|
|
||||||||



* Department of Internal Medicine,
Graduate Program in Immunology,
Department of Pathology, University of Michigan, Ann Arbor, MI 48109; and
Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom
| Abstract |
|---|
|
|
|---|
1 production was not reduced in IL-13-/- mice. Analyses of fibroblasts isolated from the four genotypes demonstrated that although there were similar numbers of fibroblasts present in cultures of lung minces, fibroblasts from IL-13-deficient strains have reduced basal and stimulated levels of collagen production. IL-13R
1 expression increases on fibroblasts during fibrotic responses in vivo, and IL-13 increases collagen synthesis in fibroblasts. Thus, IL-13 mediates its profibrotic actions through direct effects on fibroblast production of extracellular matrix. | Introduction |
|---|
|
|
|---|
A number of soluble factors have been implicated as profibrotic mediators. Among these are growth and differentiation factors such as TGF-
(5), proinflammatory cytokines such as TNF-
(6), lipid mediators such as leukotrienes (7), and type 2 (T2) cytokines such as IL-4 and IL-13 (8, 9, 10). T2 cytokines have been implicated in remodeling associated with granuloma formation (11, 12) as well as asthma (13, 14, 15). The T2 cytokines, IL-4 and IL-13, share many functional properties mediated by shared receptor components, yet have been described to have differing functions as well (16). IL-4 is known to promote fibroblast chemotaxis, proliferation, and collagen synthesis (17, 18, 19, 20, 21, 22). IL-13 can also promote fibroblast proliferation and collagen synthesis (21, 22, 23, 24). Similarly, IL-4 and IL-13 have both been shown to augment the ability of human mesenchymal cells to contract collagen gels (25) and the expression of adhesion molecules and profibrotic cytokines from fibroblasts (26). Studies using IL-4-/- animals or IL-4 neutralization have shown reduced granuloma formation in Schistosoma japonicum-infected mice (27) and reduced liver fibrosis in Schistosoma mansoni-infected mice (11), suggesting that IL-4 can promote the fibrotic-like granulomatous response. Similarly, IL-13 blockade has been shown to ameliorate hepatic fibrosis after Schistosoma mansoni infection (12). Neutralization of IL-13 after bleomycin stimulation ameliorates pulmonary fibrosis as well (28). Finally, recent studies using animals that overexpressed IL-13 under control of the Clara cell-specific CC10 promoter demonstrated increased subepithelial cell fibrosis, mucus hypersecretion, and eosinophilic inflammation reminiscent of asthma exacerbations (10). Further investigations by the same authors demonstrated the ability of IL-13 to promote transcription and activation of the profibrotic cytokine TGF-
1 (29), thus suggesting TGF-
1 activation as a central mechanism for the profibrotic effects of IL-13.
As mentioned above, numerous studies have suggested a profibrotic role for these T2 cytokines; however, there have been no studies to date to examine the progression of experimental fibrosis in the complete absence of IL-4 and/or IL-13. We chose to do this by examining the fibrotic response to FITC in IL-4-/-, IL-13-/-, and IL-4/13-/- mice. IL-13-/- and IL-4/13-/- mice were significantly protected from FITC-induced pulmonary fibrosis; however, IL-4-/- mice were not. The protection in IL-13-/- mice did not correlate with reduced inflammation. Surprisingly, protection did not correlate with reduced production of, or responsiveness to, TGF-
1. Fibroblasts from IL-13-/- mice produce lower basal levels of collagen than wild-type controls, whereas fibroblasts from IL-4-/- mice produced collagen levels equivalent to control values. IL-13 can stimulate collagen production in both wild-type and IL-13-/- fibroblasts; however, the overall collagen synthesis in IL-13-/- animals is still lower. IL-13R
1 expression increases on fibroblasts during fibrotic responses in vivo. The fact that IL-13-/- mice are protected from FITC-induced fibrosis despite the presence of TGF-
1 suggests that IL-13 plays a crucial regulatory role in determining fibrotic responses in vivo.
| Materials and Methods |
|---|
|
|
|---|
IL-4-/- mice bred onto the BALB/c background and control BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, ME). The generation of IL-13-/- (30) and IL-4/13-/- (31) mice has been previously described. These genotypes were backcrossed onto the BALB/c background for eight generations and were bred at University of Michigan under specific pathogen-free conditions. All mice were given food and water ad libitum and monitored daily by University of Michigan Unit for Laboratory Animal Medicine veterinary staff. These experiments were approved by the university committee for the use and care of animals.
FITC inoculation
FITC inoculation was performed as previously described (4). Briefly, mice were anesthetized with sodium pentobarbital. The trachea was exposed and entered with a needle under direct visualization. FITC (21 mg; F-7250; Sigma-Aldrich, St. Louis, MO) was dissolved in 10 ml of sterile PBS, vortexed extensively, and sonicated for 30 s. This slurry was transferred to multiuse vials and vortexed extensively before each 50-µl aliquot was removed for intratracheal injection using a 26-gauge needle.
Lung collagen measurements
Total lung collagen levels were determined by harvesting lungs from mice on day 21 after FITC or saline administration. Animals were euthanized and perfused with 3 ml of normal saline before all five lung lobes were removed and snap-frozen in liquid nitrogen. Before analysis, lungs were homogenized in 1 ml of normal saline and spun at 2000 rpm for 10 min. Aliquots of lung homogenate (100 µl) were then assayed for total lung collagen levels and compared with a standard curve prepared from rat tail collagen using the Sircol collagen dye binding assay (Accurate, Westbury, NY) according to the manufacturers instructions.
Histology
Animals were euthanized and perfused via the right ventricle with 5 ml of normal saline. Lungs were inflated with 1 ml of 10% neutral buffered formalin, removed, and fixed overnight in formalin before being dehydrated in 70% ethanol. Lungs were processed using standard procedures and embedded in paraffin. Three- to 5-µm sections were cut, mounted on slides, and stained with H&E or Massons Trichrome Blue for collagen deposition.
Collagenase digestion to isolate lung leukocytes
Collagenase digestions can be used to analyze both resident and recruited populations of lung cells found in the alveolar space and interstitium. This procedure has been optimized to purify lung leukocytes (32). Lungs were excised, minced, and enzymatically digested for 30 min using 15 ml/lung of digestion buffer (RPMI 1640, 5% FCS, antibiotics, 1 mg/ml collagenase (Roche, Chicago, IL), and 30 µg/ml DNase (Sigma-Aldrich)). The cell suspension and undigested fragments were further dispersed by repeated passage through the bore of a 10-ml syringe without a needle. The total cell suspension was pelleted, and any contaminating erythrocytes were eliminated by lysis in ice-cold NH4Cl buffer (0.829% NH4Cl, 0.1% KHCO3, and 0.0372% Na2 EDTA, pH 7.4). The pellet was resuspended in 5 ml of complete medium (RPMI 1640, 5% FCS, 1% penicillin/streptomycin, and 1% L-glutamine) and dispersed by 20 passages through a 5-ml syringe. The dispersed cells were filtered through a Nytex filter (Tetko, Kansas City, MO) to remove clumps. The total volume was brought up to 10 ml with complete medium. An equal volume of 40% Percoll (Sigma-Aldrich) was added, and the cells were centrifuged at 3000 rpm for 30 min (room temperature) without a brake. The cell pellets were resuspended in complete medium, and leukocytes were counted on a hemocytometer in the presence of trypan blue. Cells were >90% viable by trypan blue exclusion. Cytospins of recovered cells were prepared for differential staining as described below. In addition, recovered leukocytes were analyzed by flow cytometry.
Lung homogenates
After perfusion of the lungs with 5 ml of normal saline via the right ventricle, individual lung lobes were dissected and homogenized in 1 ml of PBS containing protease inhibitors (Complete Protease tablets; Roche, Manheim, Germany). Cellular debris was removed by centrifugation at 3000 rpm for 10 min. Aliquots of lung homogenate were then assayed by specific ELISA for cytokines. In some experiments lipids were extracted from lung homogenates using Sep-Pak cartridges (Waters, Milford, MA) as previously described (33). Eicosanoids were then measured by specific enzyme immunoassay (EIA)3 kits obtained from Cayman Chemicals (Ann Arbor, MI).
Differential staining
Cytospins of collagenase digestions were made by centrifuging 50,000 cells onto microscope slides using a Cytospin 3 (Shandon, Astmoore, U.K.). The slides were allowed to air-dry and were stained using a modified Wright-Giemsa (WG) stain. For WG staining, the slides were fixed/prestained for 2 min with a one-step, methanol-based WG stain (Harleco; EM Diagnostics, Gibbstown, NJ), followed by steps 2 and 3 of the Diff-Quik whole blood stain (Diff-Quik; Baxter Scientific, Miami, FL). This modification of the Diff-Quik stain procedure improves the resolution of eosinophils from neutrophils in the mouse. A total of 300 cells was counted from randomly chosen high power microscope fields for each sample. The differential percentage was multiplied by the total leukocyte number to derive the absolute numbers of monocyte/macrophages, neutrophils, and eosinophils per sample.
FACS analysis
Lung cells (1 x 106) from the collagenase digestions of individual animals were incubated for 15 min on ice in Fc block (BD PharMingen, San Diego, CA) before washing and centrifugation. Cells were stained in a 100-µl total volume with 1 µg of combinations of the following Abs (obtained from BD PharMingen unless otherwise noted): CD45 (YW62.3; Caltag Laboratories, Burlingame, CA), CD4 (RM4-4), CD8 (53-6.7), CD19 (1D3), or DX5. Stained samples were stored in the dark at 4°C until being analyzed on a flow cytometer (FACScan; BD Biosciences, Mountain View, CA). All samples were stained with CD45 to identify a leukocyte-specific gate. The absolute number of a type of leukocyte in the lungs was determined as the percentage of that cell type multiplied by the total number of cells (leukocytes) in the lung collagenase digestion.
Lung leukocyte culture
Lung leukocytes purified by collagenase digestion were cultured at 5 x 106/ml in complete RPMI 1640 medium containing 10% FCS, 1% penicillin-streptomycin, and 1% L-glutamine. Cell-free supernatants were collected after 24 h of culture and were analyzed by ELISA for production of cytokines.
ELISA and EIA
Measurements of IL-4, monocyte chemotactic protein-1 (MCP-1), IFN-
, and IL-10 were performed on culture supernatants and lung homogenates using Opti-EIA kits from BD PharMingen according to the manufacturers instructions. IL-13 ELISAs were purchased from R&D Systems (Minneapolis, MN). Sensitivity ranged from 210 pg/ml at the lower limit. Lung homogenates were analyzed by EIA for the production of PGE2, cysteinyl leukotrienes, and leukotriene B4 using commercially available kits from Cayman Chemicals.
Plasminogen activator inhibitor-1 (PAI-1)/luciferase assay for TGF-
1
PAIL cells (mink lung epithelial cells (MLECs-clone 32) stably transfected with an 800-bp fragment of the 5' end of the human PAI-1 gene fused to the firefly luciferase reporter gene in a p19LUC-based vector containing the neomycin resistance gene from pMAMneo; a gift from Dr. D. Rifkin, Department of Cell Biology, New York University, New York, NY) were maintained in DMEM supplemented with 10% FCS, penicillin (100 U/ml), streptomycin (100 mg/ml), L-glutamine, and G418 (geneticin effective concentration, 200 µg/ml). To perform the assay, cells were plated at 1 x 106 cells/well in a six-well plate. The following day, medium was replaced with DMEM supplemented with 0.1% BSA, penicillin (100 U/ml), streptomycin (100 mg/ml), L-glutamine, and G418. Then, 250 µl of lung homogenate or recombinant TGF-
1 was added to each well. After a 24-h incubation, medium was removed, cells were rinsed with PBS, and 400 µl of cell lysis buffer (Promega, Madison, WI) was added to each well. Cells were scraped and transferred to a microcentrifuge tube placed on ice. After all samples were collected, tubes were vortexed and spun at 12,000 x g for 15 s at room temperature. Supernatants were transferred to a new tube and assayed using the Promega Luciferase Assay System according to the manufacturers directions. To prepare lung homogenates, one set of lungs was dissolved in 2 ml of PBS containing protease inhibitors. For measurements of active TGF-
1, 250 µl of lung homogenates were used neat. To determine total TGF-
1 activity, 250 µl of lung homogenate was incubated with 3.3 µl of 12 N HCl for 10 min at room temperature, followed by the addition of 3.5 µl of 12 N NaOH. Samples were vortexed and added immediately to the PAIL cells.
Fibroblast isolation
Lungs were perfused free of blood, and individual lung lobes were removed to a petri dish. Using sterile technique, lung lobes were finely minced with scissors, and the lung mince was cultured for 1014 days in complete DMEM containing 10% FCS and 1% penicillin-streptomycin. Fibroblasts were passaged by trypsinization when they reached 70% confluence and were always used before the third passage. To insure that there was no leukocyte contamination in fibroblast cultures that were to be stimulated with cytokines, cells were stained with anti-CD45 Abs coupled to magnetic beads (Miltenyi Biotech, Auburn, CA), and the CD45-deficient cells were negatively selected as the column flow-through (SuperMacs columns; Miltenyi Biotec).
mRNA analysis
Total mRNA was prepared using TRIzol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturers instructions. TGF-
1, TGF-
2, and TGF-
3 mRNA levels were determined using RNase protection assays (RiboQuant; BD PharMingen, San Diego, CA) according to the manufacturers instructions. IL-13R
1 expression was determined by RT-PCR using the Promega Access RT-PCR kit according to the manufacturers instructions. Primer sequences were as follows: IL-13R
1 sense, GAATTTGAGCGTCTCTGTCGAA; IL-13R
1 antisense, GGTTATGCCAAATGCACTTGAG;
-actin sense, GTGGGGCTCCCCAGGCACCA; and
-actin antisense, GCTCGGCCGTGGTGGTGAAGC.
Western blotting
Cells were grown to 8595% confluence and serum-starved for 2448 h in 35-mm dishes. Cultures were exposed to treatments for 24 h, then were washed with ice-cold PBS, and 200 µl of cold RIPA lysis buffer (1% (w/w) Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M NaH2PO4, 0.02 M EDTA, 0.05 M NaF, 0.002 M NA3VO4, and a 1/100 dilution of Protease Cocktail Set II (Calbiochem-Novabiochem, San Diego, CA)) was added to each sample. After a 2-min incubation on ice, the lysed sample was collected. Lysis samples were assayed for total protein concentration using the DC Protein Assay (Bio-Rad, Hercules, CA). Equal amounts of protein from each experimental condition were mixed with a 1:5 (v/v) ratio of 6x electrophoresis sample buffer (0.2 M EDTA, 40 mM DTT, 6% SDS, and 0.6 mg/ml pyronin, pH 6.8) and boiled for 7 min. SDS-PAGE was performed using a 412% polyacrylamide gradient gel. Protein samples were electrophoretically transferred to polyvinylidene difluoride membrane (Immobilon-P; Millipore, Bedford, MA) and incubated with 5% nonfat milk and 0.1% Tween 20, pH 7.4, for at least 1 h. Collagen was detected using a 1/500 dilution of purified rabbit anti-mouse collagen type I (Cedarlane Laboratories, Hornby, Ontario, Canada) in 5% nonfat milk and 0.1% Tween 20 for 1 h, followed by two washes with PBS-Tween (0.1% Tween). The secondary Ab was an HRP-coupled goat anti-rabbit Ab (ImmunoPure Goat Anti-Rabbit IgG, (H+L) peroxidase conjugated; Pierce, Rockford, IL) used at a 1/10,000 dilution in 5% nonfat milk and 0.1% Tween 20, incubated for 12 h. The blot was then washed five times with PBS-Tween (0.1% Tween) before incubation with SuperSignal West Pico chemiluminescence substrate (Pierce) for 5 min and exposed to chemiluminescent-sensitive Kodak X-OMAT AR film (Eastman Kodak, Rochester, NY). For other experiments,
-smooth muscle actin (
SMA) was detected after electrophoresis and transfer of a 420% polyacrylamide gradient gel using a monoclonal primary Ab (clone 1A4; DAKO, Carpinteria, CA) diluted 1/1000 in blocking buffer, followed by detection with an HRP-coupled secondary Ab (ImmunoPure goat anti-mouse IgG, (H+L) peroxidase conjugated; Pierce) diluted 1/10,000. In most experiments lanes represent cells pooled from three individual animals. Equal protein loading in each lane was confirmed by stripping the blots and reprobing them with anti-
-tubulin Ab (Sigma-Aldrich).
TGF-
1 responsiveness
Fibroblast responsiveness to TGF-
1 was measured in two ways. First, fibroblasts were serum-starved for 24 h before incubation with 2 ng/ml TGF-
1 for 24 h. Cells were then analyzed for collagen synthesis by Western blot analysis as described. TGF-
1 stimulates collagen synthesis in fibroblasts. Additionally, TGF-
1 signaling capacity was analyzed by transfecting fibroblast cultures with a reporter plasmid carrying a TGF-
1-responsive promoter (p3TP-LUX; a gift from Dr. J. Massague, Memorial Sloan-Kettering Cancer Center, Howard Hughes Medical Institute, New York, NY). Four million fibroblasts were transfected with 10 µg of plasmid DNA via electroporation at 250 V and 960 µF using a Gene Pulser (Bio-Rad). Transfected cells were then split into two cultures. Cultures were maintained in complete medium for the first 24 h posttransfection. Cultures were switched to serum-free medium containing 0.1% BSA with or without 10 ng/ml TGF-
1 for an additional 24 h before luciferase activity was measured in cell lysates. Results are reported as the fold induction of TGF-
1-stimulated luciferase activity over nonstimulated levels.
Statistics
Statistical significance was analyzed using the InStat 2.01 program (GraphPad, San Diego, CA) on a Power Macintosh G3. Students t tests were run to determine p values when comparing two groups. When comparing three or more groups, ANOVA was performed with a post-hoc Bonferroni test to determine which groups showed significant differences. A value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
To determine whether IL-4 and IL-13 are induced in the lung in response to FITC challenge, lung leukocytes were prepared from BALB/c mice on days 0, 7, 14, and 21 post-FITC challenge and cultured at 5 x 106/ml in the presence or the absence of 5 µg/ml Con A for 24 h before harvest. IL-4 and IL-13 production were measured in cell-free supernatants using specific ELISAs. IL-13 was readily detectable in supernatants from lung leukocytes and remained elevated compared with baseline secretion measured from leukocytes purified from untreated mice throughout days 721 (Fig. 1). IL-4 was also elevated compared with baseline, but was present at much lower levels than IL-13. Stimulation of the lung leukocytes with Con A increased the production of both cytokines. IL-4 levels were stimulated
4- to 5-fold at all time points, whereas IL-13 levels were stimulated 20- to 30-fold by Con A at all time points (not shown). Thus, IL-4 and IL-13 are both produced by lung leukocytes after FITC challenge; however, IL-13 is induced to a much greater extent.
|
To determine whether the production of IL-4 and/or IL-13 was regulating the development of pulmonary fibrosis, we injected BALB/c, IL-13-/-, IL-4-/-, and IL-4/13-/- mice with either saline or FITC intratracheally on day 0. On day 21 postchallenge, mice were euthanized, and lungs were analyzed for collagen content as a surrogate measure of fibrosis. Baseline (saline-challenged) levels of lung collagen were not statistically different in any of the four genotypes tested (Fig. 2). After FITC challenge, BALB/c mice develop fibrosis, as measured by increased deposition of collagen similar to what has been reported previously (3). Similarly, the IL-4-/- mice showed no protection from the development of pulmonary fibrosis. In contrast, mice deficient in IL-13 or mice deficient in both IL-4 and IL-13 showed protection from the development of FITC-induced fibrosis that was statistically significant. There was no additive protection seen in the mice that were deficient in both IL-4 and IL-13 compared with the mice deficient in IL-13 alone.
|
The results of the collagen assay were confirmed by examining histology from FITC-treated mice of the four genotypes. Histologic sections were obtained from mice on day 21 post-FITC and were stained with H&E to identify inflammatory cells and with Massons Trichrome to visualize mature collagen deposition. Both BALB/c and IL-4-/- mice show evidence of dense consolidation and fibrosis, whereas the IL-13-/- and IL-4/13-/- mice showed only isolated areas of inflammation and consolidation (Fig. 3).
|
To determine the degree of inflammation seen in the four genotypes after FITC administration, mice were injected with FITC on day 0 and harvested for collagenase digestion on days 7, 14, and 21 post-FITC. Total cell numbers were enumerated and compared with cell numbers from collagenase digestions of untreated mice (day 0). All genotypes of mice tested showed cellular influx to the lung in response to FITC inoculation. The inflammatory response was maximal on day 7, but remained slightly elevated on days 14 and 21 post-FITC (Fig. 4A). There was no statistical difference in the magnitude of the inflammatory response between any of the groups of mice tested. Thus, the protection seen in the IL-13-/- and IL-4/13-/- mice could not be attributed to diminished inflammation.
|
To determine the composition of the inflammatory cells that were recruited in the four genotypes of mice, leukocytes purified from collagenase digests were subjected to differential and flow cytometric analysis to determine cellular phenotype. Fig. 4B represents data from day 7 post-FITC, the peak of the inflammatory response. These data demonstrate that BALB/c mice develop marked eosinophilia in response to FITC challenge on day 7 postinoculation. The eosinophilia is transient and is gone by day 14 post-FITC (not shown). Interestingly, the IL-13-/-, IL-4-/-, and IL-4/13-/- mice all showed reduced eosinophilia on day 7 despite the fact that the IL-4-/- mice were not protected from fibrosis. We conclude that the genetic disruption of the T2 cytokines inhibits the development of transient eosinophilia in response to fibrotic challenge; however, the absence of eosinophils does not correlate with protection from fibrosis. To determine whether there were any differences in the composition of the lymphocytes that were recruited to the lung after FITC challenge, we subjected the collagenase-digested leukocytes to flow cytometric analysis. There was no statistical difference in the number of B, NK, 
T, CD4+ 
T, or CD8+ 
T cells within the lungs of any of the genotypes tested (not shown). Similarly, there were no significant differences in the composition of the inflammatory response among the various genotypes when tested on day 14 or 21 post-FITC (not shown).
Number of fibroblasts cultured from lung minces is similar in all four genotypes
To determine whether there were differences in the numbers of fibroblasts present in the lungs of FITC-treated mice, lung minces were prepared from mice of all four genotypes on day 7 post-FITC, the peak of inflammation. Lung minces from individual mice (n = 4) were cultured for 14 days and total numbers of mesenchymal cells were enumerated. BALB/c mice contained an average of 2.4 ± 0.5 million fibroblasts. IL-13-/- mice contained 2.8 ± 0.5 million, IL-4/13-/- mice contained 2.5 ± 0.6 million, and IL-4-/- mice contained 2.8 ± 0.3 million fibroblasts/lung. There were no statistical differences in the number of fibroblasts grown from lung minces of the different genotypes at any time point tested between days 0 and 21.
Neither T1 cytokine profiles nor eicosanoid differences correlate with protection from FITC-induced fibrosis
We were next interested in determining whether there were notable differences in the profiles of eicosanoids or cytokines made in response to FITC in the susceptible vs resistant genotypes. Mice of all four genotypes were injected with FITC on day 0. On day 3 or 7 post-FITC, lungs were harvested, and lung homogenates were analyzed for cytokine levels by specific ELISA. Table I describes the levels of IFN-
, IL-10, and MCP-1 that were present in the lungs of each genotype. There were no significant differences in the levels of IL-10 or MCP-1 present in the lungs of the four genotypes of mice. Interestingly, the level of IFN-
was significantly greater in the BALB/c lungs than in the other three genotypes (p < 0.01); however, there was no statistical difference between the protected IL-13-deficient mice and the susceptible IL-4-/- mice. Furthermore, when IFN-
was measured in leukocyte supernatants of cells purified from lungs on day 7 postfibrotic insult, there were no significant differences noted (BALB/c lung leukocytes secreted 790 ± 293 pg/ml compared with 1176 ± 506 pg/ml from IL-4-/- leukocytes and 715 ± 177 pg/ml from IL-13-/- leukocytes; n = 4.) Thus, IFN-
production does not correlate with protection.
|
IL-13-/- mice do not have diminished levels of TGF-
1
TGF-
1 is a critical profibrotic cytokine that is known to be able to induce fibrotic responses within the lung (45). It has been well documented that TGF-
1 can induce the transformation of fibroblasts to myofibroblasts (46, 47, 48, 49, 50) and can increase the production of extracellular matrix components in fibroblasts (51, 52). Recent work using IL-13-overexpressing mice has suggested that IL-13 exerts its profibrotic effects via increasing both the transcription and the activation of TGF-
1 (29). Therefore, we wanted to determine the level of TGF-
1 expression in IL-13-/- and IL-4/13-/- mice. For these analyses, BALB/c, IL-13-/-, and IL-4/13-/- mice were injected with FITC on day 0. On days 0, 3, 7, 14, and 21 post-FITC, lungs were harvested for RNA analysis of TGF-
isoforms or were homogenized and assayed for TGF-
1 bioactivity using PAIL cells. Fig. 5A demonstrates the levels of total (acid-treated) TGF-
1 activity detected in lung homogenates from the various genotypes after FITC. There were no statistical differences between any of the strains. Likewise, when active TGF-
1 was analyzed by bioassay in non-acid-treated samples (Fig. 5B), the levels paralleled the pattern seen in total TGF-
1 activity, and there were no statistical differences between the groups. Similarly, the mRNA levels were not statistically different for TGF-
1, TGF-
2, and TGF-
3 when analyzed by RNase protection assay (Fig. 5C) on day 7. Additionally, RT-PCR analysis of TGF-
1 expression in lungs on day 14 post-FITC are not different (Fig. 5D). Thus, IL-13-/- mice are protected from FITC-induced pulmonary fibrosis despite abundant levels of TGF-
1.
|
1 responsiveness is intact in IL-13-deficient fibroblasts
We next determined whether the responsiveness to TGF-
1 was diminished in IL-13-deficient fibroblasts. To ascertain whether TGF-
1 signaling pathways were functional in IL-13-/- fibroblasts, cells were grown from lung minces of unchallenged BALB/c and IL-13-/- mice. Four million primary fibroblasts pooled from three mice of each genotype were transiently transfected with the p3TP-LUX plasmid, which contains a TGF-
1-responsive promoter driving a luciferase reporter gene. Transfected cells were split into equal aliquots, and half were treated with 10 ng/ml TGF-
1. Cellular lysates were then analyzed for luciferase activity. TGF-
1 induced a 7.4 ± 2.2-fold increase in luciferase activity in BALB/c fibroblasts compared with a 15.2 ± 4.8-fold increase in IL-13-/- fibroblasts (n = 3; p = NS). Thus, there was no deficiency in TGF-
1 signaling in the IL-13-/- fibroblasts. TGF-
1 is well known to up-regulate collagen synthesis in fibroblast cultures; thus, we tested the effect of TGF-
1 on collagen production in BALB/c and IL-13-/- fibroblasts. Fig. 6A demonstrates that TGF-
1 augments the production of collagen I in BALB/c fibroblasts. Fig. 6B demonstrates that TGF-
1 is similarly able to augment collagen I production from IL-13-deficient fibroblasts. These data suggest that there are no defects in TGF-
1 signaling in fibroblasts from IL-13-deficient mice.
|
We next addressed whether the overall production of collagen was different among fibroblasts purified from the four genotypes of mice. Fibroblasts were grown from pooled lung minces (n = 3) of the four strains of mice as described in Materials and Methods. After 13 days of culture, cells were adhered to 35-mm dishes and were then serum-starved for 24 h. Some dishes of cells were treated with IL-13 at 10 ng/ml or were maintained in serum-free medium for an additional 48 h. Cellular lysates were prepared and analyzed for collagen I production by Western blot. Fig. 7A demonstrates that IL-13-/- and IL-4/13-/- fibroblasts from unchallenged mice produce lower levels of collagen I compared with BALB/c mice when equal amounts of protein from the cultures are compared. Densitometry of multiple experiments showed the production of collagen I by IL-13-/- fibroblasts was reduced 6090% compared with that by BALB/c fibroblasts. This was also true when fibroblasts were isolated from day 7 FITC-treated mice (not shown). In contrast, fibroblasts from IL-4-/- mice produced equivalent collagen levels (never >12% different by densitometry) compared with BALB/c controls (Fig. 7B). Fig. 7C demonstrates that IL-13 could augment the production of collagen in both BALB/c and IL-13-/- fibroblasts. However, because of the overall lower levels of collagen at baseline in the IL-13-/- mice, even stimulated levels of collagen production were lower. Thus, an overall diminished production of collagen in the IL-13-/- mice is probably responsible for the protection from fibrosis seen in these mice in vivo.
|
1 expression increases on fibroblasts during fibrotic responses
Our data demonstrate that IL-13 is a potent profibrotic cytokine that drives the production of collagen I from fibroblasts. Therefore, we hypothesized that IL-13R expression might increase on fibroblasts during fibrotic processes in vivo. We examined the expression of the high affinity, signal-transducing IL-13R
1 chain on fibroblasts purified from wild-type mice at various time points post-FITC challenge. Fibroblasts were grown out of lung minces started on days 0, 1, 3, 7, 10, and 14 post-FITC. Fibroblasts were allowed to grow for 14 days in culture before RNA was harvested and analyzed by RT-PCR for the expression of IL-13R
1. The levels of mRNA for IL-13R
1 were increased by days 10 and 14 during the fibrotic response, a time point that correlates well with in vivo fibroproliferation post-FITC. We were unable to identify transcripts for IL-13R
2 in these same cells by RT-PCR (not shown). Thus, fibroblast IL-13R
1 expression increases during fibrotic processes in vivo, and the profibrotic effects of IL-13 on collagen I production are probably amplified.
| Discussion |
|---|
|
|
|---|
1 activation or signaling. Rather, the protection seen in IL-13-deficient mice is related to the collagen synthesis phenotype of the fibroblasts. Fibroblasts from IL-13-/- and IL-4/13-/- mice produce less collagen I than wild-type cells both at baseline and after FITC challenge. The expression of IL-13R
1 increases on fibroblasts during fibrotic responses in vivo. Thus, fibrotic protection in IL-13-/- mice can be attributed to the lack of IL-13 activation of collagen secretion in fibroblasts from those animals. IL-13-/- animals are protected from fibrosis despite the presence of TGF-
1; thus, these results suggest that in vivo IL-13 plays an obligatory role in driving collagen production from fibroblasts.
Our studies involve IL-13- and IL-4/13-deficient mice. Previous studies involved transgenic mice overexpressing IL-13. These overexpression studies demonstrated that IL-13 increased subepithelial cell fibrosis, mucus hypersecretion, and eosinophilic inflammation reminiscent of changes associated with asthma and airway remodeling (10). Further investigations demonstrated that IL-13 increased the transcription and activation of TGF-
1 (29), thus suggesting that activation of TGF-
1 was a central mechanism for the profibrotic effects of IL-13. These experiments clearly demonstrated that overexpression of IL-13 (in the absence of a fibrotic stimulus) was associated with fibrotic changes in the lung. Our results confirm a crucial role for IL-13 in mediating fibrotic responses, but demonstrate a different mechanism from that found in earlier studies. IL-13-/- mice are significantly protected when administered a fibrotic challenge. Interestingly, these IL-13-/- mice are protected from FITC-induced pulmonary fibrosis despite abundant production of TGF-
1. Our results show that there were no differences in the levels of transcription of TGF-
1, TGF-
2, or TGF-
3 among any of the genotypes tested at any time point. No differences in the levels of active or latent TGF-
1 were detected in lung homogenates of any of the genotypes at any time point analyzed, and no differences in TGF-
1 signaling were identified. Thus, in this model, IL-13-/- mice do not show a defect in their ability to transcribe and activate this profibrotic cytokine. We propose that IL-13 plays a dominant, non-TGF-
1-dependent role in the regulation of fibroblast extracellular matrix production.
Our previous work has demonstrated that 5-lipoxygenase products of arachidonic acid metabolism (leukotrienes) are profibrotic molecules in pulmonary fibrosis (7), whereas the cyclooxygenase products of arachidonic acid metabolism (PGs) are protective lipid mediators in fibrotic responses (33, 34). T2 cytokines can influence the expression of enzymes regulating arachidonic acid metabolism (35, 36, 37, 38, 39, 40, 41, 42, 43, 44). Table I demonstrates that the expression of cysteinyl leukotrienes, leukotriene B4, and PGE2 are similar despite the genotype of the mouse tested. Similar patterns of expression were seen on days 14 and 21 post-FITC as well (not shown). Thus, altered eicosanoid generation could not account for the protection in IL-13-/- mice.
Fibrotic diseases in the lung have been attributed to alterations in the balance of T1 vs T2 cytokines (53, 54, 55). Diseases such as asthma and fungal infections, which can develop fibrotic consequences, are often characterized by the overproduction of T2 relative to T1 cytokines. Thus, one possibility for the protection seen in IL-13-deficient mice was that the fibrotic protection was due to a compensatory overproduction of T1 cytokines such as IFN-
. However, no clear pattern of elevated IFN-
could be identified in the protected IL-13-/- and IL-4/13-/- mice at any time point post-FITC.
Fibroblasts, specifically myofibroblasts, are the cell type responsible for the pathologic consequences of excess matrix production during fibrosis (50). Fibroblasts grown from lung minces in complete medium phenotypically resemble myofibroblasts, as evidenced by the high level expression of
SMA. IL-13- and IL-4/13-deficient cells produced less collagen I despite having equivalent levels of
SMA. These data suggest that IL-13 does not regulate myofibroblast differentiation, but, rather, regulates the effector function of these myofibroblasts in situ. One possibility to explain this finding is that fibroblasts from IL-13-deficient mice failed to express receptors for TGF-
1 or IL-13. However, our results suggest that the fibroblasts from IL-13-deficient mice are fully capable of responding to both TGF-
1 and IL-13 in vitro by increasing collagen I production. Diminished matrix production in IL-13-/- fibroblasts cannot be attributed to decreased fibrotic ligand responsiveness, but, rather, results from an absence of fibrotic ligand (IL-13) expression. Additionally, our data from wild-type mice demonstrate that IL-13R
1 expression increases on fibroblasts/myofibroblasts throughout the progression of fibrotic disease (Fig. 8). Given that our data in Fig. 7 demonstrate that IL-13 is a potent inducer of extracellular matrix secretion in fibroblasts, increased receptor expression during fibrotic responses is likely to have important pathogenic consequences. Increased receptor expression probably leads to increased signaling, and thus the cycle of IL-13-driven matrix production would be expected to be amplified.
|
SMA expression and collagen I expression are distinct. Previous studies have suggested that the increased collagen production in fibrotic responses is due to the increased synthesis of collagen by myofibroblasts (56). IL-13-/- fibroblasts are deficient in collagen I synthesis despite equivalent levels of
SMA expression. Furthermore, this observation suggests that neutralization of IL-13 may still be beneficial in fibrotic disorders where myofibroblast recruitment/proliferation is already underway.
In conclusion, our data demonstrate that IL-13 crucially regulates collagen I production by myofibroblasts. Signals from IL-13 increase the levels of collagen I protein expression independent of TGF-
1 signaling. The absence of IL-13 is sufficient to prevent collagen I synthesis, even in the presence of TGF-
1, both in vitro and in vivo. Blockade of IL-13 or IL-13R may represent a promising therapeutic target, because it may block the undesired effects of excess matrix production, presumably while leaving intact the ability of myofibroblasts to contract and close injured areas via
SMA-mediated processes. Furthermore, our results suggest that anti-IL-13 therapy would be unlikely to modulate the eicosanoid and cytokine cascades necessary for efficient wound repair. Thus, our results suggest that anti-IL-13 therapies may be very beneficial for the treatment of fibroproliferative lung disorders.
| Footnotes |
|---|
2 Address correspondence and reprint requests Dr. Bethany B. Moore, Internal Medicine/Pulmonary Division, University of Michigan, 1150 West Medical Center Drive, 6301 MSRB III, Ann Arbor, MI 48109-0642. E-mail address: bmoore{at}umich.edu ![]()
3 Abbreviations used in this paper: EIA, enzyme immunoassay; MCP-1, monocyte chemotactic protein-1; PAI-1, plasminogen activator inhibitor-1;
SMA,
-smooth muscle actin; WG, Wright-Giemsa. ![]()
Received for publication March 24, 2003. Accepted for publication January 23, 2004.
| References |
|---|
|
|
|---|
and fibroblast collagen synthesis in chronic pulmonary inflammation. J. Exp. Med. 170:727.
deficient host. Parasite Immunol. 23:271.[Medline]
1. J. Exp. Med. 194:809.
inhibit prostaglandin production by interleukin-1
-stimulated human periodontal ligament fibroblasts. Inflammation 23:1.[Medline]
-interferon and interleukins 4 and 13: potential relevance to leukotriene regulation in glomerular disease. Exp. Nephrol. 8:258.[Medline]
1 induces prolonged severe fibrosis in rat lung. J. Clin. Invest. 100:768.[Medline]
-smooth muscle actin gene expression in myofibroblast differentiation from rat lung fibroblasts. Int J. Biochem. Cell Biol. 33:723.[Medline]
1 is dependent on cell adhesion and integrin signaling via focal adhesion kinase. J. Biol. Chem. :
1 promotes the morphological and functional differentiation of the myofibroblast. Exp. Cell. Res. 257:180.[Medline]
1 induces
-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. 122:103.
on cell proliferation and collagen formation by lung fibroblasts. J. Biol. Chem. 262:3897.
. Connect. Tissue Res. 24:237.[Medline]
This article has been cited by other articles:
![]() |
R. M. Strieter and B. Mehrad New Mechanisms of Pulmonary Fibrosis Chest, November 1, 2009; 136(5): 1364 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. McMillan, B. B. Moore, J. B. Weinberg, K. M. Vannella, W. B. Fields, P. J. Christensen, L. F. van Dyk, and G. B. Toews Exacerbation of Established Pulmonary Fibrosis in a Murine Model by Gammaherpesvirus Am. J. Respir. Crit. Care Med., April 1, 2008; 177(7): 771 - 780. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Migliaccio, M. C. Buford, F. Jessop, and A. Holian The IL-4R{alpha} pathway in macrophages and its potential role in silica-induced pulmonary fibrosis J. Leukoc. Biol., March 1, 2008; 83(3): 630 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Moore and C. M. Hogaboam Murine models of pulmonary fibrosis Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L152 - L160. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Scotton and R. C. Chambers Molecular Targets in Pulmonary Fibrosis: The Myofibroblast in Focus Chest, October 1, 2007; 132(4): 1311 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Swain, S. Han, A. Harmsen, K. Shampeny, and A. G. Harmsen Pulmonary Hypertension Can Be a Sequela of Prior Pneumocystis Pneumonia Am. J. Pathol., September 1, 2007; 171(3): 790 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhandari, R. Choo-Wing, R. J. Homer, and J. A. Elias Increased Hyperoxia-Induced Mortality and Acute Lung Injury in IL-13 Null Mice J. Immunol., April 15, 2007; 178(8): 4993 - 5000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Brown, E. J. Swindle, N. M. Kushnir-Sukhov, A. Holian, and D. D. Metcalfe Silica-Directed Mast Cell Activation Is Enhanced by Scavenger Receptors Am. J. Respir. Cell Mol. Biol., January 1, 2007; 36(1): 43 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Misson, F. Brombacher, M. Delos, D. Lison, and F. Huaux Type 2 immune response associated with silicosis is not instrumental in the development of the disease Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L107 - L113. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. N. Lama, H. Harada, L. N. Badri, A. Flint, C. M. Hogaboam, A. McKenzie, F. J. Martinez, G. B. Toews, B. B. Moore, and D. J. Pinsky Obligatory Role for Interleukin-13 in Obstructive Lesion Development in Airway Allografts Am. J. Pathol., July 1, 2006; 169(1): 47 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Prasse, D. V. Pechkovsky, G. B. Toews, W. Jungraithmayr, F. Kollert, T. Goldmann, E. Vollmer, J. Muller-Quernheim, and G. Zissel A Vicious Circle of Alveolar Macrophages and Fibroblasts Perpetuates Pulmonary Fibrosis via CCL18 Am. J. Respir. Crit. Care Med., April 1, 2006; 173(7): 781 - 792. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. White, R. G. Atrasz, B. Hu, S. H. Phan, V. Stambolic, T. W. Mak, C. M. Hogaboam, K. R. Flaherty, F. J. Martinez, C. D. Kontos, et al. Negative Regulation of Myofibroblast Differentiation by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) Am. J. Respir. Crit. Care Med., January 1, 2006; 173(1): 112 - 121. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Finotto, M. Hausding, A. Doganci, J. H. Maxeiner, H. A. Lehr, C. Luft, P. R. Galle, and L. H. Glimcher Asthmatic changes in mice lacking T-bet are mediated by IL-13 Int. Immunol., August 1, 2005; 17(8): 993 - 1007. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Beamer and A. Holian Scavenger receptor class A type I/II (CD204) null mice fail to develop fibrosis following silica exposure Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L186 - L195. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Moore, J. E. Kolodsick, V. J. Thannickal, K. Cooke, T. A. Moore, C. Hogaboam, C. A. Wilke, and G. B. Toews CCR2-Mediated Recruitment of Fibrocytes to the Alveolar Space after Fibrotic Injury Am. J. Pathol., March 1, 2005; 166(3): 675 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Belperio, M. Dy, L. Murray, M. D. Burdick, Y. Y. Xue, R. M. Strieter, and M. P. Keane The Role of the Th2 CC Chemokine Ligand CCL17 in Pulmonary Fibrosis J. Immunol., October 1, 2004; 173(7): 4692 - 4698. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jinnin, H. Ihn, K. Yamane, and K. Tamaki Interleukin-13 Stimulates the Transcription of the Human {alpha}2(I) Collagen Gene in Human Dermal Fibroblasts J. Biol. Chem., October 1, 2004; 279(40): 41783 - 41791. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |