecule or the IL-21R also expressed these transcripts, indicating that, although a prerequisite, their expression alone is not sufficient to warrant IgG production. Because of the high homology among the human
subclasses, PCR amplification by itself may cause difficulties in the identification of
subclass-specific transcripts (18). However, RT-PCR products from germline C
1 and C
3 have unique endonuclease restriction sites; therefore, their specific germline transcripts can be determined by sequence analysis and identification of the SfoI (NarI isoschizomer) (
1) or NcoI (
3) restriction endonuclease digestion of the respective PCR products (19, 20). Stimulation of purified CD19+ spleen B cells with anti-CD40 mAb and rIL-21 for 5 days, followed by RNA isolation and RT-PCR analysis of germline transcript synthesis, yielded I
1-C
1 and I
3-C
3 PCR products with expected lengths of 603 and 670 bp, respectively (Fig. 3B). Direct sequence analysis and SfoI and NcoI digestion of the PCR-amplified rIL-21-induced transcripts showed that the amplified product contained the NarI and NcoI restriction sites, indicating that IL-21 specifically induces germline
1 and
3 transcription (data not shown).
|
|
1 and
3, as well as AID transcripts in B cells stimulated via CD40, the production of IgG was observed only in those cells that had been costimulated with anti-CD40 mAb and rIL-21. These results show that rIL-21, although incapable of inducing AID transcription by itself, is required to promote IgG production, most likely by synergizing with CD40-mediated signaling pathways.
|
-Cµ transcripts resulting from the formation of S
-Sµ switch circular DNA were present only in B cells stimulated with both anti-CD40 mAb and rIL-21 and were readily detectable after 25 cycles of amplification. In contrast, further increasing the number of PCR cycles (up to 45) yielded no positive signal in B cells stimulated with anti-CD40 mAb or rIL-21 alone. The class specificity of the recombination events was confirmed by the lack of detectable I
-Cµ and I
-Cµ switch transcripts in B cells stimulated with rIL-21 and anti-CD40 mAb (results not shown) in association with the absence of IgE and IgA production, respectively, under these culture conditions. In theory, only a single nonreplicating switch circular DNA can be generated from each allele in a given B cell. Because this is a one-time event, the observed increase in the number of switch DNA circles cannot be explained by the expansion of already isotype-committed B cells. Therefore, the observed production of IgG1 and IgG3 must be the result of a bona fide CSR event induced by IL-21 in naive surface IgG B lymphocytes and is unlikely to be due to the proliferation-inducing effects of this cytokine. The latter notion is underscored by the observation that I
-Cµ transcripts were absent in anti-CD40 mAb and rIL-21-stimulated B cells in early cultures and became detectable in increased amount only after 5 days of culture (Fig. 4 and results not shown). Taken together, the results of this study show that IL-21 plays an important role in the regulation of IgG1 and IgG3 production, in particular due to its capacity to induce CSR in naive human B cells.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hans Yssel, Institut National de la Santé et de la Recherche Médicale, Unité 454, Centre Hospitalier Universitaire Arnaud de Villeneuve, 34295 Montpellier, cedex 5, France. E-mail address: yssel{at}montp.inserm.fr ![]()
3 Abbreviations used in this paper: CSR, class switch recombination; AID, activation-induced cytidine deaminase. ![]()
Received for publication June 30, 2003. Accepted for publication March 8, 2004.
| References |
|---|
|
|
|---|
and
and prostaglandin E2. Proc. Natl. Acad. Sci. USA 85:6880.
1 and
3 switching in human B cells is interleukin-10 dependent. Mol. Immunol. 33:1335.[Medline]
chain. Proc. Natl. Acad. Sci. USA 97:11439.
-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.
regions and their participation in sequential switching to IgE. J. Immunol. 155:3021.[Abstract]
subclass germ-line transcripts in human peripheral blood B cells. J. Immunol. 151:3478.[Abstract]
subclass-specific isotype switch: switching to
1,
3, and
4, but not
2. J. Immunol. 155:2318.[Abstract]
This article has been cited by other articles:
![]() |
H. Wu, E. Center, G. Tsokos, and H. Weiner Suppression of murine SLE by oral anti-CD3: inducible CD4+CD25-LAP+ regulatory T cells control the expansion of IL-17+ follicular helper T cells Lupus, June 1, 2009; 18(7): 586 - 596. [Abstract] [PDF] |
||||
![]() |
G.-Y. Seo, J. Youn, and P.-H. Kim IL-21 ensures TGF-{beta}1-induced IgA isotype expression in mouse Peyer's patches J. Leukoc. Biol., May 1, 2009; 85(5): 744 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Konforte, N. Simard, and C. J. Paige IL-21: An Executor of B Cell Fate J. Immunol., February 15, 2009; 182(4): 1781 - 1787. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Ettinger, S Kuchen, and P E Lipsky Interleukin 21 as a target of intervention in autoimmune disease Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii83 - iii86. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Odegard, B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity J. Exp. Med., November 24, 2008; 205(12): 2873 - 2886. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Y. Wu, F. J. Quintana, and H. L. Weiner Nasal Anti-CD3 Antibody Ameliorates Lupus by Inducing an IL-10-Secreting CD4+CD25-LAP+ Regulatory T Cell and Is Associated with Down-Regulation of IL-17+CD4+ICOS+CXCR5+ Follicular Helper T Cells J. Immunol., November 1, 2008; 181(9): 6038 - 6050. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye STAT3 is required for IL-21-induced secretion of IgE from human naive B cells Blood, September 1, 2008; 112(5): 1784 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Leonard, R. Zeng, and R. Spolski Interleukin 21: a cytokine/cytokine receptor system that has come of age J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4 J. Immunol., August 1, 2008; 181(3): 1767 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iuchi, S. Teitz-Tennenbaum, J. Huang, B. G. Redman, S. D. Hughes, M. Li, G. Jiang, A. E. Chang, and Q. Li Interleukin-21 Augments the Efficacy of T-Cell Therapy by Eliciting Concurrent Cellular and Humoral Responses Cancer Res., June 1, 2008; 68(11): 4431 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation J. Immunol., April 1, 2008; 180(7): 4805 - 4815. [Abstract] [Full Text] [PDF] |
||||
![]() |
A H Sawalha, K M Kaufman, J A Kelly, A J Adler, T Aberle, J Kilpatrick, E K Wakeland, Q-Z Li, A E Wandstrat, D R Karp, et al. Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus Ann Rheum Dis, April 1, 2008; 67(4): 458 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Bryant, C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, R. de Waal Malefyt, and S. G. Tangye Cytokine-Mediated Regulation of Human B Cell Differentiation into Ig-Secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells J. Immunol., December 15, 2007; 179(12): 8180 - 8190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kishida, Y. Hiromura, M. Shin-Ya, H. Asada, H. Kuriyama, M. Sugai, A. Shimizu, Y. Yokota, T. Hama, J. Imanishi, et al. IL-21 Induces Inhibitor of Differentiation 2 and Leads to Complete Abrogation of Anaphylaxis in Mice J. Immunol., December 15, 2007; 179(12): 8554 - 8561. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis J. Immunol., November 15, 2007; 179(10): 7157 - 7165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuchen, R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger Essential Role of IL-21 in B Cell Activation, Expansion, and Plasma Cell Generation during CD4+ T Cell-B Cell Collaboration J. Immunol., November 1, 2007; 179(9): 5886 - 5896. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Herber, T. P. Brown, S. Liang, D. A. Young, M. Collins, and K. Dunussi-Joannopoulos IL-21 Has a Pathogenic Role in a Lupus-Prone Mouse Model and Its Blockade with IL-21R.Fc Reduces Disease Progression J. Immunol., March 15, 2007; 178(6): 3822 - 3830. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ettinger, G. P. Sims, R. Robbins, D. Withers, R. T. Fischer, A. C. Grammer, S. Kuchen, and P. E. Lipsky IL-21 and BAFF/BLyS Synergize in Stimulating Plasma Cell Differentiation from a Unique Population of Human Splenic Memory B Cells J. Immunol., March 1, 2007; 178(5): 2872 - 2882. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo Blood, March 1, 2007; 109(5): 2023 - 2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Good, V. L. Bryant, and S. G. Tangye Kinetics of Human B Cell Behavior and Amplification of Proliferative Responses following Stimulation with IL-21 J. Immunol., October 15, 2006; 177(8): 5236 - 5247. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Fecteau, G. Cote, and S. Neron A New Memory CD27-IgG+ B Cell Population in Peripheral Blood Expressing VH Genes with Low Frequency of Somatic Mutation J. Immunol., September 15, 2006; 177(6): 3728 - 3736. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ettinger, G. P. Sims, A.-M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky IL-21 Induces Differentiation of Human Naive and Memory B Cells into Antibody-Secreting Plasma Cells J. Immunol., December 15, 2005; 175(12): 7867 - 7879. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Avery, J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, and S. G. Tangye Increased Expression of CD27 on Activated Human Memory B Cells Correlates with Their Commitment to the Plasma Cell Lineage J. Immunol., April 1, 2005; 174(7): 4034 - 4042. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Vollmer, R. Liu, M. Price, S. Rhodes, A. La Cava, and F.-D. Shi Differential Effects of IL-21 during Initiation and Progression of Autoimmunity against Neuroantigen J. Immunol., March 1, 2005; 174(5): 2696 - 2701. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ozaki, R. Spolski, R. Ettinger, H.-P. Kim, G. Wang, C.-F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al. Regulation of B Cell Differentiation and Plasma Cell Generation by IL-21, a Novel Inducer of Blimp-1 and Bcl-6 J. Immunol., November 1, 2004; 173(9): 5361 - 5371. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |