The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pène, J.
Right arrow Articles by Yssel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pène, J.
Right arrow Articles by Yssel, H.
The Journal of Immunology, 2004, 172: 5154-5157.
Copyright © 2004 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: IL-21 Is a Switch Factor for the Production of IgG1 and IgG3 by Human B Cells1

Jérôme Pène*, Jean-François Gauchat{dagger}, Sandrine Lécart*, Elodie Drouet{ddagger}, Paul Guglielmi{ddagger}, Vera Boulay*, Adriana Delwail§, Don Foster, Jean-Claude Lecron§ and Hans Yssel2,*

* Institut National de la Santé et de la Recherche Médicale, Unité 454, Montpellier, France; {dagger} Département de Pharmacologie, Université de Montréal, Canada; {ddagger} Laboratoire d’Immunologie, Centre National de la Recherche Scientifique, Unité Mixte de Recherche, Limoges, France; § Laboratoire Cytokines, Université de Poitiers, France; and Zymogenetics, Seattle, WA 98102


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
IL-21 is a cytokine that regulates the activation of T and NK cells and promotes the proliferation of B cells activated via CD40. In this study, we show that rIL-21 strongly induces the production of all IgG isotypes by purified CD19+ human spleen or peripheral blood B cells stimulated with anti-CD40 mAb. Moreover, it was found to specifically induce the production of IgG1 and IgG3 by CD40-activated CD19+CD27– naive human B cells. Although stimulation of CD19+ B cells via CD40 alone induced {gamma}1 and {gamma}3 germline transcripts, as well as the expression of activation-induced cytidine deaminase, only stimulation with both anti-CD40 mAb and rIL-21 resulted in the production of S{gamma}/Sµ switch circular DNA. These results show that IL-21, in addition to promoting growth and differentiation of committed B cells, is a specific switch factor for the production of IgG1 and IgG3.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Upon activation, naive B lymphocytes can switch from the production of IgM to that of IgG, IgE, or IgA as a result of Ig isotype class switch recombination (CSR)3 (reviewed in Ref. 1), a highly regulated process controlled by cytokines, as well as by cellular interactions, involving B cell-expressed CD40 and its ligand CD154 (reviewed in Ref. 2). Isotype switching in B cells is important in the humoral immune response, because it generates Abs of the same specificity, but with different effector function. Induction of naive IgM- or IgD-expressing B cells to switch to the production of other isotypes occurs via a distinct recombination process during which the VDJ gene is moved from its initial position upstream of the C region (CH) gene. This process is a result of deletion of the DNA between the recombination breakpoints that occur within internally repetitive sequences, known as switch (S) regions, which is excised as circular DNA, the presence of which provides direct proof of specific isotype switching (reviewed in Ref. 3).

CSR is invariably preceded by the transcription of specific germline transcripts, which is under the control of promoters upstream of each switch region. The activity of germline promoters is regulated by specific cytokines. For example, it has been demonstrated that IL-4 and IL-10 selectively induce {gamma}4/{epsilon} and {gamma}1/{gamma}3 germline promoters and switching, respectively, in human B cells. In the presence of appropriate costimulatory signals, this results in the production of the corresponding Ig: IgG4 and IgE (4, 5) or IgG1 and IgG3 (6, 7).

IL-21, a typical four-helix-bundle cytokine with significant homology to IL-2, IL-4, and IL-15, signals via a class I receptor, selectively expressed in lymphoid tissues (8). The IL-21R has homology to the shared {beta}-chain of the IL-2R and the IL-15R (9) and is associated with the common {gamma}-chain of the IL-2R (8, 10). IL-21, produced by CD4+, but not CD8+, T cells is important, but not required, for mouse NK cell development and has been shown to inhibit IL-15-mediated expansion of resting NK cells (11). IL-21 inhibits the proliferation of mouse B cells induced by IL-4 and anti-IgM Ab. It has the opposite effect on B cells stimulated with anti-CD40 mAb on which proliferation is increased (8).

In the present study, we have analyzed the capacity of rIL-21 to induce the production of Ig isotypes by human B cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cells, separation, and culture conditions

Highly purified (purity, >98%) CD19+ spleen B cells were obtained from human spleen fragments (generously provided by Prof. J.-M. Fabre (Centre Hospitalier Universitaire St. Eloi, Montpellier, France) in accordance with the guidelines of the ethical committee of the Montpellier University Hospitals) by positive selection using specific mAb-coated magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany), as described (12). Purified CD19+ B cells (purity, >98%) were also isolated from PBMC (Etablissement Français du Sang, Montpellier, France) using the Rosettesep procedure (StemCell Technologies, Meylan, France). CD19+CD27– and CD19+CD27+ B cells were obtained by staining with an FITC-conjugated anti-CD27 mAb (BD PharMingen, La Jolla, CA) followed by sorting on a FACSVantage (BD Biosciences, San Jose, CA). Two-color sorting was conducted using an additional PE-labeled mouse anti-human surface IgG mAb (BD Biosciences). Reanalysis of sorted cells showed >99% purity.

Induction of Ig production was conducted as follows: whole CD19+, or sorted CD19+CD27– and CD19+CD27+ human B lymphocytes (106 per milliliter) were cultured with 1 µg/ml anti-CD40 mAb 89 (13), in the presence or absence of combinations of rIL-4, rIL-10 (kind gifts from Dr. F. Brière (Schering-Plough, Dardilly, France) and rIL-21 (see Ref. 8) in flat-bottom 96-well culture plates in IMDM, supplemented with 10% FCS in sextuplate in a final volume of 200 µl. PBMC (106 per milliliter) were cultured with combinations of cytokines, in the absence of anti-CD40 mAb. After 12 days of incubation at 37°C and 5% CO2, culture supernatants were collected, and Ig content was measured by isotype-specific ELISA. For analysis of various transcripts, purified CD19+ B cells were cultured under the same experimental conditions and were harvested for mRNA isolation after 5 or 7 days of culture.

Measurement of Ig production

IgG1, IgG2, IgG3, IgG4, IgE, and IgA secretion was determined by isotype-specific ELISA (12).

cDNA synthesis, RT-PCR analysis, and Northern blotting analysis

Detection of isotype class-specific germline transcripts, activation-induced cytidine deaminase (AID), and spliced I{gamma}-Cµ transcripts was conducted by RT-PCR. RNA extraction, reverse transcription, and amplification of cDNA was conducted as described (12). The nucleotide sequences of PCR primers (5'-3') were as follows: C{gamma}1, sense I{gamma}1, ACGAGGAACATGACTGGATGC, and antisense C{gamma}1, TGTGAGTTTTGTCACAAGATTTGGG; C{gamma}3, sense I{gamma}3, AGGTGGGCAGGCTTCAGGCACCGAT, and antisense C{gamma}3, TTGTGTCACCAAGTGGGGTTTTAGC; AID, sense, GAGATTTTTCTGGCCTGAGA, and antisense, CCACTGTCTTCAGCAGAGAT; I{gamma}-Cµ, sense, GAGGGAGGAGGAGAGGCCCC, and antisense, AGGAAGTCCTGTGCGAGGCAG; and {beta}-actin, sense, GCTGCTGACCGAGGCCCCCCTGAAC, and antisense, CTCCTTAATGTCACGCACGATTTC.

PCR conditions for germline transcripts consisted of 35 cycles of 30 s at 94°C (25 cycles for {beta}-actin), 1 min at 60°C, and 1 min at 72°C, and for AID, as well as spliced I{gamma}-Cµ transcripts, of 32 cycles of 45 s at 94°C, 30 s at 55°C, and 1.5 min at 72°C. Where indicated, PCR products were sequenced on a 3730XL sequencer (Applied Biosystems, Foster City, CA).


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
To investigate the capacity of rIL-21 to induce the production of Ig, purified human CD19+ splenic B cells were stimulated with anti-CD40 mAb in the presence of increasing concentrations of rIL-21, and the production of IgG1, IgG2 IgG3, IgG4, IgE, and IgA was analyzed by isotype-specific ELISA. rIL-21 induced the production of all isotypes, with the exception of IgE and IgA, in a dose-dependent fashion (Fig. 1 and data not shown). Optimal IgG production-inducing capacity of rIL-21 was observed at concentrations between 4 and 10 ng/ml cytokine. As expected, addition of rIL-4 to cultures of anti-CD40 mAb-stimulated CD19+ B cells, induced the production of IgG4 and IgE (14), which was strongly enhanced when both rIL-4 and rIL-21 were added. Moreover, rIL-4 also enhanced rIL-21-induced IgG1 and IgG3 production.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 1. Induction of Ig production by rIL-4 and/or rIL-21 in cultures of purified CD19+ splenic B cells. Purified human CD19+ splenic B cells (106 per milliliter) were stimulated with anti-CD40 mAb in the presence or absence of rIL-4 (10 ng/ml) and/or increasing concentrations of rIL-21. Culture supernatants were analyzed by isotype-specific ELISA after 12 days of culture. Data represent mean ± SD of five independent experiments with spleen samples from four different donors.

 
Splenic and peripheral blood B cell populations consist of both IgM-producing naive B cells that have not yet undergone isotype class switching and isotype-committed memory B cells that produce IgG, IgA, or IgE. According to the literature, naive B cells are characterized by the absence of cell surface CD27 and are surface IgG–, whereas isotype-committed Ig-producing B cells are contained within the CD19+CD27+ population (15, 16). CD19+CD27– and CD19+CD27+ B cells are about equally represented in human spleen (Fig. 2). IL-21 has been reported to induce the proliferation of human peripheral blood B cells stimulated via CD40 (8), raising the possibility that its Ig production-inducing capacity might be due to its growth-promoting activities on isotype-committed Ig-producing B cells, rather than to a specific induction of class isotype switching in naive B cells. Therefore, the Ig production-inducing effects of rIL-21 were tested on highly purified CD19+CD27– and CD19+CD27+ splenic B cells.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 2. Expression of surface IgG and CD27 on CD19+ splenic B cells. Purified CD19+ spleen-derived B cells were stained with an FITC-conjugated anti-CD27 mAb and a PE-conjugated mouse anti-human IgG mAb and analyzed by flow cytometry. Cell surface expression of CD27 (x-axis) and IgG (y-axis) is represented on a four-decade log scale as dot blots of correlated FITC and PE fluorescence. Quadrant markers were positioned to include >98% of control Ig-stained cells in the lower left quadrant (not shown).

 
As shown in Table I, rIL-21 induced the production of all four IgG isotype subclasses by CD19+CD27+ B cells at levels that were comparable to those produced by nonseparated CD19+ B cells (Fig. 1). However, rIL-21 specifically induced the production of IgG1 and IgG3, but neither IgG2, nor IgG4, by CD19+CD27– B cells. It is of note that ~2% of CD19+CD27– B were surface IgG+ (Fig. 2) and could therefore contribute to the observed IgG1 and IgG3 production. However, removal of surface IgG+ cells by FACS sorting yielded similar results (Table I), excluding the latter possibility. These results indicate that the production of both the IgG1 and IgG3 isotypes directly results from isotype switching, whereas that of IgG2 and IgG4 may be due to the proliferative effect of rIL-21 on isotype-committed CD19+CD27+ B cells. Indeed, rIL-21 was found to induce strong proliferative responses in CD19+CD27+, but not in CD19+CD27– B cell subpopulations (data not shown). This dual effect of rIL-21 with respect to the induction of CSR and of IgG1 and IgG3 production by naive B cells is reminiscent to that of rIL-10, the other cytokine known to promote CSR for the production of these isotypes (6). Finally, the IgG1 and IgG3 production-inducing capacity of IL-21 is not related to the origin of the B cells, because production of both isotypes was observed in cultures of PBMC, as well as anti-CD40 mAb-activated purified peripheral blood-derived B cells, in the presence of this cytokine (data not shown). The appearance of small CH-specific germline RNA transcripts is considered to be an obligatory event, preceding isotype switching in both mouse and human B cells (4, 17). Indeed, C{gamma}1 and C{gamma}3 sterile transcripts were detectable in B cells that had been stimulated with anti-CD40 mAb and rIL-21 (Fig. 3A). It is of note that B cells stimulated either via the CD40 molecule or the IL-21R also expressed these transcripts, indicating that, although a prerequisite, their expression alone is not sufficient to warrant IgG production. Because of the high homology among the human {gamma} subclasses, PCR amplification by itself may cause difficulties in the identification of {gamma} subclass-specific transcripts (18). However, RT-PCR products from germline C{gamma}1 and C{gamma}3 have unique endonuclease restriction sites; therefore, their specific germline transcripts can be determined by sequence analysis and identification of the SfoI (NarI isoschizomer) ({gamma}1) or NcoI ({gamma}3) restriction endonuclease digestion of the respective PCR products (19, 20). Stimulation of purified CD19+ spleen B cells with anti-CD40 mAb and rIL-21 for 5 days, followed by RNA isolation and RT-PCR analysis of germline transcript synthesis, yielded I{gamma}1-C{gamma}1 and I{gamma}3-C{gamma}3 PCR products with expected lengths of 603 and 670 bp, respectively (Fig. 3B). Direct sequence analysis and SfoI and NcoI digestion of the PCR-amplified rIL-21-induced transcripts showed that the amplified product contained the NarI and NcoI restriction sites, indicating that IL-21 specifically induces germline {gamma}1 and {gamma}3 transcription (data not shown).


View this table:
[in this window]
[in a new window]
  		Table I. IL-21 induces the production of IgG1 and IgG3 by CD40-activated CD19+CD27– human B cellsa

 


View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of rIL-21 on isotype germline transcription by human B cells. A, Human CD19+ B cells were stimulated as described in Materials and Methods, and transcripts for I{gamma}1, I{gamma}3, and {beta}-actin were amplified by PCR. B, Amplification products corresponding to germline {gamma} transcripts of B cells stimulated with rIL-21 and anti-CD40 mAb were digested with SfoI or with NcoI. Size and position of the largest expected digestion products are indicated.

 
Stimulation of splenic B cells with anti-CD40 mAb and rIL-21 was found to induce transcription of the AID gene that could be easily detected after 5 and 7 days of culture (Fig. 4). AID transcripts were also present in B cells treated with anti-CD40 mAb alone. However, despite the presence of sterile transcripts for {gamma}1 and {gamma}3, as well as AID transcripts in B cells stimulated via CD40, the production of IgG was observed only in those cells that had been costimulated with anti-CD40 mAb and rIL-21. These results show that rIL-21, although incapable of inducing AID transcription by itself, is required to promote IgG production, most likely by synergizing with CD40-mediated signaling pathways.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 4. Analysis of AID and spliced I{gamma}-Cµ transcripts in splenic B cells. Purified human CD19+ B cells were stimulated, and AID gene and spliced I{gamma}-Cµ transcripts were analyzed as described in Materials and Methods. Representative results of three independent experiments with spleen cells from different individuals.

 
The normal molecular mechanism of isotype class switch involves a nonhomologous recombination event during which the intervening DNA between two S regions is excised as circular DNA (21). To provide direct evidence that the induction of IgG1 and IgG3 production by rIL-21 is associated with this type of DNA recombination, the presence of circular switch DNA in activated B cells was analyzed. At day 7 of culture (and in some experiments at day 5), spliced I{gamma}-Cµ transcripts resulting from the formation of S{gamma}-Sµ switch circular DNA were present only in B cells stimulated with both anti-CD40 mAb and rIL-21 and were readily detectable after 25 cycles of amplification. In contrast, further increasing the number of PCR cycles (up to 45) yielded no positive signal in B cells stimulated with anti-CD40 mAb or rIL-21 alone. The class specificity of the recombination events was confirmed by the lack of detectable I{epsilon}-Cµ and I{alpha}-Cµ switch transcripts in B cells stimulated with rIL-21 and anti-CD40 mAb (results not shown) in association with the absence of IgE and IgA production, respectively, under these culture conditions. In theory, only a single nonreplicating switch circular DNA can be generated from each allele in a given B cell. Because this is a one-time event, the observed increase in the number of switch DNA circles cannot be explained by the expansion of already isotype-committed B cells. Therefore, the observed production of IgG1 and IgG3 must be the result of a bona fide CSR event induced by IL-21 in naive surface IgG– B lymphocytes and is unlikely to be due to the proliferation-inducing effects of this cytokine. The latter notion is underscored by the observation that I{gamma}-Cµ transcripts were absent in anti-CD40 mAb and rIL-21-stimulated B cells in early cultures and became detectable in increased amount only after 5 days of culture (Fig. 4 and results not shown).

Taken together, the results of this study show that IL-21 plays an important role in the regulation of IgG1 and IgG3 production, in particular due to its capacity to induce CSR in naive human B cells.


   Footnotes
 
1 S.L. was supported by MedBioMed. Back

2 Address correspondence and reprint requests to Dr. Hans Yssel, Institut National de la Santé et de la Recherche Médicale, Unité 454, Centre Hospitalier Universitaire Arnaud de Villeneuve, 34295 Montpellier, cedex 5, France. E-mail address: yssel{at}montp.inserm.fr Back

3 Abbreviations used in this paper: CSR, class switch recombination; AID, activation-induced cytidine deaminase. Back

Received for publication June 30, 2003. Accepted for publication March 8, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Honjo, T., K. Kinoshita, M. Muaramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu. Rev. Immunol. 20:165.[Medline]
  2. Banchereau, J., F. Bazan, D. Blanchard, F. Briere, J. P. Galizzi, C. van Kooten, Y. J. Liu, F. Rousset, S. Saeland. 1994. The CD40 antigen and its ligand. Annu. Rev. Immunol. 12:881.[Medline]
  3. Manis, J. P., M. Tian, F. W. Alt. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23:31.[Medline]
  4. Gauchat, J. F., D. A. Lebman, R. L. Coffman, H. Gascan, J. E. de Vries. 1990. Structure and expression of germline epsilon transcripts in human B cells induced by interleukin 4 to switch to IgE production. J. Exp. Med. 172:463.[Abstract/Free Full Text]
  5. Pène, J., F. Rousset, F. Brière, I. Chretien, J. Y. Bonnefoy, H. Spits, T. Yokota, N. Arai, K. Arai, J. Banchereau, J. E. De Vries. 1988. IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons {gamma} and {alpha} and prostaglandin E2. Proc. Natl. Acad. Sci. USA 85:6880.[Abstract/Free Full Text]
  6. Brière, F., C. Servet-Delprat, J. M. Bridon, J. M. Saint-Remy, J. Banchereau. 1994. Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3. J. Exp. Med. 179:757.[Abstract/Free Full Text]
  7. Fujieda, S., A. Saxon, K. Zhang. 1996. Direct evidence that {gamma}1 and {gamma}3 switching in human B cells is interleukin-10 dependent. Mol. Immunol. 33:1335.[Medline]
  8. Parrish-Novak, J., S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, J. Johnston, K. Madden, W. Xu, J. West, et al 2000. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408:57.[Medline]
  9. Ozaki, K., K. Kikly, D. Michalovich, P. R. Young, W. J. Leonard. 2000. Cloning of a type I cytokine receptor most related to the IL-2 receptor {beta} chain. Proc. Natl. Acad. Sci. USA 97:11439.[Abstract/Free Full Text]
  10. Asao, H., C. Okuyama, S. Kumaki, N. Ishii, S. Tsuchiya, D. Foster, K. Sugamura. 2001. Cutting edge: the common {gamma}-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.[Abstract/Free Full Text]
  11. Kasaian, M. T., M. J. Whitters, L. L. Carter, L. D. Lowe, J. M. Jussif, B. Deng, K. A. Johnson, J. S. Witek, M. Senices, R. F. Konz, et al 2002. IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Immunity 16:559.[Medline]
  12. Lecart, S., F. Morel, N. Noraz, J. Pene, M. Garcia, K. Boniface, J. C. Lecron, H. Yssel. 2002. IL-22, in contrast to IL-10, does not induce Ig production, due to absence of a functional IL-22 receptor on activated human B cells. Int. Immunol. 14:1351.[Abstract/Free Full Text]
  13. Valle, A., C. E. Zuber, T. Defrance, O. Djossou, M. De Rie, J. Banchereau. 1989. Activation of human B lymphocytes through CD40 and interleukin 4. Eur. J. Immunol. 19:1463.[Medline]
  14. Gascan, H., J. F. Gauchat, M. G. Roncarolo, H. Yssel, H. Spits, J. E. de Vries. 1991. Human B cell clones can be induced to proliferate and to switch to IgE and IgG4 synthesis by interleukin 4 and a signal provided by activated CD4+ T cell clones. J. Exp. Med. 173:747.[Abstract/Free Full Text]
  15. Klein, U., T. Goossens, M. Fischer, H. Kanzler, A. Braeuninger, K. Rajewsky, R. Kuppers. 1998. Somatic hypermutation in normal and transformed human B cells. Immunol. Rev. 162:261.[Medline]
  16. Nagumo, H., K. Agematsu, N. Kobayashi, K. Shinozaki, S. Hokibara, H. Nagase, M. Takamoto, K. Yasui, K. Sugane, A. Komiyama. 2002. The different process of class switching and somatic hypermutation; a novel analysis by CD27– naive B cells. Blood 99:567.[Abstract/Free Full Text]
  17. Stavnezer-Nordgren, J., S. Sirlin. 1986. Specificity of immunoglobulin heavy chain switch correlates with activity of germline heavy chain genes prior to switching. EMBO J. 5:95.[Medline]
  18. Mills, F. C., M. P. Mitchell, N. Harindranath, E. E. Max. 1995. Human Ig S{gamma} regions and their participation in sequential switching to IgE. J. Immunol. 155:3021.[Abstract]
  19. Kitani, A., W. Strober. 1993. Regulation of C{gamma} subclass germ-line transcripts in human peripheral blood B cells. J. Immunol. 151:3478.[Abstract]
  20. Fujieda, S., K. Zhang, A. Saxon. 1995. IL-4 plus CD40 monoclonal antibody induces human B cells {gamma} subclass-specific isotype switch: switching to {gamma}1, {gamma}3, and {gamma}4, but not {gamma}2. J. Immunol. 155:2318.[Abstract]
  21. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, S. Tonegawa. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy-chain genes. Nature 286:676.[Medline]



This article has been cited by other articles:


Home page
 BloodHome page
R. A. Ettinger, E. A. James, W. W. Kwok, A. R. Thompson, and K. P. Pratt
Lineages of human T-cell clones, including T helper 17/T helper 1 cells, isolated at different stages of anti-factor VIII immune responses
Blood, August 13, 2009; 114(7): 1423 - 1428.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. A. Neveu, J. B. Allard, O. Dienz, M. J. Wargo, G. Ciliberto, L. A. Whittaker, and M. Rincon
IL-6 Is Required for Airway Mucus Production Induced by Inhaled Fungal Allergens
J. Immunol., August 1, 2009; 183(3): 1732 - 1738.
[Abstract] [Full Text] [PDF]

Home page
 LupusHome page
H. Wu, E. Center, G. Tsokos, and H. Weiner
Suppression of murine SLE by oral anti-CD3: inducible CD4+CD25-LAP+ regulatory T cells control the expansion of IL-17+ follicular helper T cells
Lupus, June 1, 2009; 18(7): 586 - 596.
[Abstract] [PDF]

Home page
 J. Leukoc. Biol.Home page
G.-Y. Seo, J. Youn, and P.-H. Kim
IL-21 ensures TGF-{beta}1-induced IgA isotype expression in mouse Peyer's patches
J. Leukoc. Biol., May 1, 2009; 85(5): 744 - 750.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Konforte, N. Simard, and C. J. Paige
IL-21: An Executor of B Cell Fate
J. Immunol., February 15, 2009; 182(4): 1781 - 1787.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
R Ettinger, S Kuchen, and P E Lipsky
Interleukin 21 as a target of intervention in autoimmune disease
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii83 - iii86.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. M. Odegard, B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft
ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity
J. Exp. Med., November 24, 2008; 205(12): 2873 - 2886.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Y. Wu, F. J. Quintana, and H. L. Weiner
Nasal Anti-CD3 Antibody Ameliorates Lupus by Inducing an IL-10-Secreting CD4+CD25-LAP+ Regulatory T Cell and Is Associated with Down-Regulation of IL-17+CD4+ICOS+CXCR5+ Follicular Helper T Cells
J. Immunol., November 1, 2008; 181(9): 6038 - 6050.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye
STAT3 is required for IL-21-induced secretion of IgE from human naive B cells
Blood, September 1, 2008; 112(5): 1784 - 1793.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
W. J. Leonard, R. Zeng, and R. Spolski
Interleukin 21: a cytokine/cytokine receptor system that has come of age
J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye
IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4
J. Immunol., August 1, 2008; 181(3): 1767 - 1779.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Iuchi, S. Teitz-Tennenbaum, J. Huang, B. G. Redman, S. D. Hughes, M. Li, G. Jiang, A. E. Chang, and Q. Li
Interleukin-21 Augments the Efficacy of T-Cell Therapy by Eliciting Concurrent Cellular and Humoral Responses
Cancer Res., June 1, 2008; 68(11): 4431 - 4441.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits
STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation
J. Immunol., April 1, 2008; 180(7): 4805 - 4815.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
A H Sawalha, K M Kaufman, J A Kelly, A J Adler, T Aberle, J Kilpatrick, E K Wakeland, Q-Z Li, A E Wandstrat, D R Karp, et al.
Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus
Ann Rheum Dis, April 1, 2008; 67(4): 458 - 461.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
V. L. Bryant, C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, R. de Waal Malefyt, and S. G. Tangye
Cytokine-Mediated Regulation of Human B Cell Differentiation into Ig-Secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells
J. Immunol., December 15, 2007; 179(12): 8180 - 8190.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Kishida, Y. Hiromura, M. Shin-Ya, H. Asada, H. Kuriyama, M. Sugai, A. Shimizu, Y. Yokota, T. Hama, J. Imanishi, et al.
IL-21 Induces Inhibitor of Differentiation 2 and Leads to Complete Abrogation of Anaphylaxis in Mice
J. Immunol., December 15, 2007; 179(12): 8554 - 8561.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar
Interleukin-21 Signaling: Functions in Cancer and Autoimmunity
Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda
IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis
J. Immunol., November 15, 2007; 179(10): 7157 - 7165.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Kuchen, R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger
Essential Role of IL-21 in B Cell Activation, Expansion, and Plasma Cell Generation during CD4+ T Cell-B Cell Collaboration
J. Immunol., November 1, 2007; 179(9): 5886 - 5896.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Herber, T. P. Brown, S. Liang, D. A. Young, M. Collins, and K. Dunussi-Joannopoulos
IL-21 Has a Pathogenic Role in a Lupus-Prone Mouse Model and Its Blockade with IL-21R.Fc Reduces Disease Progression
J. Immunol., March 15, 2007; 178(6): 3822 - 3830.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Ettinger, G. P. Sims, R. Robbins, D. Withers, R. T. Fischer, A. C. Grammer, S. Kuchen, and P. E. Lipsky
IL-21 and BAFF/BLyS Synergize in Stimulating Plasma Cell Differentiation from a Unique Population of Human Splenic Memory B Cells
J. Immunol., March 1, 2007; 178(5): 2872 - 2882.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf
IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo
Blood, March 1, 2007; 109(5): 2023 - 2031.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. L. Good, V. L. Bryant, and S. G. Tangye
Kinetics of Human B Cell Behavior and Amplification of Proliferative Responses following Stimulation with IL-21
J. Immunol., October 15, 2006; 177(8): 5236 - 5247.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. F. Fecteau, G. Cote, and S. Neron
A New Memory CD27-IgG+ B Cell Population in Peripheral Blood Expressing VH Genes with Low Frequency of Somatic Mutation
J. Immunol., September 15, 2006; 177(6): 3728 - 3736.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen
IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells
J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Ettinger, G. P. Sims, A.-M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky
IL-21 Induces Differentiation of Human Naive and Memory B Cells into Antibody-Secreting Plasma Cells
J. Immunol., December 15, 2005; 175(12): 7867 - 7879.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. T. Avery, J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, and S. G. Tangye
Increased Expression of CD27 on Activated Human Memory B Cells Correlates with Their Commitment to the Plasma Cell Lineage
J. Immunol., April 1, 2005; 174(7): 4034 - 4042.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. L. Vollmer, R. Liu, M. Price, S. Rhodes, A. La Cava, and F.-D. Shi
Differential Effects of IL-21 during Initiation and Progression of Autoimmunity against Neuroantigen
J. Immunol., March 1, 2005; 174(5): 2696 - 2701.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Ozaki, R. Spolski, R. Ettinger, H.-P. Kim, G. Wang, C.-F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al.
Regulation of B Cell Differentiation and Plasma Cell Generation by IL-21, a Novel Inducer of Blimp-1 and Bcl-6
J. Immunol., November 1, 2004; 173(9): 5361 - 5371.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pène, J.
Right arrow Articles by Yssel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pène, J.
Right arrow Articles by Yssel, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS