|
|
||||||||



* Rheumatology Section, Imperial College Faculty of Medicine, Hammersmith Campus, London, United Kingdom;
Departments of Medicine and Immunology, University of Colorado Health Sciences Center, Denver, CO 80262; and
Department of Pathology, Centre Medical Universitaire, Geneva, Switzerland
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
There is considerable evidence that gp70 is a major target of pathogenic autoantibodies in murine models of systemic lupus erythematosus (SLE).3 Immune complexes (ICs) formed between gp70 and anti-gp70 Abs (gp70IC) have been shown to be present in the glomeruli of diseased New Zealand (NZ) mice (6), and serum gp70IC levels closely correlate with the development of lupus nephritis (7, 8, 9, 10). gp70 provides a unique system to examine autoantibody production in lupus-prone mice, because, unlike anti-nuclear Abs, the Ag availability can be quantified and potentially manipulated.
Previous linkage studies in NZ mice have shown that no single locus is responsible for serum gp70 levels. A region on chromosome 13, between 30 and 50 cM from the centromere, was linked to gp70 and gp70IC levels in NZB, NZW, and BXSB mice on a C57BL/10 or C57BL/6 background (9, 11, 12). A region on distal chromosome 4 was linked to serum gp70 levels in NZB mice on a C57BL/6 background (9), and linkage with serum gp70 and/or serum gp70IC levels has also been demonstrated on chromosome 7 in NZW and 129 mice on a C57BL/6 background (12, 13). A number of other loci have demonstrated weak linkage to gp70 and gp70IC, including chromosome 17, at the H2 complex, in non-H2-matched cohorts (8, 12, 14).
Reflection on the above data suggests that genetic background might influence the loci linked to serum gp70 production. To investigate the genetic basis of gp70 and gp70IC production in the NZ model of SLE, two experimental crosses were studied: an (NZW x BALB/c.NZW-H2z F1) x NZB backcross (W-BC) and a (NZB x BALB/c)F2 intercross (B-F2). Mice in the W-BC cohort were all H2z/d and mice in the B-F2 cohort all H2d/d.
Linkage analyses were conducted on the two crosses to determine the contribution of the NZB, NZW, and BALB/c genomes to gp70 and gp70IC production. In this study, we corroborate a number of loci already linked with gp70 production, and in addition show remarkably strong linkage to a previously unrecognized locus on chromosome 12, thus highlighting the importance of the nonautoimmune background strain on complex traits. These data are confirmed using a BALB/c mouse congenic for a 34-cM region of NZW chromosome 12 (centromere to 34 cM). We show that the anti-gp70 response is constrained by both Ag availability and strain-specific genetic factors.
| Materials and Methods |
|---|
|
|
|---|
(NZB x BALB/c)F2 cohort. NZB/BINJ (NZB) and BALB/cByJ (BALB/c) mice were purchased from Harlan Olac (Bicester, Oxfordshire, U.K.) and maintained in the Biological Services Unit of Imperial College Faculty of Medicine (London, U.K.). These mice were crossed, and the resulting F1 progeny were intercrossed to produce the (NZB x BALB/c)F2 cohort (B-F2; n = 222 female mice). Additionally, control NZB, NZW, and BALB/c female mice were obtained from the same source and studied in parallel to the B-F2 cohort.
(NZW x BALB/c.H2z) x NZB cohort. NZB/BINJ, NZW/LacJ, and BALB/cByJ mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained in the animal care facilities at the National Jewish Center for Research and Medicine and University of Colorado Health Sciences Center (Denver, CO). BALB/cByJ mice congenic for the NZW H2z locus were obtained from a cohort maintained as above (15). These mice were crossed to produce a backcross cohort, (NZW x BALB/c.H2z)F1 x NZB (W-BC; n = 126 female mice).
BALB/c.NZW C12 congenic. BALB/c mice congenic for a 34-cM region of NZW chromosome 12 (centromere to 34 cM) were bred to backcross 6 using the speed congenic method (16), and the interval was fixed by intercrossing heterozygous carriers of the congenic interval (R. J. Rigby, N. Lea, H. Gill, J. Boyle, and T. J. Vyse, manuscript in preparation). Only female BALB/c.NZW C12 congenic mice were studied.
Genetic mapping using simple sequence length polymorphisms
Oligonucleotides flanking microsatellite repeat regions polymorphic between NZB and BALB/c (B-F2) or NZW and BALB (W-BC) were used to amplify genomic DNA in a standard 35-cycle PCR. The resulting PCR product was electrophoresed on polyacrylamide gels (MiniProtean II electrophoresis system; Bio-Rad, Hemel Hempstead, U.K.) at 2.25 V/mm for 90120 min, stained with ethidium bromide solution, viewed under UV light, and digitally photographed.
An autosome-wide map, at an average marker distance of <20 cM, was created for both cohorts. Marker positions were based on data from the Mouse Genome Database (www.informatics.jax.org).
Collection of sera and subsequent serological analyses
The B-F2 cohort was bled from the tail every 2 mo, from 6 mo until 14 mo of age. The W-BC cohort was bled from the tail at 7 and 9 mo of age. Mice were sacrificed at 14 mo of age, when a proteinuria level of
5 g/liter (3+) on Combur3 urine dipstick (Roche Diagnostics, Lewes, U.K.) at one time point, or a proteinuria level of 1g/liter (2+) for two consecutive time points occurred. Blood was incubated at 37°C for 30 min, and centrifuged for 10 min at 13,500 rpm at room temperature, and the serum fraction was removed. Samples were stored at −70°C.
Serum gp70 was assayed as previously described (17). Briefly, microtiter plates were coated with goat anti-gp70, followed by incubation with serum samples. The bound gp70 was detected with an alkaline phosphatase-conjugated goat anti-gp70 Ab. The anti-gp70 Abs were assayed in a similar manner, but as the anti-gp70 Abs form ICs with the excess of serum gp70, they were precipitated with polyethylene glycol. Abs to dsDNA were assayed as described previously (18). Briefly, biotinylated plasmid DNA was added to streptavidin-coated microtiter plates and incubated with serum samples. The bound anti-dsDNA Abs were detected with an HRP-conjugated anti-mouse IgG Ab.
Assessment of glomerular disease
Kidneys from the B-F2 cohort were fixed in Bouins solution (three parts saturated picric acid to one part 40% formaldehyde and 5% glacial acetic acid; all VWR, Poole, U.K.) for 24 h, transferred to 70% ethanol, processed overnight, and embedded in paraffin wax. Two-micrometer sections were cut and stained with H&E. Kidneys were assessed using the glomerular scoring system described in Ref. 18 .
Typing of Friend virus susceptibility 1 (Fv1) alleles
Polymorphisms in the Fv1 gene present between NZB, NZW, BXSB, BALB/c, and C57BL/10 mouse strains were investigated by either direct sequencing or PCR. The entire coding sequence was determined in NZB, NZW, and BXSB strains by direct sequencing using the primers GGACCTCATTGCTGATTGGT (no. 1 forward), CCCTAATCTTGCAGAAATGTTCA (no. 1 reverse), GATAAATGTGGCCGATCTCC (no. 2 forward), GCCATAACCACTTTCCTCAGA (no. 2 reverse), TGTGGGAGGACATAGATTCTG (no. 3 forward), CTGCAGCTCTCTTGTAGTAGGC (no. 3 reverse), TTTAGGTCCTTTGAGCCTTG (no. 4 forward), and TCCCCACTGTTATGTCCTTT (no. 4 reverse). Additionally, the previously published polymorphic region (19) was sequenced in C57BL/10 and BALB/c mice. Briefly, PCR product was amplified with the forward primer in the presence of fluorescently labeled di-deoxynucleotides (Big-Dye terminators; Applied Biosystems, Warrington, U.K.) and purified, and the sequence was determined by capillary electrophoresis (3700 DNA Analyser; Applied Biosystems). The sequence was analyzed with AutoAssembler v.1.4.0 (Applied Biosystems).
The presence or absence of a 4-bp deletion in the 3' region of the gene was also determined using the above sequencing method with the primers TGCCAAATACAAACAAACTG (forward) and TAGTTTTAAATTGGGGAGCA (reverse) in NZB, NZW, BXSB, C57BL/10, and BALB/c mice.
The presence or absence of a 1.3-kb deletion was determined in NZB, NZW, BXSB, C57BL/10, and BALB/c mice by PCR using the primers AACCTGTCACCAGACCCAAG (forward) and CAGCACCAGACCAACCCTAT (reverse). Briefly, 40 ng of genomic DNA was amplified with Taq polymerase (Bioline, London, U.K.) in a standard 35-cycle PCR. PCR products were separated by gel electrophoresis (0.6% agarose/1x TBE/0.3 mg/ml ethidium bromide), visualized under UV light, and digitally photographed.
The presence or absence of an inserted intracisternal A-particle (IAP) domain in the 3' region was determined using PCR as above, and in the above strains, with a common forward primer (TGCCAAATACAAACAAACTG) and a reverse primer specific for genomic sequence with (AATTCGGCACCAAATGTTAT) or without the IAP insertion (TGTCTTCAGACACACCAGAA). All nucleotide positions described are based on the sequence X97719.
Statistical analysis
Linkage analyses and permutation tests were conducted using Map Manager QTb29 (20). Thresholds for suggestive, significant, and highly significant linkage were based on the results of 1000 permutations for a given trait and cohort. These values are highlighted in the text as required.
The significance of differences between gp70 and gp70IC levels in the crosses and strains studied was determined by the Mann-Whitney U test, and the correlation between gp70 and gp70IC levels was determined by nonparametric Spearman correlation. The association between histological glomerular disease and high or low serum levels of anti-dsDNA Abs or gp70IC were determined using Fishers exact test. The criteria for high and low autoantibody levels were based on serum levels being
75th percentile and
25th percentile of the entire cohort. The difference between the serum levels of anti-dsDNA Abs and gp70IC between mice with high (score of 47) and low (score of 01) glomerular involvement was determined by the Mann-Whitney U test. These tests were performed using GraphPad Prism version 3.03 for Windows (GraphPad Software, San Diego, CA).
| Results |
|---|
|
|
|---|
Serum levels of gp70 and gp70IC in parental mice
In a cohort of 9-mo-old female NZB mice (n = 15), the median serum gp70 level was 41.8 µg/ml, and the median gp70IC level was 4.0 µg/ml; in age- and sex-matched NZW mice (n = 11), the median serum gp70 level was 37.5 µg/ml, and the median gp70IC level was 0.30 µg/ml. Female BALB/c mice (n = 14) had significantly lower gp70 (0.34 µg/ml; p < 0.0001) and produced minimal anti-gp70 Abs of
0.05 µg/ml, the lower limit of detection in the assay.
Linkage of serum gp70 levels to a region on chromosome 12
A genome-wide scan for loci linked with serum gp70 levels in both the B-F2 and W-BC crosses revealed a highly significant area of linkage within a 7-cM region on proximal chromosome 12 (Fig. 1). Serum gp70 levels were measured at two time points (7 and 9 mo of age in the W-BC cohort; 6 and 10 mo of age in the B-F2 cohort), both of which demonstrated highly significant linkage in their respective crosses. The log of odds (LOD) scores ranged from 8.4 (W-BC; 7 mo of age) to 23 (B-F2; 6 mo of age) (Table I). The positive association with high serum gp70 levels was derived from NZ alleles in both of the cohorts investigated, and acted in a recessive manner in the B-F2 cross.
|
|
Two other loci with at least suggestive linkage (based on trait-specific permutation tests) were linked to serum gp70 levels (Table II). A region on distal chromosome 4 was previously associated with serum gp70 levels in crosses between NZB and C57BL/6 (9). This region was also associated with serum gp70 levels in both the B-F2 (p = 3.9 x 10−6) and W-BC (p = 1.4 x 10−2) cohorts.
|
Serum gp70IC levels were also linked to proximal chromosome 12, apparently within the same region as linkage to serum gp70 levels (Fig. 2). The LOD scores were smaller than those observed for serum gp70 levels, with a maximum LOD score of 3.9 in the W-BC and 5.9 in the B-F2 cohorts at 9 and 10 mo of age, respectively. Interestingly, there seems to be a secondary, but significant, linkage peak on chromosome 12 in the W-BC cohort, in the region 2030 cM from the centromere. Linkage to gp70IC was also observed at several other loci (Tables III and IV), including a region of distal chromosome 1, a region previously shown to be associated with gp70IC, and other autoantibodies, in NZB mice (21) and autoantibodies in a number of other murine models of SLE (22, 23, 24, 25). A significant degree of correlation, as determined by Spearman nonparametric correlation, between serum gp70 and anti-gp70 Ab levels in both the W-BC (rs = 0.61; p < 0.0001) and B-F2 cohorts (rs = 0.56; p < 0.0001) was observed. The correlation between gp70 and gp70IC in 10-mo-old B-F2 mice is demonstrated in Fig. 3. There seems to be a threshold level of serum gp70,
1.1 µg/ml, under which minimal gp70IC (<1 µg/ml) is produced.
|
|
|
|
To further study the contribution of the chromosome 12 locus to gp70 and gp70IC, a congenic mouse strain consisting of a 34-cM region of proximal NZW chromosome 12 (centromere to 34 cM) on a BALB/c background was produced. The median serum gp70 levels in a cohort of 9-mo-old female BALB/c.NZW chromosome 12 congenic mice (n = 37) was 1.80 µg/ml, significantly (p < 0.0001) higher than the serum levels in BALB/c mice (0.34 µg/ml) (Fig. 4). The gp70IC levels in the chromosome 12 congenic were not significantly higher than those in the BALB/c cohort.
|
As previously discussed, the presence of gp70IC is believed to have pathological significance in the development of renal disease in NZ mice. We examined this relation in the B-F2 cohort. Kidney sections were assessed for both glomerular matrix scarring and cellular infiltration, and the data were analyzed using two statistical methods. Serum levels of gp70IC at 10 mo of age were deemed high or low based on being
75th percentile (3.5 µg/ml) and
25th percentile (1.0 µg/ml) of the entire data set, respectively. The degree of glomerular disease was calculated by the addition of the two glomerular trait scores, and based on the finding that a cohort of 13 BALB/c mice had a median score of 0 (data not shown), a score of
2 was classed as being affected. A score of 0 or 1 was classed as unaffected. Analysis of the above data using Fishers exact test demonstrated a significant association (p = 0.0053). A similar analysis, comparing serum anti-dsDNA IgG Abs at 12 mo of age to nephritis with Fishers exact test, showed a weak association (p = 0.09).
Grouping the B-F2 cohort, based on renal histological data, into high (a score of 47) and low (a score of 01) sets allowed the comparison of both the serum levels of gp70IC and anti-dsDNA IgG Abs. Both Ab species were significantly raised in the mice with a high degree of renal disease. Mirroring the results from the Fishers exact test, the levels of serum gp70IC were more strongly associated with renal disease (p = 0.0003) than anti-dsDNA IgG Abs (p = 0.0031) (Fig. 5).
|
The locus on chromosome 4 had the most significant linkage, after chromosome 12, to serum gp70 levels, and had been associated with serum gp70 in a previous study of NZB x C57BL/6 crosses (9). To test the hypothesis that the locus on distal chromosome 4 encodes a structural gp70 element, we examined a cDNA sequence (X59305) derived from an NZB hepatic library that has been suggested to encode a serum gp70 (26). A nucleotide-nucleotide BLAST (www.ncbi.nlm.nih.gov/blast) and related sequence(www.ncbi.nlm.nih.gov/entrez) search of the NZB-derived endogenous murine leukemia virus gp70 gene sequence showed the sequence to demonstrate considerable homology to the clone RP23-384D6. This clone is within the region of maximal linkage on chromosome 4. An Interpro homology scan against protein motif databases (27) (www.ebi.ac.uk/interpro) of the translated cDNA sequence in question confirmed the presence of a viral env protein motif (Interpro accession no. IPR002050). However, the BLAST search also showed considerable homology of the gp70 gene sequence to clones located on chromosomes 2 and 11. Additionally, an Ensembl WU-BLAST search on the gp70 sequence X59305 resulted in 76 chromosomal associations. In both cases, the chromosome 2 locus had the highest degree of similarity with the gp70 locus. Therefore, it is possible that the chromosome 4 locus is structural, but the alignment may be coincidental.
Fv1 is a gene on distal chromosome 4, within the linkage region mapped in this study, that has been shown to influence retroviral replication (19). Thus, Fv1 is a good candidate gene to explain the linkage data in NZ mice. In a study of genetic associations with gp70 and gp70IC in BXSB mice crossed with C57BL/10, no linkage to distal chromosome 4 was observed (11). Therefore, we investigated the polymorphisms in Fv1, comparing NZB, NZW, BXSB, C56BL/10, and BALB/c strains. The entire gene sequence of Fv1 was determined in NZB, NZW, and BXSB mice by direct sequencing, along with the sequencing of a previously described polymorphic region (19). Additionally, the presence of a 1.3-kb deletion and downstream IAP domain (previously documented by Best et al. (19)) were investigated, as well as the segregation of a novel 4-bp deletion, identified by sequence alignment, downstream of the coding sequence. Table V shows the polymorphisms in the Fv1 gene that segregate between the NZ strains and BXSB, along with BALB/c and C57BL/10. These data show major gene differences between the autoimmune-prone strains (NZB, NZW, and BXSB) and the nonautoimmune strains (BALB/c and C57BL/10). Additionally, NZB and NZW differ from BXSB at a single nucleotide, which results in a nonconservative amino acid change. To further investigate the candidacy of Fv1, the B-F2 cohort was genotyped using the 1.3-kb deletion in Fv1 and the presence or absence of the IAP domain (Table V). Maximal linkage of serum gp70 at both 6 and 10 mo of age on chromosome 4 was observed at
4 cM proximal to Fv1 in an interval map (p = 3.9 x 10−6 and 5.0 x 10−4, respectively). In a marker map, maximal linkage of serum gp70 at 6 mo of age was observed at Fv1.
|
| Discussion |
|---|
|
|
|---|
We have studied the genetic basis of gp70 and gp70IC production in NZB and NZW mice in the context of a BALB/c background. A locus on proximal chromosome 12 in both NZB and NZW mice was identified that is strongly linked with serum gp70 and serum gp70IC levels. The point of maximal linkage, as determined by interval mapping and fixing known marker positions, seemed to differ slightly between the two cohorts, 1 cM in the W-BC cohort vs 7.2 cM in the B-F2 cohort. This is unlikely to represent different loci. The most accurate positional determination of the chromosome 12 locus is in the B-F2 cohort, a result of both the increased numbers of mice and the increased number of recombinants compared with a backcross. In this F2 cohort, the locus exhibits maximal linkage 7.2 cM from the centromere, which is 1.2 cM telomeric of D12Mit12. This proximal chromosome 12 region has not been previously linked or associated with serum gp70 and gp70IC levels, and therefore represents a novel locus, specific to NZ mice and observed only in crosses with BALB/c mice. gp70ICs have been implicated in the pathogenesis of murine lupus nephritis (7, 8, 9, 10). This study provides further support for this conclusion, because mice in the B-F2 cohort with serum gp70IC levels equal to or above the 75th percentile of the entire cohort had a significantly higher degree of renal disease than mice with gp70IC levels equal to or below the 25th percentile (p = 0.0053). Interestingly, when a similar analysis was conducted using serum anti-dsDNA IgG levels, a much weaker association was observed (p = 0.086). The correlation between renal disease and anti-gp70 Abs was further substantiated by the high levels of gp70IC observed in mice with more severe renal disease (Fig. 5). Additionally, the proximal locus on chromosome 12 was strongly linked with the development of proteinuria in the W-BC and B-F2 cohorts and histological nephritis in the B-F2 cohort (18).
A region on distal chromosome 4 was also linked to serum gp70 levels. The individual p values at this region were not as significant as those on chromosome 12, but the linkage is corroborated in both the crosses. This region of linkage has been described previously in NZB x C57BL/6 crosses (9), but not in BXSB x C57BL/10 crosses (11). Therefore, this NZ-derived region, present in both NZB and NZW, appears to be independent of the nonautoimmune background strain.
The contribution of the chromosome 12 region to the variance of serum gp70 levels ranges from 32% in the W-BC to 42% in the B-F2. The contribution of the chromosome 4 region, at the peak of linkage, was 12%. Therefore, these two major loci contribute to just over 50% of the variance of serum gp70 levels. The remaining 50% of the trait variance may be influenced by both environmental factors and other genetic effects from undetected loci, presumably with an extremely low penetrance. Obvious candidate loci, if this were the case, would be the numerous retroviral loci found throughout the mouse genome. In conclusion, these linkage data indicate that a locus on proximal chromosome 12 acts as a key genetically controlled checkpoint for high gp70 production in NZ mice.
The significantly increased serum gp70 levels in an BALB/c.NZW chromosome 12 congenic confirm the role of this region in the regulation of serum gp70 (Fig. 4). Interestingly, for a locus with a significant effect on the variance of serum gp70, the congenic mouse had a greatly reduced median serum gp70 level compared with NZW mice (1.80 vs 37.5 µg/ml). Because the environmental conditions were as similar as possible between the two cohorts, this suggests that a number of other elements from the NZW genome are required for high levels of serum gp70.
In the current two crosses, no consistent suggestion for linkage to gp70 and/or gp70IC was seen at the region of chromosome 13 (
40 cM from the centromere), previously described in NZB x C57BL/6 (9), as Bxs6 in BXSB x C57BL/10 (11) and in NZW x C57BL/6.Yaa (12) crosses. This suggests that allelic differences exist between NZ and BALB/c mice at the proximal chromosome 12 locus, but not at the mid-chromosome 13 locus described above. The opposite is presumably true when considering NZ and C57BL/6 mice.
Proposed mechanism of chromosome 4 locus
The chromosome 4 locus maps in crosses of both NZB and NZW and, unlike the locus on chromosome 12, is independent of background. We considered that a gene polymorphism might contribute to serum gp70 either by encoding a structural gp70 gene or by a cis-regulatory effect on structural locus. The bioinformatic data suggest that a sequence homology to a gp70 clone exists at the locus on distal chromosome 4, but in conjunction with considerable homology to other genomic areas. Therefore, it cannot be determined at this time if the homology to distal chromosome 4 is purely circumstantial.
To test our second hypothesis, that the locus on chromosome 4 exerts a regulatory effect on serum gp70 levels, the surrounding region was examined for candidate genes that may be associated with the control of gp70. The gene Fv1 can control retroviral replication (19) and is within the region mapped. It is known that BALB/c and C57BL/6 have a common Fv1 allele, Fv1b (19). NZB and NZW share the Fv1nr allele (28), which encodes a protein that is polymorphic, truncated, and functionally different compared with the product of the Fv1b allele (28). A previous study in which linkage to gp70 was examined in a BXSB x C57BL/10 cross demonstrated no linkage to the distal region of chromosome 4 (11). Based on genotype (Table V), we confirm that NZB and NZW were identical in sequence and polymorphic features, and carry the Fv1nr allele. However, BXSB differed at nucleotide position 3222 from NZB and NZW, having, based on genotype, the Fv1n allele. Therefore, BXSB and the NZ strains have different Fv1 alleles, giving support to our hypothesis that this gene is a good candidate in the genetic control of serum gp70 levels. If Fv1 is the causal gene, then the polymorphism at nucleotide position 3222 is likely to be functionally significant. No other polymorphisms in the coding sequence between NZ and BXSB were detected. The inclusion of Fv1 in the linkage analysis provides additional support for the hypothesis that Fv1 underlies the linkage on chromosome 4an interval map placed the maximum linkage at
4 cM proximal of Fv1, which was the most significantly linked marker in the marker map.
Proposed mechanism of chromosome 12 locus
The chromosome 12 locus associated with high serum gp70 and anti-gp70IC levels is apparent in NZ mice on a BALB/c background, but not in NZ mice on a C57BL/6 background. Therefore, it is reasonable to suggest that any gene or genes influencing these traits on proximal chromosome 12 would have to be polymorphic between BALB/c and C57BL/6. An endogenous retroviral polymerase gene, Pol7, maps within the linkage region, and is known to be polymorphic between BALB/c and C57BL/6 (29). However, a nucleotide-nucleotide BLAST (www.ncbi.nlm.nih.gov/blast) and related sequence (www.ncbi.nlm.nih.gov/entrez) search of the NZB-derived endogenous murine leukemia virus gp70 gene sequence discussed above showed no homology to the region on proximal chromosome 12. A number of transcription factor genes (E2f6, Idb2) are also situated within this region, but to date, no information on polymorphisms between BALB/c and C57BL/6 in these genes has been published. In conclusion, there seems to be no candidate genes on proximal chromosome 12 that have the equivalent structural and functional characteristics as Fv1, or indeed the endogenous retroviral loci on distal chromosome 4.
Relationship between gp70 Ag and anti-gp70ICs
The region on chromosome 12 was also associated with serum levels of anti-gp70 Abs, measured as gp70IC. However, the contribution of the region to the variance of serum gp70IC levels was considerably lower than the contribution to the variance of serum gp70 levels, with a value of
12%. This suggests a large contribution from other loci to the gp70IC production. One area that is a strong candidate for affecting serum gp70IC levels is in the region of 92 cM on chromosome 1, at D1Mit36. The locus is linked to gp70IC levels in both the W-BC and B-F2 crosses, and is in a region (Sle1, Nba2) linked with autoantibody production in murine models of SLE (21, 30). The observation that BALB/c.NZW chromosome 12 congenic mice had no significant increase in gp70IC compared with BALB/c may be a result of the absence of loci that contribute to autoantibody production outside the 34-cM region on proximal chromosome 12.
A positive correlation was observed between serum gp70 and gp70IC levels in the W-BC and B-F2 cohorts. These data, combined with the shared region of linkage on chromosome 12, suggest that the production of gp70IC is driven, at least partially, by Ag availability. However, as described above, it is apparent that other genetic factors also contribute to the loss of tolerance to gp70. There seems to be a threshold level of serum gp70,
1.1 µg/ml, under which minimal gp70IC is produced, a phenomenon shown previously by Haywood et al. (11) in BXSB x C57BL/10 crosses. The presence of individuals that have high serum gp70 levels and low gp70IC levels indicate there are other genetic factors that drive the production of gp70IC, and that it is not solely reliant on high levels of serum gp70 Ag.
In conclusion, we have shown that, in crosses between NZ and BALB/c mice, linkage of both gp70 and gp70IC is associated with a number of loci, including a novel locus on proximal chromosome 12. Linkage at this locus was confirmed in a BALB/c.NZW chromosome 12 congenic mouse strain. Additionally, linkage to a previously described region of distal chromosome 4 was confirmed. Further analysis of candidate genes in the regions described will give some insight into the genetic control of this autoantigen-autoantibody system, which will go some way toward an understanding of the pathogenesis of murine SLE.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Timothy J. Vyse, Rheumatology Section, Imperial College Faculty of Medicine, Hammersmith Campus, London, W12 0NN, U.K. E-mail address: t.vyse{at}imperial.ac.uk ![]()
3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; IC, immune complex; Fv1, Friend virus susceptibility 1; LOD, log of odds; IAP, intracisternal A-particle. ![]()
Received for publication September 16, 2003. Accepted for publication February 5, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Yoshinobu, L. Baudino, M.-L. Santiago-Raber, N. Morito, I. Dunand-Sauthier, B. J. Morley, L. H. Evans, and S. Izui Selective Up-Regulation of Intact, but Not Defective env RNAs of Endogenous Modified Polytropic Retrovirus by the Sgp3 Locus of Lupus-Prone Mice J. Immunol., June 15, 2009; 182(12): 8094 - 8103. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Baudino, K. Yoshinobu, N. Morito, S. Kikuchi, L. Fossati-Jimack, B. J. Morley, T. J. Vyse, S. Hirose, T. N. Jorgensen, R. M. Tucker, et al. Dissection of Genetic Mechanisms Governing the Expression of Serum Retroviral gp70 Implicated in Murine Lupus Nephritis J. Immunol., August 15, 2008; 181(4): 2846 - 2854. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rankin, J. J. Boyle, S. J. Rose, L. Gabriel, M. Lewis, V. Thiruudaian, N. J. Rogers, S. Izui, and B. J. Morley The Bxs6 Locus of BXSB Mice Is Sufficient for High-Level Expression of gp70 and the Production of gp70 Immune Complexes J. Immunol., April 1, 2007; 178(7): 4395 - 4401. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. M. Alamgir, N. Owens, M. Lavignon, F. Malik, and L. H. Evans Precise Identification of Endogenous Proviruses of NFS/N Mice Participating in Recombination with Moloney Ecotropic Murine Leukemia Virus (MuLV) To Generate Polytropic MuLVs J. Virol., April 15, 2005; 79(8): 4664 - 4671. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kikuchi, L. Fossati-Jimack, T. Moll, H. Amano, E. Amano, A. Ida, N. Ibnou-Zekri, C. Laporte, M.-L. Santiago-Raber, S. J. Rozzo, et al. Differential Role of Three Major New Zealand Black-Derived Loci Linked with Yaa-Induced Murine Lupus Nephritis J. Immunol., January 15, 2005; 174(2): 1111 - 1117. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |