| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Immunology and Medicine, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand;
Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan;
Coley Pharmaceutical Group, Wellesley, MA 02481;
Department of Immunology, Walter Reed Army Institute of Research, Silver Spring, MD 20910;
¶
Ehime University School of Medicine, Ehime, Japan; and
||
Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. IFN- production was also detected in malaria-infected patients, but the levels of circulating PDCs were markedly reduced, possibly because of schizont-stimulated up-regulation of CCR7, which is critical for PDC migration. The schizont-stimulated PDCs elicited a poor T cell response, but promoted 
T cell proliferation and IFN- production. The schizont immune stimulatory effects could be reproduced using murine DCs and required the Toll-like receptor 9 (TLR9)-MyD88 signaling pathway. Although the only known TLR9 ligand is CpG motifs in pathogen DNA, the activity of the soluble schizont extract was far greater than that of schizont DNA, and it was heat labile and precipitable with ammonium sulfate, unlike the activity of bacterial DNA. These results demonstrate that schizont extracts contain a novel and previously unknown ligand for TLR9 and suggest that the stimulatory effects of this ligand on PDCs may play a key role in immunoregulation and immunopathogenesis of human falciparum malaria. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
300–500 million episodes of acute malaria illness, and between 1 and 3 million people die from the disease, mostly children in Africa (1). The interaction of malaria parasites with the immune system of the host is complicated and poorly understood. Specific immunity to natural infection is acquired slowly despite a high degree of repeated exposure. Malaria parasites have devised many strategies to escape from the host’s immune response, but the host innate immune system may have evolved the ability to detect parasite molecules. The parasites have a four-stage life cycle with a stage-specific expression of many proteins at each stage. These proteins tend to be highly polymorphic, and thus they are able to evade Ag-specific immunity. The majority of the malaria parasite’s life cycle occurs within the RBC, thus excluding them both from the Ab attack and from killing by CTLs, as mature RBC do not express HLA molecules. Late blood stage parasites adhere to the endothelium of blood vessels, helping them to evade splenic clearance. The binding of blood stage parasites to myeloid dendritic cells (DCs)3 inhibits cell maturation, leading to a suppression of the T cell response (2).
Malaria parasites are almost entirely confined to the bloodstream, suggesting that the blood stage parasites and their products continue to interact with host immune cells. Parasite products released from rupturing schizonts have been shown to activate cellular components of the innate immune system to produce proinflammatory cytokines (3). In human blood, there are two subpopulations of DC precursors, which can be identified by cell phenotype and morphology. CD11c+ DCs are myeloid in appearance and express myeloid markers (CD13 and CD 33) (4, 5, 6), whereas CD11c− DCs have a negligible expression of myeloid markers, but express high levels of the IL-3R (CD123) (6). Due to their plasma cell-like morphology, CD11c− DCs have been called plasmacytoid DCs (PDCs) (6, 7, 8). CD11c+ myeloid DCs and PDCs express different Toll-like receptors (TLRs) (9). In response to TLR2 and TLR4 ligands, CD11c+ myeloid DCs produce TNF-, IL-6, and IL-12 (10), whereas PDCs produce mainly IFN- in response to TLR9 ligand (11). A recent study demonstrated that both CD11c+ myeloid DCs and PDCs express TLR7, but their cytokine response to TLR7 ligand is subset specific, in that CD11c+ myeloid DCs produce IL-12, and PDCs produce IFN- (12). Taken together, these observations suggest that both DC subsets may be programmed to perform distinct functions through their lineage and their differences in TLR expression.
In addition to replenishing the pool of tissue-residing immature DCs, these circulating DC precursors could play a critical role in both innate and adaptive immunity against pathogens that can access the bloodstream, such as blood stage malaria. In the present study we describe the interaction of P. falciparum blood stage schizonts with PDCs and show how such interaction can modulate other immunological responses.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mAbs against CD3, CD4, CD8, CD14, CD16, CD56, CD20, CD11c, CD11b, TCR-, CD45RA, CD 45RO, CD69, CD123, and HLA-DR were purchased from BD Biosciences (San Jose, CA). mAbs against CD40, CD86, IFN-, and IL-4 were purchased from BD PharMingen (San Diego, CA). mAb against CCR7 was obtained from hybridoma clone CCR7.6B3 (13). Histopaque-1077, Percoll, Escherichia coli LPS, and E. coli DNA were purchased from Sigma-Aldrich (St. Louis, MO). Human GM-CSF, IL-4, and ELISA kits for human cytokines were obtained from R&D Systems (Minneapolis, MN). ELISA kits for mouse IFN- and IL-12 p40 were purchased from PBL Biomedical Laboratories (New Brunswick, NJ) and Techne Laboratories (Minneapolis, MN), respectively. Human Flt3 ligand was obtained from PeproTech EC (London, U.K.). CpG ODN 2216 (ggGGGACGATCGTCgggggG) and CpG ODN 2006 (tcgtcgttttgtcgttttgtcgtt) were obtained from Coley Pharmaceutical Group (Wellesley, MA). CpG ODN D19 (ggTGCATCGATGCAgggggG) was obtained from Hokkaido System Science (Sapporo, Japan). Sequences are shown 5'-3'; lowercase letters represent phosphorothioate linkage, and capital letters represent phosphodiester linkage 3' of the base.
Parasite cultures and parasite product preparation
A laboratory strain (TM267R) and different field isolates (GR, MRU, LA, and PH) of P. falciparum were cultured in group O+ human RBC suspended in RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% heat-inactivated human serum. All parasite cultures were free of mycoplasma contamination, as detected by a commercially available PCR method (American Type Culture Collection, Manassas, VA). Schizont stage parasites were purified by sedimentation through 63% Percoll. This technique normally produces schizonts with a purity of 80%. Schizonts were suspended in RPMI 1640 and subjected to two or three freeze-thaw cycles to obtain the lysate. The schizont-soluble fraction (particulate free) was obtained by centrifugation of the lysate at the highest speed for 5 min using a microcentrifuge (Eppendorf; Brinkmann Instruments, Westbury, NY). This centrifugation process was repeated two or three times until a clarified fraction was obtained. In some experiments this soluble fraction was heated at 100°C for 15 min or precipitated with ammonium sulfate (80%). The pellet from ammonium sulfate fractionation was dissolved in RPMI 1640 and dialyzed for 48 h, then the volume was adjusted to the original volume.
Cell purification and stimulation
Peripheral venous blood was obtained from healthy human donors. PBMC were obtained by centrifugation using Ficoll-Hypaque. PBMC preparations were separated into a T cell-depleted population and an enriched T cell population by rosetting with neuraminidase-treated sheep RBC. To purify the PDCs (CD123+ DCs), T cell-depleted preparations were stained with mAbs against HLA-DR (FITC) and CD123 (PE). CD123bright HLA-DR+ cells were then sorted with FACSVantage (BD Biosciences, Mountain View, CA) (14). The sorted cells had a typical plasma cell-like morphology and did not express either CD11c or lineage marker. For myeloid CD11c+ DC purification, T cell-depleted preparations were stained with a mixture of Abs, including mAbs against CD3, CD14, CD16, CD56, CD20 (FITC), and CD11c (PE). Lineage− and CD11cbright cells were sorted with FACSVantage (BD Biosciences) (14). The sorted cells were analyzed and were found to express HLA-DR, but minimally expressed CD123 and had a typical myeloid morphology. T cells, NK cells, B cells, and monocytes were purified from PBMC as TCR-+, CD56+, CD20+, and CD14+ cells, respectively. The 
T cells were purified by negative sorting of enriched T cell populations that had been stained with mAbs against CD56, CD20, CD14, and TCR- (FITC). The purity of all sorted populations ranged from 92–97%. Different cell populations were stimulated with intact schizonts, schizont lysate, or soluble fraction derived from schizont lysate for 24–48 h. Schizont lysate and soluble fraction were used at concentrations equivalent to a cell:schizont ratio of 1:10 throughout the study. Cell activation was determined by monitoring the expression of costimulatory molecule (CD40, CD86), activation marker (CD69), or production of cytokines (IFN-, TNF-, IFN-). Activation of granulocytes was performed in whole blood cultures. After 1–2 h of incubation with soluble fraction, whole blood cells were stained with mAbs against CD16 (FITC) and CD11b/Mac-1 (PE), then treated with RBC lysing solution (BD Biosciences). Leukocytes were analyzed by flow cytometry using a side light scatter/forward angle dot plot. CD16+ cells in the granulocyte gate were identified as granulocytes, then analyzed for up-regulation of CD11b/Mac-1 expression. LPS (500 ng/ml) was used as a positive control for stimulation of CD11c+ DCs, monocytes, and granulocytes, and CpG ODN 2216 and 2006 (10 µg/ml) were used as positive controls for PDC and B cell activation, respectively. For T and NK cell activation, PMA (50 ng/ml) and ionomycin (50 µg/ml) were used as a positive control.
To evaluate the up-regulation of CCR7 expression, enriched PDC populations from healthy donors were used. Lineage− CD11c− cells were sorted from T cell-depleted preparations that had been stained with FITC-conjugated mAbs against CD3, CD14, CD16, CD20, CD56, and CD11c. The sorted lineage−CD11c− cells (consisted of 25–35% PDCs) were stimulated with intact schizonts for 48 h. The stimulated cells were stained with purified mAb against CCR7, followed by APC-conjugated second Ab, and finally, they were stained with mAbs against CD123 (PE) and HLA-DR (PerCP). CD123bright HLA-DR+ cells were gated as PDCs and then analyzed for CCR7 expression.
Allogeneic T cell response
Flow cytometrically sorted PDCs were stimulated with schizont lysate overnight. Monocyte-derived DCs (MoDCs) were prepared from flow cytometrically sorted CD14+ cells and were cultured with 50 ng/ml GM-CSF and IL-4 for 5–7 days. They were then stimulated overnight with E. coli LPS (1 µg/ml). PDCs and MoDCs (control and stimulated) were plated at different cell concentrations in 96-well, U-bottom plates (Costar; Corning Glass, Corning, NY). Allogeneic naive CD4+ T cells were obtained by negative sorting of enriched T cell populations that had been stained with mAbs against CD8 (FITC), CD20 (FITC), CD56 (FITC), CD45RO (FITC), and TCR- (PE). This technique provides CD4+CD45RA+ naive T cells with a purity of >90%. Flow cytometrically sorted allogeneic naive T cells (1 x 105 cells/well) were added in culture wells that contained control and stimulated PDCs or MoDCs. The proliferative response was measured on day 5 by [3H]thymidine uptake. Some of cell cultures were used to evaluate Th cell differentiation induced by schizont lysate-stimulated PDCs. On day 6, they were restimulated with PMA (50 ng/ml) and ionomycin (50 µg/ml) for 5 h, and brefeldin (10 µg/ml) was added during the last 3 h. The stimulated cells were then stained with mAb against CD4, fixed, and permeabilized (BD PharMingen), then stained with mAbs against IFN- and IL-4. CD4+ T cells were gated, then analyzed for intracellular cytokines by FACSCalibur (BD Biosciences).
T cell response
Enriched T cells (2 x 105 cells/well) were cocultured with flow cytometrically sorted PDCs (4 x 104 cells/well) in the presence of schizont lysate. After 40 h of incubation, cell cultures were treated with brefeldin (10 µg/ml) and incubated for another 8 h. Cells were stained with mAbs against CD3 (PerCP) and TCR- (PE), fixed, and permeabilized (BD PharMingen), then stained with mAb against IFN- (FITC). CD3+ TCR-+ cells were gated as T cells and analyzed for intracellular IFN- by FACSCalibur (BD Biosciences). To evaluate the proliferative response, cell cultures were incubated until day 7, then stained with mAbs against CD3 (PerCP) and TCR- (PE). The increase in T cells in cell cultures was determined by flow cytometry.
Mice
C57BL/6 mice were obtained from CLEA Japan (Tokyo, Japan). MyD88-deficient (MyD88−/−) mice were established as described previously (15) and backcrossed over eight generations with C57BL/6. TLR9-deficient (TLR9−/−) mice were generated as described previously (11) and backcrossed eight times with C57BL/6 mice. TLR7-deficient (TLR7−/Y) mice were generated as described previously (16) and backcrossed with B6 mice three generations.
Preparation and analysis of mouse bone marrow DCs
Bone marrow cells were prepared from femora and tibia and passed through nylon mesh. Then cells were cultured in RPMI 1640 medium supplemented with 10% FCS, 100 µM 2-ME, and 100 ng/ml human Flt3 ligand. After 7 days, the cells were harvested and used as bone marrow DCs (BMDCs; 80–90% CD11c+) for additional experiments. B220+ and B220− cells were purified by MACS (Miltenyi Biotec, Bergisch Gladbach, Germany). In brief, Flt3 ligand-induced BMDCs were incubated with anti-B220 microbeads for 20 min. After washing, B220+ cells were selected by MACS LS column. The B220− cell fraction was stained with anti-CD11c beads, and B220−CD11c+ cells were then selected by MACS LS column. The purity of B220+ cells was >85%, and the purity of B220− cells exceeded 90%. BMDCs, B220+ cells, or B220− cells were seeded into 96-well plates at a concentration of 2 x 106 cell/ml and stimulated with schizont-soluble fraction, heated schizont-soluble fraction, ammonium sulfate fraction (at an equivalent concentration of cell:schizont, 1:10), CpG ODN D19 (3 µM), or LPS (100 ng/ml) for 24 h. The culture supernatants were collected and analyzed for IFN- and IL-12p40 production by ELISA. To evaluate surface expression levels of costimulatory molecules, cells were stained with biotinylated anti-CD40 and FITC-labeled anti-CD86, developed with PE-conjugated streptavidin, and analyzed by flow cytometry.
Patients and blood samples
Blood samples were collected from 30 malaria-infected patients (15 complicated and 15 noncomplicated patients) who were admitted at Bangkok Hospital of Tropical Medicine. Ethical approval and informed consent were obtained before blood donation. Complicated malaria was defined by the presence of asexual forms of P. falciparum in the blood and one or more of the following symptom: cerebral malaria; hyperparasitemia (>200,000 parasites/µl); spontaneous bleeding from gum, nose, gastrointestinal tract etc.; repeated generalized convulsion; impaired consciousness; prostration; inability to swallow or retain oral medication; hyperpyrexia; or clinical laboratory tests showing severe anemia (hematocrit, <15%; hemoglobulin, <5 g/dl, renal failure (serum creatinine >265 µmol/l) or hypoglycemia (whole blood glucose, < 2.2 mmol/l). Patients with none of the above abnormalities were considered to have noncomplicated falciparum malaria. Fifteen control samples were obtained from healthy adult volunteers. For the detection of circulating PDCs, 200 µl of whole blood was stained with an mAb mixture containing lineage-specific mAbs (anti-CD3, anti-CD14, anti-CD16, anti-CD56, anti-CD20; FITC), mAb anti-HLA-DR (PerCP), and mAb anti-CD123 (PE). These stained cells were treated with RBC lysing solution (BD Biosciences), then washed with PBS, and finally reconstituted in 1% paraformaldehyde. Fifty thousand stained cells were analyzed using FACSCalibur (BD Biosciences) and lineage− HLA-DR+CD123bright cells were identified as PDCs. The absolute numbers of circulating PDCs were obtained by multiplying the percentage of PDCs by the numbers of leukocytes per milliliter of blood.
Detection of cytokines
The production of cytokines in cell cultures were measured by ELISA, as were the serum cytokine levels in healthy donors and malaria-infected patients.
Statistical analysis
The data were analyzed using SigmaStat (Jandel Scientific, San Rafael, CA). The Student’s t test was used for parametric data, and the Mann-Whitney rank-sum test was used for nonparametric data. A value of p 
0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Given the role of PDCs in innate and adaptive immunity (17, 18) and their continuous exposure to blood stage malaria in the bloodstream, we investigated the interaction of PDCs with blood stage schizonts. Highly purified PDCs (>95%) were obtained from peripheral blood of healthy individuals. Cocultures of PDCs with different concentrations of intact schizonts for 48 h led to cell activation. Unlike CpG ODN 2216, which is potent for PDC activation, blood stage schizonts stimulated the PDCs to up-regulate the expression of CD86, but not CD40, and also to induce IFN-, but not TNF-, production (Fig. 1, a and b). The viability of PDCs was maintained in both schizont- and CpG ODN 2216-treated cell cultures (Fig. 1c). These PDCs, when stimulated with schizonts, developed into blast cells, but never fully differentiated into mature PDCs associated with DC-like morphology (Fig. 1d). The ability of schizonts to stimulate IFN- production from PDCs is not restricted to only a laboratory strain (TM267R), but was also observed in the field isolates from different geographical regions (GR, MRU, LA, PH; Table I). In addition to intact schizonts, IFN--inducing activity was also observed in schizont lysate and in the soluble fraction prepared from the lysate (Table I).
|
|
T cell responses
We next evaluated the ability of the schizont-stimulated PDCs to prime naive CD4+ T cells. In line with the enhanced expression of CD86, but not CD40, and the fact that this population lacks mature morphology, stimulated PDCs induced a poor allogeneic naive CD4+T cell response compared with monocyte-derived dendritic cells (MoDCs) or LPS-stimulated MoDCs from the same donor (Fig. 2a). Intracellular cytokine staining (IFN- and IL-4) demonstrated that the schizont-stimulated PDCs did not induce allogeneic naive CD4+T cell response of either Th1 or Th2 bias (Fig. 2b).
|
T cells markedly increase during malaria infection (19, 20). We therefore also investigated the role of the schizont-stimulated PDCs in specifically promoting T cell responses. Cocultures of enriched T cell populations containing T cells with PDCs in the presence of schizont lysate for 7 days led to a significant increase in the numbers of T cells in cell cultures compared with enriched T cell cultures stimulated with schizont lysate in the absence of PDCs. Fig. 2c shows a representative histogram. The mean ± SEM of four experiments was 15.6 ± 3.2 vs 0.8 ± 0.3 (p = 0.014). IFN- response of T cells was also evaluated by intracellular staining at 48 h of incubation. The percentage of T cells expressing IFN- in schizont lysate-stimulated enriched T cell cultures was minimal (7.2 ± 1.3). When PDCs were present in those cultures, the numbers of T cells that were positive for IFN- was significantly increased by almost 3-fold (19.8 ± 4.0; p = 0.018; n = 5; Fig. 2d). Characterization of soluble molecule from schizont lysate
Having established that the soluble fraction from schizont lysate can activate PDCs to produce IFN- (similar to intact schizonts), we then determined whether this soluble fraction could activate other immune cells. Fig. 3 demonstrates that the schizont-soluble fraction selectively activated PDCs (assayed by CD86 expression and IFN- production) and T cells (assayed by CD69 expression and IFN- production). No activation of the other immune cells by these soluble molecules was observed, including CD11c+ DCs (assayed by CD86 expression and TNF- production), monocytes (assayed by TNF- production), granulocytes (assayed by CD11b expression), and NK, B, and T cells (assayed by CD69 expression).
|
T cells, found in the schizont-soluble fraction, was due to the same or different molecules. As shown in Table II, heating the soluble fraction at 100°C for 15 min completely abolished the activation of PDCs, but not the activation of T cells. The stimulatory molecule(s) that activated PDCs, but not T cells, was precipitated by ammonium sulfate (80%). E. coli DNA, a known activator of PDCs, did not stimulate IFN- production from T cells. Heating E. coli DNA at 100°C for 15 min had no effect on its ability to activate PDCs to produce IFN- (Table II).
|
TLR9 and TLR7 have been shown to mediate immune cell activation in response to CpG DNA and the antiviral compounds, imidazoquinolines, respectively (11, 16). Some TLR ligands, such as CpG DNA, show some species specificity in their effects, so it was important to confirm that the schizonts would activate mouse DCs as well as human.
In the presence of Flt3 ligand large numbers of CpG DNA responsive DCs can be generated in vitro from mouse bone marrow cells (21, 22). We first evaluated the responses of Flt3 ligand-induced mouse BMDCs to schizont-soluble fraction, heated schizont-soluble fraction, and ammonium sulfate fraction. These BMDCs demonstrated up-regulation of CD40 and CD86 expression in response to schizont-soluble fraction and ammonium sulfate fraction, but not to heated schizont-soluble fraction (Fig. 4a). To examine the role of the TLR-MyD88 signaling pathway in murine schizont-stimulated DCs, we tested schizont-soluble fraction on Flt3 ligand-induced BMDCs derived from TLR7-deficient (TLR7−/Y), TLR9-deficient (TLR9−/−), and MyD88-deficient (MyD88−/−) mice. Wild-type and TLR7−/Y BMDCs were found to be activated by schizont-soluble fraction as indicated by up-regulation of CD40, CD86 expression, and IL-12 production (Fig. 4, b and c). However, MyD88−/− and TLR9−/− BMDCs demonstrated negligible up-regulation of CD40, CD86 expression, and IL-12 production (Fig. 4, b and c). The data indicate that TLR9-MyD88 signaling pathway is a critical requirement for schizont-induced DC activation. LPS, which was used as a positive control for BMDCs, induced enhanced expression of CD40 and CD86, but had no effect on the IL-12 production in MyD88−/− BMDCs (Fig. 4, b and c). The data confirmed that LPS-induced cell activation is MyD88 independent, but that MyD88 is critical for LPS-induced cytokine production (16, 23).
|
production from human PDCs stimulated with either a schizont-soluble fraction or CpG ODN 2216 (Fig. 4d). The same concentrations of chloroquine had negligible effect on the LPS-induced TNF- production from human monocytes.
Flt3 ligand-induced mouse BMDCs can be divided into two subsets; PDCs and myeloid DCs according to B220 expression (21, 22). We tested the responses of these subpopulations to schizont-soluble fraction. Both B220+ PDCs and B220− myeloid DCs demonstrated up-regulation of CD40, CD86 expression, and IL-12 production in response to schizont-soluble fraction (Fig. 5, a, b, and d). Neither subpopulation produced detectable levels of IFN- (Fig. 5c).
|
and decreased circulating PDCs in P. falciparum patients
To obtain some indication of whether PDCs are activated during P. falciparum infection, serum samples and blood cells were taken from patients and then analyzed for IFN- levels as well as the number of circulating PDCs compared with healthy controls. Both complicated and noncomplicated malaria-infected patients demonstrated a significant increase in their serum levels of IFN- and a marked reduction of circulating PDCs (Fig. 6, a and b). However, PDCs are known to actively migrate (7, 26), thus the reduction of circulating PDCs observed in this study may reflect their migration to secondary lymphoid tissues. To evaluate this possibility, we investigated the expression of CCR7, which plays a critical role in DC migration. The freshly isolated PDCs from healthy donors showed negligible expression of CCR7; however, upon stimulation with schizonts in vitro, the expression of CCR7 on PDCs was up-regulated (Fig. 6c).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in response to viral (7, 27) or microbial DNA or CpG DNA stimulation (28, 29). Although unstimulated PDCs express very low levels of costimulatory molecule, activated PDCs can serve as efficient APCs for the adaptive immune response (17, 18). We have demonstrated in this study that P. falciparum schizonts, both from a laboratory strain and from field isolates from different geographical regions, activated human PDCs. The schizont-stimulated PDCs demonstrated a phenotype of incomplete mature cells, as they expressed CD86, but not CD40, and did not have a typical DC-like morphology. They produced IFN-, but not TNF-.
Blood stage parasites have the ability to adhere to host cells via surface adhesion molecules and to modulate cell functions. For example, suppression of the Ag-presenting capability of MoDCs by blood stage parasites requires the adhesion of malaria parasites to target cells (2). However, the observed PDC activation did not require adhesion of schizonts. The soluble fraction from schizont lysate had similar IFN--inducing activity, as did the intact schizonts when cultured with PDCs, suggesting that soluble molecules derived from rupturing schizonts were responsible for the observed effect.
Our observation that PDCs promoted T cell proliferation and IFN- production in response to stimulation with schizonts may have further physiological significance and points to a possible role for PDCs in mediating the innate immune response to the schizonts. A marked increase in circulating T cells has been reported in malaria patients (19, 20). The increase in T cell responses observed in this study could be via mediators released from the schizont-stimulated PDCs. IFN- has been shown to activate T cells (29), but we failed to inhibit the increase in numbers of T cells by treatment with neutralizing anti-IFN- Ab or a mixture of neutralizing anti-IFN- Ab and anti-IFN- Ab (data not shown). It is possible that PDC-produced IFN- could nevertheless drive T cell proliferation if this was directly transferred between the cells. The possible requirement of cell contact between PDCs and T cells could not be ruled out.
The increased T cell response in malaria could have both beneficial and deleterious effects. T cells have been shown to directly inhibit the growth of blood stage parasites in vitro (30). However, a marked increase in T cell activity associated with high levels of proinflammatory cytokines can cause pathology (31). In the mouse model the accumulation of T cells in the brain is found to be associated with cerebral malaria (32).
The soluble fraction from P. falciparum schizont lysate was highly specific in its immune effects; it directly activated only two innate immune cell populations, PDCs and T cells, but not CD11c+ DCs, monocytes, granulocytes, NK cells, B cells, or T cells. We have previously shown that a nonprotein component of schizont lysate-containing phosphate groups activates T cells (33). In this study we have identified additional immunostimulatory components from schizonts that are capable of stimulating PDCs to produce IFN-. Other products from the parasite, such as glycosylphosphatidylinositol and malaria pigment, are also known to activate human monocytes to produce cytokines (34, 35).
The innate immune response against P. falciparum, especially involving TLRs and their corresponding ligands, is as yet poorly understood. A recent study in the mouse model of P. berghei blood stage infection demonstrated that the IL-12-mediated liver injury depends on the TLR-MyD88-dependent pathway (36). TLR2, TLR4, and TLR6 do not seem to be involved (36). In this study we have shown that schizont-soluble fraction from P. falciparum induced maturation of mouse bone marrow B220+ and B220− DCs and stimulated IL-12, but not IFN-, production. The TLR9-MyD88 signaling pathway is required for the response to schizont-soluble products, as the response is absent in mice genetically deficient in TLR9. To date, the only known TLR9 ligand is CpG motifs in pathogen DNA. In addition to species specificity, the ability of CpG DNA to induce cell maturation and IFN- production is also dependent on the characteristic sequence of CpG DNA (37). It is possible that the schizont-soluble fraction exerts an opposite effect in human cells compared with that in murine cells. Our findings suggest that in human cells the schizont-soluble fraction is a potent stimulator of IFN- production, but a weak inducer of cell maturation (induces CD86, but not CD40, expression). Conversely, our findings also suggest that in murine cells, the same schizont-soluble fraction is a weak stimulator of IFN- production, but a strong inducer of cell maturation (induces both CD86 and CD40 expression). We have not yet fully characterized the nature of the parasite molecule(s) involved in PDC activation, but our data indicate that it is unlikely to be DNA. First, although E. coli DNA triggered the expected large amounts of IFN- production, comparable to that induced by the schizont-soluble fraction, schizont DNA induced very little IFN- production, even when added at concentrations far exceeding the level present in the schizont-soluble fraction (data not shown). Second, the majority of the IFN--inducing activity was heat labile, unlike DNA. Finally, the activity could be precipitated with ammonium sulfate, indicating that it is not DNA, and suggesting instead that it may be associated with protein. Taken together, these findings suggest that a novel and previously unknown TLR9 ligand is present in schizonts and is responsible for IFN- production. It is also possible that one or more parasite protein(s) could form a complex with DNA and synergistically costimulate PDCs to produce IFN-. A two-signal engagement pathway has been recently implicated in the autoreactive B cell response, in which binding of the Ab to the B cell receptor may enhance the uptake of chromatin-containing immune complexes, and this is thought to result in the effective delivery of the chromatin fragment to the endosome-associated TLR9 (25). Clearly, the interaction of pathogen-derived molecules with TLRs has many complexities that remain to be elucidated.
During the last 20 years, there have been at least four reports documenting P. falciparum-mediated IFN- response both in vitro and in vivo (38, 39, 40, 41). Our study confirms those observations and demonstrates for the first time the important role of schizont products in PDC activation. An increase in IFN- production was detected in both complicated and noncomplicated malaria-infected patients. The possible role of PDCs in human malaria is further supported by the findings of a significant reduction of circulating PDCs in patients. One possible mechanism for the loss of PDCs in the blood is due to the mobilization of cells to secondary lymphoid tissues such as the spleen, where marked immunological activity has been observed (42). The migration capability of PDCs requires chemokine stimulation and induction of CCR7 (43). Our study demonstrates that schizont-stimulated PDCs up-regulate the expression of CCR7, providing a potential explanation for the decrease in blood PDCs seen in malaria infection.
A possible scenario for P. falciparum-mediated PDC activation in vivo may start with the rupture of blood stage schizonts, releasing soluble molecules that activate PDCs via the TLR9-MyD88 signaling pathway. The stimulated PDCs produce IFN- and enhance the response of T cells that have been simultaneously primed with a schizont-derived phosphorylated molecule. Further characterization of the complex nature of parasite ligands that activate PDCs will provide new insight into innate immunity and its role in the pathogenesis of malaria infection.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sathit Pichyangkul, Department of Immunology and Medicine, Armed Forces Research Institute of Medical Sciences, 315/6 Rajvithi Road, Bangkok 10400, Thailand. E-mail address: sathitp{at}afrims.org
3 Abbreviations used in this paper: DC, dendritic cell; BMDC, bone marrow DC; MoDC, monocyte-derived DC; PDC, plasmacytoid DC; TLR, Toll-like receptor.
Received for publication March 25, 2003. Accepted for publication February 9, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507./-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219. T cell receptor in patients with acute Plasmodium falciparum malaria. J. Infect. Dis. 162:283.[Medline]
T cells in acute Plasmodium falciparum malaria. Immunol. Lett. 25:139.[Medline]
T cells via interferon-/-. Eur. J. Immunol. 31:3525.[Medline]
T cells that inhibit the in vitro growth of the asexual blood stages of the Plasmodium falciparum parasite express cytolytic and proinflammatory molecules. Scand. J. Immunol. 50:642.[Medline]
T-cell function in pathogenesis of cerebral malaria in mice infected with Plasmodium berghei ANKA. Infect. Immun. 67:446. T cells in the brain and alters resistant mice to susceptible-like phenotype. Am. J. Pathol. 158:163. T cells in malaria: interaction of cytokines and a schizont-associated Plasmodium falciparum antigen. J. Infect. Dis. 176:233.[Medline]
and interleukin-1. Am. J. Trop. Med. Hyg. 51:430.
/ in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
following the acute attack. J. Interferon Res. 5:169.[Medline]
This article has been cited by other articles:
|
|
 |
|
  J. W. Griffith, T. Sun, M. T. McIntosh, and R. Bucala Pure Hemozoin Is Inflammatory In Vivo and Activates the NALP3 Inflammasome via Release of Uric Acid J. Immunol., October 15, 2009; 183(8): 5208 - 5220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Gaudreault and J. Gosselin Leukotriene B4 Potentiates CpG Signaling for Enhanced Cytokine Secretion by Human Leukocytes J. Immunol., August 15, 2009; 183(4): 2650 - 2658. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kawai and S. Akira The roles of TLRs, RLRs and NLRs in pathogen recognition Int. Immunol., April 1, 2009; 21(4): 317 - 337. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Kim, S. Parikh, J. C. Sun, A. Myrick, L. L. Lanier, P. J. Rosenthal, and J. L. DeRisi Experimental Malaria Infection Triggers Early Expansion of Natural Killer Cells Infect. Immun., December 1, 2008; 76(12): 5873 - 5882. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. T. Cadman, A. Y. Abdallah, C. Voisine, A.-M. Sponaas, P. Corran, T. Lamb, D. Brown, F. Ndungu, and J. Langhorne Alterations of Splenic Architecture in Malaria Are Induced Independently of Toll-Like Receptors 2, 4, and 9 or MyD88 and May Affect Antibody Affinity Infect. Immun., September 1, 2008; 76(9): 3924 - 3931. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Bhan, G. Trujillo, K. Lyn-Kew, M. W. Newstead, X. Zeng, C. M. Hogaboam, A. M. Krieg, and T. J. Standiford Toll-Like Receptor 9 Regulates the Lung Macrophage Phenotype and Host Immunity in Murine Pneumonia Caused by Legionella pneumophila Infect. Immun., July 1, 2008; 76(7): 2895 - 2904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hisaeda, K. Tetsutani, T. Imai, C. Moriya, L. Tu, S. Hamano, X. Duan, B. Chou, H. Ishida, A. Aramaki, et al. Malaria Parasites Require TLR9 Signaling for Immune Evasion by Activating Regulatory T Cells J. Immunol., February 15, 2008; 180(4): 2496 - 2503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Thitithanyanont, A. Engering, P. Ekchariyawat, S. Wiboon-ut, A. Limsalakpetch, K. Yongvanitchit, U. Kum-Arb, W. Kanchongkittiphon, P. Utaisincharoen, S. Sirisinha, et al. High Susceptibility of Human Dendritic Cells to Avian Influenza H5N1 Virus Infection and Protection by IFN-{alpha} and TLR Ligands J. Immunol., October 15, 2007; 179(8): 5220 - 5227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. E. Brentlinger, C. B. Behrens, and J. G. Kublin Challenges in the Prevention, Diagnosis, and Treatment of Malaria in Human Immunodeficiency Virus Infected Adults in Sub-Saharan Africa Arch Intern Med, September 24, 2007; 167(17): 1827 - 1836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Bhan, N. W. Lukacs, J. J. Osterholzer, M. W. Newstead, X. Zeng, T. A. Moore, T. R. McMillan, A. M. Krieg, S. Akira, and T. J. Standiford TLR9 Is Required for Protective Innate Immunity in Gram-Negative Bacterial Pneumonia: Role of Dendritic Cells J. Immunol., September 15, 2007; 179(6): 3937 - 3946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Elliott, T. P. Spurck, J. M. Dodin, A. G. Maier, T. S. Voss, F. Yosaatmadja, P. D. Payne, G. I. McFadden, A. F. Cowman, S. J. Rogerson, et al. Inhibition of Dendritic Cell Maturation by Malaria Is Dose Dependent and Does Not Require Plasmodium falciparum Erythrocyte Membrane Protein 1 Infect. Immun., July 1, 2007; 75(7): 3621 - 3632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. deWalick, F. H. Amante, K. A. McSweeney, L. M. Randall, A. C. Stanley, A. Haque, R. D. Kuns, K. P. A. MacDonald, G. R. Hill, and C. R. Engwerda Cutting Edge: Conventional Dendritic Cells Are the Critical APC Required for the Induction of Experimental Cerebral Malaria J. Immunol., May 15, 2007; 178(10): 6033 - 6037. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Schleicher, J. Liese, I. Knippertz, C. Kurzmann, A. Hesse, A. Heit, J. A.A. Fischer, S. Weiss, U. Kalinke, S. Kunz, et al. NK cell activation in visceral leishmaniasis requires TLR9, myeloid DCs, and IL-12, but is independent of plasmacytoid DCs J. Exp. Med., April 16, 2007; 204(4): 893 - 906. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Metenou, A. L. Suguitan Jr., C. Long, R. G. F. Leke, and D. W. Taylor Fetal Immune Responses to Plasmodium falciparum Antigens in a Malaria-Endemic Region of Cameroon J. Immunol., March 1, 2007; 178(5): 2770 - 2777. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Parroche, F. N. Lauw, N. Goutagny, E. Latz, B. G. Monks, A. Visintin, K. A. Halmen, M. Lamphier, M. Olivier, D. C. Bartholomeu, et al. From the Cover: Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9 PNAS, February 6, 2007; 104(6): 1919 - 1924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Coban, K. J. Ishii, S. Uematsu, N. Arisue, S. Sato, M. Yamamoto, T. Kawai, O. Takeuchi, H. Hisaeda, T. Horii, et al. Pathological role of Toll-like receptor signaling in cerebral malaria Int. Immunol., January 1, 2007; 19(1): 67 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. C. Urban, D. Cordery, M. J. Shafi, P. C. Bull, C. I. Newbold, T. N. Williams, and K. Marsh The Frequency of BDCA3-Positive Dendritic Cells Is Increased in the Peripheral Circulation of Kenyan Children with Severe Malaria Infect. Immun., December 1, 2006; 74(12): 6700 - 6706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. P. Breitling, R. Fendel, B. Mordmueller, A. A. Adegnika, P. G. Kremsner, and A. J. F. Luty Cord Blood Dendritic Cell Subsets in African Newborns Exposed to Plasmodium falciparum In Utero. Infect. Immun., October 1, 2006; 74(10): 5725 - 5729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Guiducci, G. Ott, J. H. Chan, E. Damon, C. Calacsan, T. Matray, K.-D. Lee, R. L. Coffman, and F. J. Barrat Properties regulating the nature of the plasmacytoid dendritic cell response to Toll-like receptor 9 activation J. Exp. Med., August 7, 2006; 203(8): 1999 - 2008. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Minns, L. C. Menard, D. M. Foureau, S. Darche, C. Ronet, D. W. Mielcarz, D. Buzoni-Gatel, and L. H. Kasper TLR9 Is Required for the Gut-Associated Lymphoid Tissue Response following Oral Infection of Toxoplasma gondii. J. Immunol., June 15, 2006; 176(12): 7589 - 7597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. Sponaas, E. T. Cadman, C. Voisine, V. Harrison, A. Boonstra, A. O'Garra, and J. Langhorne Malaria infection changes the ability of splenic dendritic cell populations to stimulate antigen-specific T cells J. Exp. Med., June 12, 2006; 203(6): 1427 - 1433. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. URBAN, M. J. SHAFI, D. V. CORDERY, A. MACHARIA, B. LOWE, K. MARSH, and T. N. WILLIAMS FREQUENCIES OF PERIPHERAL BLOOD MYELOID CELLS IN HEALTHY KENYAN CHILDREN WITH {alpha}+ THALASSEMIA AND THE SICKLE CELL TRAIT Am J Trop Med Hyg, April 1, 2006; 74(4): 578 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. P. Mockenhaupt, J. P. Cramer, L. Hamann, M. S. Stegemann, J. Eckert, N.-R. Oh, R. N. Otchwemah, E. Dietz, S. Ehrhardt, N. W. J. Schroder, et al. Toll-like receptor (TLR) polymorphisms in African children: Common TLR-4 variants predispose to severe malaria PNAS, January 3, 2006; 103(1): 177 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Rogers, A. B. Rogers, B. A. Leav, A. Sanchez, E. Vannier, S. Uematsu, S. Akira, D. Golenbock, and H. D. Ward MyD88-Dependent Pathways Mediate Resistance to Cryptosporidium parvum Infection in Mice Infect. Immun., January 1, 2006; 74(1): 549 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ing, M. Segura, N. Thawani, M. Tam, and M. M. Stevenson Interaction of Mouse Dendritic Cells and Malaria-Infected Erythrocytes: Uptake, Maturation, and Antigen Presentation J. Immunol., January 1, 2006; 176(1): 441 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-M. Chen, S. P. O'Hara, J. B. Nelson, P. L. Splinter, A. J. Small, P. S. Tietz, A. H. Limper, and N. F. LaRusso Multiple TLRs Are Expressed in Human Cholangiocytes and Mediate Host Epithelial Defense Responses to Cryptosporidium parvum via Activation of NF-{kappa}B J. Immunol., December 1, 2005; 175(11): 7447 - 7456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Korbel, K. C. Newman, C. R. Almeida, D. M. Davis, and E. M. Riley Heterogeneous Human NK Cell Responses to Plasmodium falciparum-Infected Erythrocytes J. Immunol., December 1, 2005; 175(11): 7466 - 7473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Baratin, S. Roetynck, C. Lepolard, C. Falk, S. Sawadogo, S. Uematsu, S. Akira, B. Ryffel, J.-G. Tiraby, L. Alexopoulou, et al. Natural killer cell and macrophage cooperation in MyD88-dependent innate responses to Plasmodium falciparum PNAS, October 11, 2005; 102(41): 14747 - 14752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Coban, K. J. Ishii, T. Kawai, H. Hemmi, S. Sato, S. Uematsu, M. Yamamoto, O. Takeuchi, S. Itagaki, N. Kumar, et al. Toll-like receptor 9 mediates innate immune activation by the malaria pigment hemozoin J. Exp. Med., January 3, 2005; 201(1): 19 - 25. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. McKenna, A.-S. Beignon, and N. Bhardwaj Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity J. Virol., January 1, 2005; 79(1): 17 - 27. [Full Text] [PDF]
|
|
|
|
|
|
A. Q. Khan, Q. Chen, Z.-Q. Wu, J. C. Paton, and C. M. Snapper Both Innate Immunity and Type 1 Humoral Immunity to Streptococcus pneumoniae Are Mediated by MyD88 but Differ in Their Relative Levels of Dependence on Toll-Like Receptor 2 Infect. Immun., January 1, 2005; 73(1): 298 - 307. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
