|
|
||||||||

* Departments of Microbiology/Immunology and Otolaryngology-Head and Neck Surgery, Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA 19107; and
Department of Pathobiology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
B and the production of downstream targets including GM-CSF and macrophage chemotactic protein 1. These factors are known to be immunostimulatory, making RP3 a molecular adjuvant and potentially promoting tissue-specific immunity. However compelling, these in vitro data do not reliably predict gene function in vivo or the cumulative effects of time-dependent processes such as angiogenesis, inflammation, or the influence of genetic background. To address these issues, we analyzed the production of proinflammatory mediators in mouse thyroid organs and demonstrate consistency with in vitro studies performed previously that Il1
, Il1
, Il6, and Tnf
and the enzyme Cox2 are produced by RP3-transgenic thyroid tissue, but absent from nontransgenic thyroids. Furthermore, we find that that the genetic background of the host is important in the observed RP3-induced inflammation and tumor progression. These findings provide support for the notion that oncogene-induced cytokine secretion is important for the development and progression of thyroid carcinomas in genetically permissive hosts. | Introduction |
|---|
|
|
|---|
Much like other epithelial tumors, differentiated papillary thyroid carcinomas (PTC)3 frequently express dominant oncogenes that are thought to initiate the process of transformation leading to cancer ( 3). This is supported by evidence that shows that expression of the RET/PTC oncogene (RP3) in mice causes the development of differentiated carcinomas. In contrast, in vitro data describing the function of RET/PTC has not convincingly revealed evidence about how it manifests its oncogenic properties. For example, in vitro expression of RP3 in thyroid cells not only induces the loss of thyroid-stimulating hormone dependence and nuclear features characteristic of human PTC, but also induces apoptosis ( 4). Even though several tyrosine residues have been identified as critical for signaling, mutation of any one of them in vivo does not completely abrogate tumor formation ( 5), suggesting that multiple signaling pathways are required or that other factors come together to work in concert with RET/PTC to cause cancer. A major factor is the hosts contribution to the tumor microenvironment including angiogenesis, lymphangioenesis, stromal and immune reactions ( 5). Indeed, despite the overwhelming data to support a role of oncogenes in causing cancer, very little is known about how they influence the host microenvironment. To better understand how RET/PTC function leads to cancer, investigators have identified molecules that bind phosphorylated RET/PTC and activate downstream cascades ( 6, 7). The results of these studies indicate that this type of activation initializes one or more of several common signaling pathways including RAS/extracellular signal-regulated kinase, mitogen-activated protein kinase, c-Jun N-terminal kinase, and phosphatidylinositol 3-kinase/AKT that provide survival signals but also paradoxically induce apoptosis ( 8, 9). One pathway activated by the c-RET tyrosine kinase domain results in the activation of PI3K and the nuclear translocation of NF-
B ( 10). The NF-
B pathway is critical to tumor formation since it not only promotes cell survival via the expression of antiapoptotic proteins but also the transcription of many immune-related genes and proinflammatory cytokines that can influence tumor progression through the mobilization of host cells ( 11). Consistent with this model, we demonstrated that forced expression of the RET/PTC oncogene in thyrocyte cell lines causes nuclear translocation of NF-
B and the activation of proinflammatory mediators including macrophage chemotactic protein 1 (Mcp1) and G-CSF ( 12). This activation was critically dependent on the signaling function of RET/PTC since mutation of this property abrogated cytokine synthesis ( 12, 13). Furthermore, examination of tissue specimens from PTC has indicated the capability of tumor cells to secrete a wide variety of inflammatory cytokines, although in these studies the expression of RET/PTC was not assessed ( 14, 15, 16, 17).
Cytokine secretion by transformed thyrocytes may play a role in the development and progression of thyroid cancer. For instance, low level cytokine production by thyrocytes can directly stimulate, in a paracrine or autocrine fashion, the growth of thyroid cells ( 18, 19) via the secretion of Il1
(20), Il6 ( 21), or IL4 and IL10 (17). Moreover, previous work has demonstrated that RET/PTC3 (RP3) can directly induce the production of these and other inflammatory factors ( 12) and, when such cells are transplanted into mice, induce the attraction of activated macrophages. These and other data suggest that RP3-induced thyroid hyperplasia and carcinoma evokes multiple systems in vivo to manifest carcinogenic effects of RP3 ( 22). The consequence of this oncogene-induced cytokine secretion is to recruit leukocytes that secrete additional cytokines ( 12, 23, 24, 25). Although much is known about the capability of tumors or tumor cells to produce proinflammatory mediators at late stages of disease, little is known about how these factors may be available early in the process to promote the support and progression of transformed epithelial cells. In this study, we have expanded on the finding that the RP3 oncogene can induce inflammatory mediators in thyroid cells by measuring the effects of these mediators on tumors that develop in RP3-transgenic mouse strains. The study of oncogene function within an animal model provides important clues about the interactive role genes play during the earliest stages of cellular transformation and its progression into cancer.
| Materials and Methods |
|---|
|
|
|---|
RP3, TRK-T1, and RP3p53-/--transgenic mice were constructed as previously described ( 22, 26, 27). All strains of mice were produced on a B6C3F1 background and were subsequently interbred with siblings. In some experiments, RP3-transgenic mice on a mixed B6C3F1 genetic background were backcrossed to C3H/HeJ for 10 generations (C3H/HeJ-TgN(RP3)1jlr) and backcrossed to C57BL/6 for 2 generations (C57BL/6-TgN(RP3)1jlr) and will be referred to herein as C3H-RP3 and B6-RP3, respectively. Thyroid weight was measured after organ exfirpation from mice to the nearest 0.01 g. In some cases, B6-RP3-transgenic thyroids were divided into a "small" (
0.02 g) and "large" (>0.02 g) group based on an observed and calculated bimodal distribution of thyroid weights using Conovers statistical analysis. Nontransgenic C57BL/6 and C3H/HeJ mice were purchased from Charles River Breeding Laboratories (Wilmington, MA). Mice were maintained at the Kimmel Cancer Institute animal facility.
RT-PCR analysis
For analysis of cytokine expression in nontransgenic, B6-RP3, TRK-T1, and RP3p53-/-mice. Five transgenic thyroids were examined individually for all strains except for nontransgenic thyroids in which case five pools of five thyroids were analyzed. For analysis of cytokine expression, nontransgenic, B6-RP3, and C3H-RP3 individual 2- to 4-mo-old age-matched thyroids from 7 RP3-negative transgenic littermates, 14 C3H-RP3, and 18 B6-RP3 mice were analyzed. Thyroid tissue was homogenized in 0.5 ml of cell lysis buffer (4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% sodium N-lauroylsarcosine, and 0.1 M 2-ME). Total RNA was extracted using phenol:chloroform (1:1) followed by ethanol precipitation. DNA was digested using RNase-free DNase (Ambion, Austin, TX). Five micrograms of DNase-digested total RNA was reverse transcribed using oligo(dT) primers with Superscript II (Invitrogen, Carlsbad, CA) to create cDNA from primed mRNA. As a representative of mRNA expression, the synthesized cDNA was amplified by PCR using primers specific for G3pdh for normalization or using primers specific for cytokines/chemokines. Previous work has shown that expression of cDNA represents
33% of the mRNA expressed in the cells/tissues analyzed and thus represents a low or conservative estimate of the actual amount of mRNA for a given gene ( 28). PCR cycling was 94°C for 4 min, 1 cycle; 94°C for 30 s, 60°C for 30 s, 72°C for 60 s, 25 or 30 cycles; 72°C for 7 min, 1 cycle. G3pdh PCR was performed at 25 cycles while all other PCRs were performed at 30 cycles. The primers specific for mouse G3pdh (5' primer, CCTTCATTGACCTCAACTAC and 3' primer, ATGACAAGCTTCCCATTCTC), Il1
(5' primer, ACTTGTTTGAAGACCTAAAG and 3' primer, GTTTCAGAGGTTCTCAGAGA), Il1
(5' primer, TGAGAGCATCCAGCTTCAAATCTC and 3' primer, CGCTTTTCCATCTTCTTCTTTGG), Il6 (5' primer, TTCCCTACTTCACAAGTCCGGA and 3' primer, TCCTTAGCCACTCCTTCTGTGACT), Mcp1 (5' primer, CACTCACCTGCTGCTACTCATTCA and 3' primer, GCTTGAGGTGGTTGTGGAAAAG), Tnf
(5' primer, AGGTTCTCTTCAAGGGACAAGGCT and 3' primer, AATGACTCCAAAGTAGACCTGCCC), Cox2 (5' primer, TGACTGTACCCGGACTGGATTCTA and 3' primer, TTTAAGTCCACTCCATGGCCCA) Gmcsf, (5' primer, TGGCTGCAGAATTTACTTTT and 3' primer, CCGTAGACCCTGCTCGAATA), and Kc, (5' primer, ATCCCAGCCACCCGCTCGCT and 3' primer, AGTGTGGCTATGACTTCGGT). Primers were used that specifically amplify the breakpoints of human RP3 (5' primer, TGGAGAAGAGGAGCTGTATC and 3' primer, CTTTCAGCATCTTCACGG) and TRK-T1 (5' primer, GCGGTGTTGCAGCAAGTCCT and 3' primer, CGATGATGTGGCCTTGGAGC). The sizes of the PCR products generated were: G3pdh, 100 bp; Il1
, 172 bp; Il1
, 513 bp; Il6, 487 bp; Mcp1, 320 bp; Tnf
, 281 bp; Cox2, 525 bp; Gmcsf, 239; Kc, 200 bp; RP3, 310 bp; and TRK-T1, 590 bp. Negative control PCR were performed using cDNA from sham reverse-transcribed RNA. PCR products were resolved in 2% agarose gels by electrophoresis in TBE buffer (0.89 M Tris-borate, 0.89 M boric acid, 0.02 M EDTA, pH 8.3 ± 0.1) containing 0.5 µg/ml ethidium bromide and band intensities were quantified using the Bio-Rad Gel Doc and Quantity One densitometric program (Bio-Rad, Hercules, CA). Background gel values were subtracted and normalized according to values obtained for G3pdh products. Luminosity values of PCR products from a minimum of five thyroids were averaged and SE of mean calculated.
Immunohistochemistry
Immunohistochemical analysis of paraffin-embedded mouse thyroids was performed as previously described ( 26). Briefly, tissue was fixed in 10% Formalin for 24 h, desiccated in ethanol, embedded in liquid paraffin, and cooled to room temperature. Six-micrometer tissue sections were cut and placed onto glass slides treated with xylenes, to remove paraffin, hydrated, using decreasing concentrations of alcohol, and microwaved for 15 min in 100 mM citrate buffer (pH 6.0). Slides were treated with 10% goat serum for 15 min and incubated with primary Ab for 16 h at room temperature (primary Ab consisted of either a 1/3000 dilution of 5 µg/µl rabbit polyclonal anti-mouse Cox-2 (Cayman Chemicals, Ann Arbor, MI) or 1/200 dilution of 200 µg/ml rabbit polyclonal anti-tyrosine kinase domain of c-RET (Santa Cruz Biotechnology, Santa Cruz, CA)). Following Ab incubation, slides were washed twice with PBS for 5 min each, once with PBS/0.1% BSA, and incubated with biotin-labeled secondary Ab for 1 h at 25°C. Slides were washed as above and incubated with substrate according to the DAB Vectastain kit (Vector Laboratories, Burlingame, CA). Specimens were then counterstained with hematoxylin, dehydrated, and mounted. Where indicated, cryostat sections were used to phenotype the cellular infiltrate. Mouse thyroids were embedded in OCT solution and frozen in liquid nitrogen. Six-micrometer sections were dried for 1 h, fixed in ice-cold acetone for 20 min, allowed to dry for 2 h, and then stored at -20°C until use. Sections were thawed, refixed in cold acetone for 5 min, and then allowed to air dry for 10 min. Sections were then hydrated in PBS and prepared for staining as paraffin-embedded sections after a short microwave treatment, with the exception that primary Ab was incubated on sections for 1 h at room temperature. Frozen thyroid sections were stained with the following Abs at a dilution of 1/100: 500 µg/ml CD11b, 500 µg/ml Ly-6G (Gr-1), 500 µg/ml rat IgG2b (BD PharMingen, San Diego, CA); 200 µg/ml F4/80 (Caltag Laboratories, Burlingame, CA); 500 µg/ml Il6 (R&D Systems, Minneapolis, MN); or 100 µg/ml DEC-205 (Cedarlane Laboratories, Hornby, Ontario, Canada).
Western blot analysis
Thyroid tissue from nontransgenic, B6-RP3, TRK-T1, and RP3p53-/- was homogenized, and cell lysates were prepared in protein extract buffer (30 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% Triton X-100, 100 mM NaCl, and 1 mM PMSF) and stored at -70°C. Recombinant mouse Il6 was purchased from R&D Systems. Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. Membranes were blocked for 30 min in TBST buffer (20 mM Tris-HCl (pH 7.6), 135 mM NaCl, and 1% Tween 20) with 5% nonfat dry milk or 5% BSA and immunoblotted with either a 1/2000 dilution of 5 µg/µl rabbit anti-mouse Cox2-specific antisera (Cayman Chemicals) or a 1/1000 dilution of 0.2 µg/ml biotinylated goat anti-mouse Il6 antisera (R&D Systems) or a 1/500 dilution of anti-mouse/human G3PDH antisera (Trevigen, Gaithersburg, MD) for 16 h at 4°C. Following incubation, membranes were washed three times for 5 min in TBST buffer and treated with either HRP-conjugated donkey anti-rabbit IgG (Amersham, Piscataway, NJ) or Vectastain ABC (Vector Laboratories) for 1 h at room temperature. Membranes were washed, and the protein bands were visualized using ECL (Amersham) after exposure to x-ray film for 15 min.
Statistical analysis
The results of cytokine RT-PCR and the weights of mouse thyroids are presented as the mean ± SEM. Data comparing thyroid weights with cytokine production were analyzed using two nonparametric tests. One, the Wilcoxon rank sum analysis, was used to test for a change of median between groups and a second, Conovers test for variability, for comparing multiple groups together. For both tests we used the exact form to allow for small sample sizes and the many duplicate weights. The p values reported are two tailed and are not corrected for multiple testing. Calculations were done using the StatXact software (Sytel Software) with the assistance of Dr. W. Hauck (Biostatistics Section, Kimmel Cancer Center)
| Results |
|---|
|
|
|---|
To determine whether the expression of the RP3 oncogene can specifically alter thyroid epithelial cell biology and cause the production of proinflammatory cytokines, nontransgenic and two thyroid oncogene-transgenic mouse strains (RP3 and TRK-T1) were examined for expression of selected proinflammatory cytokine RNA. RT-PCR analysis of RNA from thyroids of 3- to 8-mo-old transgenic or nontransgenic mice demonstrated that RP3 thyroids expressed Cox-2, Gmcsf, Il1
, Il1
, Mcp1, Il6, and Tnf
RNA that was increased compared with TRK-T1 and nontransgenic thyroids (Fig. 1). To determine whether increases in proinflammatory cytokine RNA corresponded to an increase in protein, thyroid tissue from RP3, TRK-T1, or nontransgenic 4- to 6-mo-old age-matched mice were examined by Western blot for the expression of the cytokines Il6 and Cox2. Thyroid organs used for these studies had no evidence of neoplastic invasion of neighboring or underlying tissue as determined at the time of extirpation of the gland. In this case "invasion" was defined by attachment or invagination of the thyroid gland underlying mucosa. Vascular invasion was not evaluated since several whole organs were needed for each molecular analysis and thus microscopic examination of every specimen could not be accomplished. Although at 8 mo of age
30% of susceptible mice (B6C3F1 mice) will develop invasive carcinoma ( 22), with the exception of two thyroids taken from control mice, the specimens used for these studies were not older than 6 mo of age. Tissue isolated from these mice was examined using Western blots and these data confirmed the induction of both Il6 and Cox2 protein in RP3 but not TRK-T1 or nontransgenic thyroids (Fig. 2).
|
|
The coexpression of inflammatory mediators with RP3 would support a cause-effect relationship like that found from in vitro studies ( 12). Thus, to evaluate the coincident expression of RP3 with a marker of inflammation, the protein Cox2 was used since it is an intracellular enzyme induced during thyroid inflammatory responses and can be localized to individual cells using immunohistochemical staining ( 29). Data in Fig. 3 show that Cox2 protein was detectable in RP3 thyroid tissues. Cox2 staining of the thyroid was not uniformly distributed within the organ but rather it was restricted to follicular epithelial cells (Fig. 3B). As expected, RP3 protein expression was similarly confined to epithelial cells (Fig. 3E), consistent with the specificity of the thyroglobulin promoter restricting the RNA expression of the RP3 transgene to these cells as previously described ( 22). The production of Cox2 was specific for RP3-expressing tissue since Cox2 was not detected in nontransgenic or TRK-T1-transgenic thyroid epithelium (Fig. 3, A, D, and G).
|
The presence of inflammatory cytokines in RP3-expressing thyroid tissue may result in the attraction of leukocytes well known to respond to these mediators. Consistent with this idea, histological examination of RP3-expressing thyroids revealed infiltrations of inflammatory cells in the follicular lumen that morphologically resembled macrophages. In contrast, leukocytic infiltrates were absent from nontransgenic mouse thyroids. Immunohistochemical staining of these infiltrating cells using myeloid-specific markers revealed expression of CD11b- and F4/80-specific epitopes (Fig. 4, A and B), consistent with the presence of activated macrophages. These cells, however, did not express detectable levels of DEC-205, or Gr-1 (Fig. 4D and data not shown), a phenotype that would be characteristic of mature dendritic cells or granulocytes. Moreover, these infiltrated macrophages clearly contributed to the cytokine environment of the thyroid as indicated by the production of Il6 (Fig. 4C).
|
RP3-transgenic mice were originally developed on a B6C3F1 background and the reports of carcinoma incidence were specific for this background. In this strain, background expression of RP3 induced secondary hyperplasia in all mice and invasive carcinomas in
30% of the mice by 8 mo of age ( 22). Since thyroid malignancies did not progress in 100% of the RP3-transgenic mice in the mixed B6C3F1 background, we investigated the tumorigenic effects of RP3 expression on C3H/HeJ and C57BL/6 backgrounds. Accordingly, transgenic mice were backcrossed to C3H/HeJ for 10 generations and C57BL/6 for 2 generations and these new strains were referred to as C3H-RP3 and B6-RP3, respectively. Age-matched thyroids were removed from B6-RP3-negative transgenic littermates, C3H-RP3, and B6-RP3-transgenic mice and weighed to quantify tumor growth as a measure of cancer progression. The mean thyroid weight from B6-RP3 tissue was significantly greater than thyroids isolated from nontransgenic and C3H-RP3 thyroids (Fig. 5A). Indeed, unlike thyroid tissue from C3H-RP3 mice, thyroids from B6-RP3 mice were segregated into separate groups based on organ weight. One group was a similar size to C3H-RP3 thyroids while the other group was four times larger, on average, than C3H-RP3 thyroids (Fig. 5B). These two populations of B6-RP3 thyroid tumors were composed of one group of small thyroids weighing 0.02 g or less and a second group composed of large tumors weighing >0.02 g. The difference in thyroid weight between strains was highly significant (Fig. 5B). Gross morphological analysis of nontransgenic, C3H-RP3, B6-RP3 small, and B6-RP3 large thyroid tumors is shown in Fig. 6, B, D, F, and H. Histologically, the increased organ size was coincident with disruption of the normal thyroid follicular architecture by multifocal, poorly circumscribed proliferations of cells which formed packets or nests with occasional irregular lumina. These nests of cells distorted and compressed adjacent thyroid parenchyma. Furthermore, the cells within these nests demonstrated relatively distinct cytoplasmic margins with moderate nuclear pleomorphism in size and shape ranging from elongate-ovoid to plump and indented nuclei. The chromatin within these nuclei was finely stippled to coarsely clumped with occasional small nucleoli. Multifocal follicles contained rafts of exfoliated cells of similar morphology as well as macrophages (Fig. 6, A, C, E, and G). These features were especially evident in the B6-RP3 strain with follicular epithelial cells that developed solid-type thyroid carcinomas (Fig. 6G). Histologically, the group with small thyroid glands showed multifocal dilation of thyroid follicles typically composed of a single layer of epithelial cells attenuated to cuboidal morphology. However, occasional follicles were lined by multiple layers of crowded cuboidal to columnar epithelial cells that form papilliferous projections into the follicular center. Interestingly, in RP3 expressing, but not in control, glands mononuclear cells (stained positive for CD11b and F4/80) were located within the interstitium as well as throughout the section. Intralumenal rafts of mononuclear cells were more frequent in the group with larger thyroid glands then in the group with smaller glands.
|
|
Staining of thyroid sections for the monocytic marker CD11b revealed that all RP3-transgenic thyroid tumors were infiltrated with monocytic cells (Fig. 6, C, E, and G). Moreover, the anatomical localization of these infiltrates was consistently different in the progressing tumors compared with the smaller carcinomas (Fig. 7). We found that the CD11b+ cells were restricted to the interstitial areas between follicles in both C3H-RP3 and B6-RP3 small tumors (Figs. 6 and 7), whereas CD11b+ cells were mostly clustered in the colloid of the follicular lumen in B6-RP3 large tumors (Fig. 7). To help explain why these infiltrates develop, we measured the presence of proinflammatory cytokines in progressing tumors and in thyroid tissue from individual nontransgenic, C3H-RP3, or B6-RP3 mice. These tissues were analyzed for cytokine synthesis and Il6 and Cox2 were designated as a representative of this analysis (Fig. 8). The mean expression of Cox2 by B6-RP3 large tumors was significantly greater in comparison to nontransgenic, C3H-RP3, and B6-RP3 small thyroids (Fig. 8). Similarly, large B6-RP3-transgenic tumors expressed significantly more Il6 than other tumors examined (Fig. 8).
|
|
We were interested in assessing the extent of inflammatory cytokines produced by progressing thyroid tumors by examining the effects of RP3 on a tumor-prone (tumor suppressor-deficient) background. The differentiated thyroid tumors of RP3 mice do not progress further than solid subtype carcinoma and rarely invade the surrounding tissue ( 22). In contrast, RP3 mice that have been crossed onto the Trp53-/- genetic background frequently develop large invasive and poorly differentiated carcinomas ( 27). Tumors from these mice develop into large invasive carcinomas by 4 mo of age and continue to grow in SCID mice for up to 8 mo following transplantation ( 27). Thus, to assess the extent of cytokine synthesis at early stages of these poorly differentiated thyroid carcinomas, we measured the production of inflammatory cytokines by neoplastic thyroid tissue of 4- to 5-mo-old RP3p53-/- mice. Interestingly, rapidly progressing neoplasms derived from RP3p53-/- mice revealed significantly increased amounts of the tested cytokines compared with nontransgenic and RP3-transgenic tissue (Fig. 1). Not all cytokines were up-regulated however, since Kc/Gro
was expressed at the levels observed in RP3-transgenic mice.
Expression of cytokines in highly malignant thyroid tumors is restricted to regions of the tumor containing differentiated morphologies
RP3p53-/--transgenic mice develop tumors with a mixed phenotype containing differentiated and undifferentiated features that vary throughout the specimen and with the age of the tumor ( 27). For instance, RP3p53-/- tumors obtained from mice that were 36 mo old maintain RP3 expression and a differentiated papillary phenotype, whereas tumors from mice older than 6 mo fail to express RP3 and lose differentiated morphology as measured by the loss of thyroglobulin, thyroid peroxidase, and thyroid-stimulating hormone receptor expression ( 27). Similar to RP3 transgenic thyroids, immunohistochemical analysis revealed that Cox2 expression within RP3p53-/- tumors was restricted to regions that show differentiated follicular epithelial cell markers and expressed RP3 (Fig. 3, C and F). In contrast, neither RP3 nor Cox2 was detected in poorly differentiated sections of RP3p53-/- thyroid tumors (Fig. 3, C and F).
| Discussion |
|---|
|
|
|---|
B which leads to the synthesis and secretion of large amounts of inflammatory cytokines from thyrocytes ( 12). To extend these findings, we sought to analyze tissue from RP3 transgenics and in this study we have made an association among cytokine expression, oncogene expression, and tumor pathology. Oncogene expression is thought to precede or cause cellular transformation and may temporally overlap with the expression of various cytokines during the course of tumorigenesis. Although oncogene expression occurs within thyroid epithelium during the early stages of cancer, the notion that it was directly responsible for the reported cytokine induction, if other cell types participate in producing cytokines or if cytokine expression is functionally associated with thyroid tumor progression, was not previously tested in an animal model ( 16). The coincident expression of RET/PTC oncogenes in thyroid cancer ( 22, 32, 33) and autoimmune disease in humans provided a clue potentially linking the inflammation observed in each of these disorders with the pathophysiology of the disease. In addition, direct evidence of the role of RP3 in cytokine synthesis and inflammation was recently demonstrated following ectopic expression of RP3 in thyroid cells in culture ( 12). Thus, the capability of RP3 to induce expression of proinflammatory cytokines in cultured thyrocytes provided the preliminary framework to perform the present studies ( 12). However, deciphering the mechanism for this effect in vitro fails to accommodate the complexities of what occurs in vivo. To begin this comparison, we studied the effects of RP3 on the production of cytokines and the correlation with tumor progression in an animal model. We find that the effects of RP3 in vivo are consistent with our previous in vitro findings and suggest that a similar mechanism may be acting. We also found that additional factors come into play in vivo that cannot be studied in vitro, including the effects of strain background which we find is providing a modifier of the RP3 effects. Accordingly, we have found that, like studies using cultured cells expressing RP3, transgenic thyroid tissue from mice demonstrated expression of the cytokines and, surprisingly, unlike the effects of RP3 on cells in culture, the expression of cytokine RNA correlated with significant tissue expansion, leading to thyroid organs four times their physiological size. Accordingly, we suggest that the presence of these cytokines is capable of altering tumor progression and that these effects may occur only in the appropriate genetic background.
Leukocytic infiltration was common to all RP3-expressing thyroid tissue and absent from nontransgenic thyroid tissue consistent with a proinflammatory or "adjuvant" effect of RP3. The cells residing within thyroid follicles of large thyroid tumors expressed the myeloid markers CD11b and F4/80, a phenotype consistent with macrophages ( 34), a cell type known to secrete a variety of mediators contributing to the cytokine expression profile observed in RP3-transgenic thyroids ( 35). Indeed, intrafollicular macrophages, fibroblasts, and vascular endothelium produced Il6, whereas only Cox2 protein was found within thyroid epithelial cells, data consistent with the expression of RET/PTC proteins in PTC ( 29). Thus, the transformed thyroid microenvironment may be modeled as a complex mixture of resident thyroid epithelial cells producing chemokines that induce the infiltration of inflammatory cells, including activated macrophages, that respond to these mediators and secrete additional factors. The interplay between the inflammatory mediators produced by the organ and those produced by the responding inflammatory cells may accelerate tumor progression by promoting angiogenesis and encourage tumor cell growth through induction of antiapoptotic proteins or soluble growth factors.
The cytokines induced by RP3 may also mediate effects through the attraction of leukocytes that interact with nascent cancer and form the tumor stroma. The notion that early stages of cancer are dependent on the host (via interaction with leukocytes) at early stages of carcinogenesis has been previously postulated ( 36) and more recently shown using animal models ( 37, 38, 39). Likewise, in studies of methylcholanthrene-induced carcinomas, the role of host leukocytes in causing a paradoxical supporting, rather than inhibiting, role in tumor growth was referred to as a "lymphodependent" stage of cancer ( 40). In support of a similar host leukocyte-dependent stage of malignancy, the macrophages observed in the thyroid lumen of transgenic mice may provide a growth-enhancing effect from IL-6 secretion. Indeed, macrophage-derived IL-6 has been described as an autocrine growth factor for prostate and renal cell carcinoma and can promote prostate, brain, and breast tumor progression ( 41, 42, 43, 44). The contribution of the thyroid epithelium to the development of the cytokine milieu in the organ is illustrated by the expression of the cytoplasmic enzyme Cox2, which was produced by thyroid epithelium from RP3-transgenic but not normal mice ( 12). Not only an indicator of the direct proinflammatory effects of RP3, COX2 is abnormally expressed in human colorectal, gastric, lung, prostate, and squamous cell carcinoma and promotes colorectal and prostate tumor progression ( 45, 46, 47, 48, 49). Although, the functional role of cox2 in thyroid cancer is not known, it may signal the recruitment of macrophages and dendritic cells potentially activating anti-RP3 T cells. However, in this case, RP3-transgenic mice are tolerant to the epitopes generated from its processing ( 50), and thus the role of cytokines in influencing tumor progression appear to be independent from any potential endogenous tumor Ag-specific lymphocytic response in these transgenic mice.
In addition to the extrinsic factors produced in the tumor microenvironment, the malignant progression of thyroid cancers is also guided by intrinsic factors, as revealed by the alteration of the host genetic background ( 51). Consistent with this effect we show that tumor progression occurs more readily when oncogene expression coincides on a mixed C57BL/6 and C3H rather than on a pure C3H background suggesting that a genetic modifier may segragate these two mouse strains. Interestingly, analysis of C57BL/6 and C3H/HeJ mice has shown that C57BL/6 mice are also more susceptible to cell injury-induced inflammation caused by hyperoxia, indicating that reactive oxygen intermediates produced by inflammatory cells may be one of the host components influencing thyroid tumor progression ( 52).
These studies show that the expression of RP3 and the production of cytokines correlated with the progression of tumor growth and that this correlation only appeared on a "permissive" genetic background. These data suggest a dependency of tumor progression on specific host parameters, which may help to explain the variability of phenotype penetrance and tumor latency that exists in numerous oncogene-expressing animal models. Finding genetic modifiers through crosses of RP3 transgenics with mice null or transgenic for specific cytokine genes will provide better insight into the role(s) that these factors may play in promoting neoplastic progression. The positive contribution inflammatory cells make in enhancing the transition of transformed epithelium from hyperplasia to overt carcinoma has been illustrated in other tumor models by the use of mice harboring defects in cytokine signaling pathways ( 53). The consequences of RP3 oncogene-induced mediators on thyroid cell growth and differentiation may provide the framework for a biological process that determines when or if tumors expand and progress or simply remain as benign conditions. Understanding this difference may be the key to deciphering the link between cancer and inflammation.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jay L. Rothstein, Department of Microbiology/Immunology and Otolaryngology-Head and Neck Surgery, Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street, BLSB 909, Philadelphia, PA 19107. E-mail address: rothstei{at}lac.jci.tju.edu ![]()
3 Abbreviations used in this paper: PTC, papillary thyroid carcinoma; RP3, RET/PTC oncogene; Cox 2, cyclooxygenase 2; Mcp1, macrophage chemotactic protein 1; RP3, RET/PTC oncogene. ![]()
Received for publication August 1, 2003. Accepted for publication January 22, 2004.
| References |
|---|
|
|
|---|
. Mol. Cell. Biol. 16:2151.[Medline]
B at the crossroads of life and death. Nat. Immunol. 3:221.[Medline]
on human thyroid follicular cells. Acta Endocrinol. 127:220.
This article has been cited by other articles:
![]() |
R. Flavin, G. Jackl, S. Finn, P. Smyth, M. Ring, E. O'Regan, S. Cahill, K. Unger, K. Denning, Jinghuan Li, et al. RET/PTC Rearrangement Occurring in Primary Peritoneal Carcinoma International Journal of Surgical Pathology, June 1, 2009; 17(3): 187 - 197. [Abstract] [PDF] |
||||
![]() |
J. S. Pufnock and J. L. Rothstein Oncoprotein Signaling Mediates Tumor-Specific Inflammation and Enhances Tumor Progression J. Immunol., May 1, 2009; 182(9): 5498 - 5506. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mantovani Cancer-related Inflammation: The Seventh Hallmark of Cancer ASCO Educational Book, January 1, 2009; 2009(1): 723 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Burniat, L. Jin, V. Detours, N. Driessens, J.-C. Goffard, M. Santoro, J. Rothstein, J. E. Dumont, F. Miot, and B. Corvilain Gene Expression in RET/PTC3 and E7 Transgenic Mouse Thyroids: RET/PTC3 But Not E7 Tumors Are Partial and Transient Models of Human Papillary Thyroid Cancers Endocrinology, October 1, 2008; 149(10): 5107 - 5117. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J. Finn Cancer Immunology N. Engl. J. Med., June 19, 2008; 358(25): 2704 - 2715. [Full Text] [PDF] |
||||
![]() |
G. Gasparre, A. M. Porcelli, E. Bonora, L. F. Pennisi, M. Toller, L. Iommarini, A. Ghelli, M. Moretti, C. M. Betts, G. N. Martinelli, et al. Disruptive mitochondrial DNA mutations in complex I subunits are markers of oncocytic phenotype in thyroid tumors PNAS, May 22, 2007; 104(21): 9001 - 9006. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Santoro, R. M. Melillo, and A. Fusco RET/PTC activation in papillary thyroid carcinoma: European Journal of Endocrinology Prize Lecture. Eur. J. Endocrinol., November 1, 2006; 155(5): 645 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mesa Jr., M. Mirza, N. Mitsutake, M. Sartor, M. Medvedovic, C. Tomlinson, J. A Knauf, G. F. Weber, and J. A. Fagin Conditional Activation of RET/PTC3 and BRAFV600E in Thyroid Cells Is Associated with Gene Expression Profiles that Predict a Preferential Role of BRAF in Extracellular Matrix Remodeling. Cancer Res., July 1, 2006; 66(13): 6521 - 6529. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al. RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Weber, S. E. Choe, K. A. Dooley, N. N. Paffett-Lugassy, Y. Zhou, and L. I. Zon Mutant-specific gene programs in the zebrafish Blood, July 15, 2005; 106(2): 521 - 530. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |