The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, J. P.
Right arrow Articles by Rothstein, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, J. P.
Right arrow Articles by Rothstein, J. L.
The Journal of Immunology, 2004, 172: 4059-4067.
Copyright © 2004 by The American Association of Immunologists

Proinflammatory Mediators and Genetic Background in Oncogene Mediated Tumor Progression1

John P. Russell*, Julie B. Engiles{dagger} and Jay L. Rothstein2,*

* Departments of Microbiology/Immunology and Otolaryngology-Head and Neck Surgery, Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA 19107; and {dagger} Department of Pathobiology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RET/PTC3 (RP3) is an oncogenic fusion protein which is frequently expressed in papillary thyroid carcinomas and has been detected in thyroid tissue from patients diagnosed with Hashimoto’s thyroiditis. The constitutive activation of the tyrosine kinase domain in the carboxyl-terminal end of RP3 induces signaling pathways within thyrocytes and causes cellular transformation. One of the signaling pathways activated in RP3-expressing cells involves the activity of the transcription factor NF-{kappa}B and the production of downstream targets including GM-CSF and macrophage chemotactic protein 1. These factors are known to be immunostimulatory, making RP3 a molecular adjuvant and potentially promoting tissue-specific immunity. However compelling, these in vitro data do not reliably predict gene function in vivo or the cumulative effects of time-dependent processes such as angiogenesis, inflammation, or the influence of genetic background. To address these issues, we analyzed the production of proinflammatory mediators in mouse thyroid organs and demonstrate consistency with in vitro studies performed previously that Il1{alpha}, Il1{beta}, Il6, and Tnf{alpha} and the enzyme Cox2 are produced by RP3-transgenic thyroid tissue, but absent from nontransgenic thyroids. Furthermore, we find that that the genetic background of the host is important in the observed RP3-induced inflammation and tumor progression. These findings provide support for the notion that oncogene-induced cytokine secretion is important for the development and progression of thyroid carcinomas in genetically permissive hosts.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inflammatory cytokines produced by transformed epithelial cells or infiltrating leukocytes are known to positively influence tumor development by affecting angiogenesis, growth, survival, immune suppression, DNA damage, tumor suppression, and metastasis ( 1). In contrast, tumor-infiltrating leukocytes can negatively regulate tumor progression by producing cytostatic or cytotoxic molecules and induce the death of targeted cells. Although the association of leukocytes with cancer has been noted for decades, the molecular basis for this underlying cellular interaction is not well understood ( 2). One factor that must influence the relationship between cancer and leukocyte infiltration is the initiating oncogene since it directly controls pathways important for survival, growth, and/or death of the cancer cell. Oncogene expression may therefore be critical for promoting tumor progression by the activation of specific signaling pathways that not only include those that regulate autocrine growth factors or their receptors, but also those that influence the immune responses.

Much like other epithelial tumors, differentiated papillary thyroid carcinomas (PTC)3 frequently express dominant oncogenes that are thought to initiate the process of transformation leading to cancer ( 3). This is supported by evidence that shows that expression of the RET/PTC oncogene (RP3) in mice causes the development of differentiated carcinomas. In contrast, in vitro data describing the function of RET/PTC has not convincingly revealed evidence about how it manifests its oncogenic properties. For example, in vitro expression of RP3 in thyroid cells not only induces the loss of thyroid-stimulating hormone dependence and nuclear features characteristic of human PTC, but also induces apoptosis ( 4). Even though several tyrosine residues have been identified as critical for signaling, mutation of any one of them in vivo does not completely abrogate tumor formation ( 5), suggesting that multiple signaling pathways are required or that other factors come together to work in concert with RET/PTC to cause cancer. A major factor is the host’s contribution to the tumor microenvironment including angiogenesis, lymphangioenesis, stromal and immune reactions ( 5). Indeed, despite the overwhelming data to support a role of oncogenes in causing cancer, very little is known about how they influence the host microenvironment. To better understand how RET/PTC function leads to cancer, investigators have identified molecules that bind phosphorylated RET/PTC and activate downstream cascades ( 6, 7). The results of these studies indicate that this type of activation initializes one or more of several common signaling pathways including RAS/extracellular signal-regulated kinase, mitogen-activated protein kinase, c-Jun N-terminal kinase, and phosphatidylinositol 3-kinase/AKT that provide survival signals but also paradoxically induce apoptosis ( 8, 9). One pathway activated by the c-RET tyrosine kinase domain results in the activation of PI3K and the nuclear translocation of NF-{kappa}B ( 10). The NF-{kappa}B pathway is critical to tumor formation since it not only promotes cell survival via the expression of antiapoptotic proteins but also the transcription of many immune-related genes and proinflammatory cytokines that can influence tumor progression through the mobilization of host cells ( 11). Consistent with this model, we demonstrated that forced expression of the RET/PTC oncogene in thyrocyte cell lines causes nuclear translocation of NF-{kappa}B and the activation of proinflammatory mediators including macrophage chemotactic protein 1 (Mcp1) and G-CSF ( 12). This activation was critically dependent on the signaling function of RET/PTC since mutation of this property abrogated cytokine synthesis ( 12, 13). Furthermore, examination of tissue specimens from PTC has indicated the capability of tumor cells to secrete a wide variety of inflammatory cytokines, although in these studies the expression of RET/PTC was not assessed ( 14, 15, 16, 17).

Cytokine secretion by transformed thyrocytes may play a role in the development and progression of thyroid cancer. For instance, low level cytokine production by thyrocytes can directly stimulate, in a paracrine or autocrine fashion, the growth of thyroid cells ( 18, 19) via the secretion of Il1{alpha} (20), Il6 ( 21), or IL4 and IL10 (17). Moreover, previous work has demonstrated that RET/PTC3 (RP3) can directly induce the production of these and other inflammatory factors ( 12) and, when such cells are transplanted into mice, induce the attraction of activated macrophages. These and other data suggest that RP3-induced thyroid hyperplasia and carcinoma evokes multiple systems in vivo to manifest carcinogenic effects of RP3 ( 22). The consequence of this oncogene-induced cytokine secretion is to recruit leukocytes that secrete additional cytokines ( 12, 23, 24, 25). Although much is known about the capability of tumors or tumor cells to produce proinflammatory mediators at late stages of disease, little is known about how these factors may be available early in the process to promote the support and progression of transformed epithelial cells. In this study, we have expanded on the finding that the RP3 oncogene can induce inflammatory mediators in thyroid cells by measuring the effects of these mediators on tumors that develop in RP3-transgenic mouse strains. The study of oncogene function within an animal model provides important clues about the interactive role genes play during the earliest stages of cellular transformation and its progression into cancer.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

RP3, TRK-T1, and RP3p53-/--transgenic mice were constructed as previously described ( 22, 26, 27). All strains of mice were produced on a B6C3F1 background and were subsequently interbred with siblings. In some experiments, RP3-transgenic mice on a mixed B6C3F1 genetic background were backcrossed to C3H/HeJ for 10 generations (C3H/HeJ-TgN(RP3)1jlr) and backcrossed to C57BL/6 for 2 generations (C57BL/6-TgN(RP3)1jlr) and will be referred to herein as C3H-RP3 and B6-RP3, respectively. Thyroid weight was measured after organ exfirpation from mice to the nearest 0.01 g. In some cases, B6-RP3-transgenic thyroids were divided into a "small" (<=0.02 g) and "large" (>0.02 g) group based on an observed and calculated bimodal distribution of thyroid weights using Conover’s statistical analysis. Nontransgenic C57BL/6 and C3H/HeJ mice were purchased from Charles River Breeding Laboratories (Wilmington, MA). Mice were maintained at the Kimmel Cancer Institute animal facility.

RT-PCR analysis

For analysis of cytokine expression in nontransgenic, B6-RP3, TRK-T1, and RP3p53-/-mice. Five transgenic thyroids were examined individually for all strains except for nontransgenic thyroids in which case five pools of five thyroids were analyzed. For analysis of cytokine expression, nontransgenic, B6-RP3, and C3H-RP3 individual 2- to 4-mo-old age-matched thyroids from 7 RP3-negative transgenic littermates, 14 C3H-RP3, and 18 B6-RP3 mice were analyzed. Thyroid tissue was homogenized in 0.5 ml of cell lysis buffer (4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% sodium N-lauroylsarcosine, and 0.1 M 2-ME). Total RNA was extracted using phenol:chloroform (1:1) followed by ethanol precipitation. DNA was digested using RNase-free DNase (Ambion, Austin, TX). Five micrograms of DNase-digested total RNA was reverse transcribed using oligo(dT) primers with Superscript II (Invitrogen, Carlsbad, CA) to create cDNA from primed mRNA. As a representative of mRNA expression, the synthesized cDNA was amplified by PCR using primers specific for G3pdh for normalization or using primers specific for cytokines/chemokines. Previous work has shown that expression of cDNA represents ~33% of the mRNA expressed in the cells/tissues analyzed and thus represents a low or conservative estimate of the actual amount of mRNA for a given gene ( 28). PCR cycling was 94°C for 4 min, 1 cycle; 94°C for 30 s, 60°C for 30 s, 72°C for 60 s, 25 or 30 cycles; 72°C for 7 min, 1 cycle. G3pdh PCR was performed at 25 cycles while all other PCRs were performed at 30 cycles. The primers specific for mouse G3pdh (5' primer, CCTTCATTGACCTCAACTAC and 3' primer, ATGACAAGCTTCCCATTCTC), Il1{alpha} (5' primer, ACTTGTTTGAAGACCTAAAG and 3' primer, GTTTCAGAGGTTCTCAGAGA), Il1{beta} (5' primer, TGAGAGCATCCAGCTTCAAATCTC and 3' primer, CGCTTTTCCATCTTCTTCTTTGG), Il6 (5' primer, TTCCCTACTTCACAAGTCCGGA and 3' primer, TCCTTAGCCACTCCTTCTGTGACT), Mcp1 (5' primer, CACTCACCTGCTGCTACTCATTCA and 3' primer, GCTTGAGGTGGTTGTGGAAAAG), Tnf{alpha} (5' primer, AGGTTCTCTTCAAGGGACAAGGCT and 3' primer, AATGACTCCAAAGTAGACCTGCCC), Cox2 (5' primer, TGACTGTACCCGGACTGGATTCTA and 3' primer, TTTAAGTCCACTCCATGGCCCA) Gmcsf, (5' primer, TGGCTGCAGAATTTACTTTT and 3' primer, CCGTAGACCCTGCTCGAATA), and Kc, (5' primer, ATCCCAGCCACCCGCTCGCT and 3' primer, AGTGTGGCTATGACTTCGGT). Primers were used that specifically amplify the breakpoints of human RP3 (5' primer, TGGAGAAGAGGAGCTGTATC and 3' primer, CTTTCAGCATCTTCACGG) and TRK-T1 (5' primer, GCGGTGTTGCAGCAAGTCCT and 3' primer, CGATGATGTGGCCTTGGAGC). The sizes of the PCR products generated were: G3pdh, 100 bp; Il1{alpha}, 172 bp; Il1{beta}, 513 bp; Il6, 487 bp; Mcp1, 320 bp; Tnf{alpha}, 281 bp; Cox2, 525 bp; Gmcsf, 239; Kc, 200 bp; RP3, 310 bp; and TRK-T1, 590 bp. Negative control PCR were performed using cDNA from sham reverse-transcribed RNA. PCR products were resolved in 2% agarose gels by electrophoresis in TBE buffer (0.89 M Tris-borate, 0.89 M boric acid, 0.02 M EDTA, pH 8.3 ± 0.1) containing 0.5 µg/ml ethidium bromide and band intensities were quantified using the Bio-Rad Gel Doc and Quantity One densitometric program (Bio-Rad, Hercules, CA). Background gel values were subtracted and normalized according to values obtained for G3pdh products. Luminosity values of PCR products from a minimum of five thyroids were averaged and SE of mean calculated.

Immunohistochemistry

Immunohistochemical analysis of paraffin-embedded mouse thyroids was performed as previously described ( 26). Briefly, tissue was fixed in 10% Formalin for 24 h, desiccated in ethanol, embedded in liquid paraffin, and cooled to room temperature. Six-micrometer tissue sections were cut and placed onto glass slides treated with xylenes, to remove paraffin, hydrated, using decreasing concentrations of alcohol, and microwaved for 15 min in 100 mM citrate buffer (pH 6.0). Slides were treated with 10% goat serum for 15 min and incubated with primary Ab for 16 h at room temperature (primary Ab consisted of either a 1/3000 dilution of 5 µg/µl rabbit polyclonal anti-mouse Cox-2 (Cayman Chemicals, Ann Arbor, MI) or 1/200 dilution of 200 µg/ml rabbit polyclonal anti-tyrosine kinase domain of c-RET (Santa Cruz Biotechnology, Santa Cruz, CA)). Following Ab incubation, slides were washed twice with PBS for 5 min each, once with PBS/0.1% BSA, and incubated with biotin-labeled secondary Ab for 1 h at 25°C. Slides were washed as above and incubated with substrate according to the DAB Vectastain kit (Vector Laboratories, Burlingame, CA). Specimens were then counterstained with hematoxylin, dehydrated, and mounted. Where indicated, cryostat sections were used to phenotype the cellular infiltrate. Mouse thyroids were embedded in OCT solution and frozen in liquid nitrogen. Six-micrometer sections were dried for 1 h, fixed in ice-cold acetone for 20 min, allowed to dry for 2 h, and then stored at -20°C until use. Sections were thawed, refixed in cold acetone for 5 min, and then allowed to air dry for 10 min. Sections were then hydrated in PBS and prepared for staining as paraffin-embedded sections after a short microwave treatment, with the exception that primary Ab was incubated on sections for 1 h at room temperature. Frozen thyroid sections were stained with the following Abs at a dilution of 1/100: 500 µg/ml CD11b, 500 µg/ml Ly-6G (Gr-1), 500 µg/ml rat IgG2b (BD PharMingen, San Diego, CA); 200 µg/ml F4/80 (Caltag Laboratories, Burlingame, CA); 500 µg/ml Il6 (R&D Systems, Minneapolis, MN); or 100 µg/ml DEC-205 (Cedarlane Laboratories, Hornby, Ontario, Canada).

Western blot analysis

Thyroid tissue from nontransgenic, B6-RP3, TRK-T1, and RP3p53-/- was homogenized, and cell lysates were prepared in protein extract buffer (30 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% Triton X-100, 100 mM NaCl, and 1 mM PMSF) and stored at -70°C. Recombinant mouse Il6 was purchased from R&D Systems. Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. Membranes were blocked for 30 min in TBST buffer (20 mM Tris-HCl (pH 7.6), 135 mM NaCl, and 1% Tween 20) with 5% nonfat dry milk or 5% BSA and immunoblotted with either a 1/2000 dilution of 5 µg/µl rabbit anti-mouse Cox2-specific antisera (Cayman Chemicals) or a 1/1000 dilution of 0.2 µg/ml biotinylated goat anti-mouse Il6 antisera (R&D Systems) or a 1/500 dilution of anti-mouse/human G3PDH antisera (Trevigen, Gaithersburg, MD) for 16 h at 4°C. Following incubation, membranes were washed three times for 5 min in TBST buffer and treated with either HRP-conjugated donkey anti-rabbit IgG (Amersham, Piscataway, NJ) or Vectastain ABC (Vector Laboratories) for 1 h at room temperature. Membranes were washed, and the protein bands were visualized using ECL (Amersham) after exposure to x-ray film for 1–5 min.

Statistical analysis

The results of cytokine RT-PCR and the weights of mouse thyroids are presented as the mean ± SEM. Data comparing thyroid weights with cytokine production were analyzed using two nonparametric tests. One, the Wilcoxon rank sum analysis, was used to test for a change of median between groups and a second, Conover’s test for variability, for comparing multiple groups together. For both tests we used the exact form to allow for small sample sizes and the many duplicate weights. The p values reported are two tailed and are not corrected for multiple testing. Calculations were done using the StatXact software (Sytel Software) with the assistance of Dr. W. Hauck (Biostatistics Section, Kimmel Cancer Center)


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RP3, but not TRK-T1, oncogene-expressing thyroids synthesize proinflammatory cytokines

To determine whether the expression of the RP3 oncogene can specifically alter thyroid epithelial cell biology and cause the production of proinflammatory cytokines, nontransgenic and two thyroid oncogene-transgenic mouse strains (RP3 and TRK-T1) were examined for expression of selected proinflammatory cytokine RNA. RT-PCR analysis of RNA from thyroids of 3- to 8-mo-old transgenic or nontransgenic mice demonstrated that RP3 thyroids expressed Cox-2, Gmcsf, Il1{alpha}, Il1{beta}, Mcp1, Il6, and Tnf{alpha} RNA that was increased compared with TRK-T1 and nontransgenic thyroids (Fig. 1). To determine whether increases in proinflammatory cytokine RNA corresponded to an increase in protein, thyroid tissue from RP3, TRK-T1, or nontransgenic 4- to 6-mo-old age-matched mice were examined by Western blot for the expression of the cytokines Il6 and Cox2. Thyroid organs used for these studies had no evidence of neoplastic invasion of neighboring or underlying tissue as determined at the time of extirpation of the gland. In this case "invasion" was defined by attachment or invagination of the thyroid gland underlying mucosa. Vascular invasion was not evaluated since several whole organs were needed for each molecular analysis and thus microscopic examination of every specimen could not be accomplished. Although at 8 mo of age ~30% of susceptible mice (B6C3F1 mice) will develop invasive carcinoma ( 22), with the exception of two thyroids taken from control mice, the specimens used for these studies were not older than 6 mo of age. Tissue isolated from these mice was examined using Western blots and these data confirmed the induction of both Il6 and Cox2 protein in RP3 but not TRK-T1 or nontransgenic thyroids (Fig. 2).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. Examination of RP3-transgenic thyroid tissue for proinflammatory cytokine expression. A, cDNA made from pooled nontransgenic (Nontg) and individual RP3, TRK-T1, and RP3p53-/- thyroids was amplified with primers specific for the listed proinflammatory cytokines. A representative RT-PCR experiment is shown. In this experiment, all specimens were not age matched since two of the pooled control specimens were derived from mice 8 mo of age. All other data points were derived from thyroid tissue pooled from 3- to 6-mo-old mice. B, RNA expression was quantified by measuring proinflammatory cytokine band intensity relative to G3pdh band intensity. The data are the mean of five individual thyroids ± SEM, except for nontransgenic which represents five pools of five mice per pool. Significant differences in all cytokine, except Kc and Tnf{alpha}, RNA synthesis were found between nontransgenic or TRK-T1 and RP3 or RP3p53-/- transgenic thyroids (p < 0.01) using the Wilcoxon rank sum analysis. {square}, nontransgenic; , TRK-T1; {blacksquare}, RP3; , RP3p53-/-.

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Examination of RP3-transgenic thyroid tissue for expression of Il6 and Cox2. A representative Western blot of age-matched nontransgenic, RP3, TRK-T1, and RP3p53-/- thyroid tissue hybridized with antisera specific for Il6 (A) or Cox2 (B) proteins. Bands observed in the lanes containing nontransgenic (Nontg) protein are not the appropriate size for these molecules and nontransgenic specimens are negative for RNA for Il6 and Cox2 (see Fig. 1). Protein-loading controls (G3pdh) are shown below each panel.

 
Coordinate expression of inflammatory mediators and RP3 in differentiated carcinomas

The coexpression of inflammatory mediators with RP3 would support a cause-effect relationship like that found from in vitro studies ( 12). Thus, to evaluate the coincident expression of RP3 with a marker of inflammation, the protein Cox2 was used since it is an intracellular enzyme induced during thyroid inflammatory responses and can be localized to individual cells using immunohistochemical staining ( 29). Data in Fig. 3 show that Cox2 protein was detectable in RP3 thyroid tissues. Cox2 staining of the thyroid was not uniformly distributed within the organ but rather it was restricted to follicular epithelial cells (Fig. 3B). As expected, RP3 protein expression was similarly confined to epithelial cells (Fig. 3E), consistent with the specificity of the thyroglobulin promoter restricting the RNA expression of the RP3 transgene to these cells as previously described ( 22). The production of Cox2 was specific for RP3-expressing tissue since Cox2 was not detected in nontransgenic or TRK-T1-transgenic thyroid epithelium (Fig. 3, A, D, and G).



View larger version (101K):
[in this window]
[in a new window]
 
FIGURE 3. Immunohistochemical staining of follicular epithelial cells in RP3 and RP3p53-/- mouse thyroid tissue with antisera against Cox2 and RET kinase. A, Nontransgenic; B, E, and G, RP3; C and F, RP3p53-/-; and D, TRK-T1 paraffin-embedded mouse thyroid tissue. A–D, Mouse thyroid sections stained for Cox2; E and F, for RET kinase; or G, with an isotype control Ab. Magnification, x60.

 
Macrophage/immature dendritic cells are present in RP3-transgenic mouse thyroids

The presence of inflammatory cytokines in RP3-expressing thyroid tissue may result in the attraction of leukocytes well known to respond to these mediators. Consistent with this idea, histological examination of RP3-expressing thyroids revealed infiltrations of inflammatory cells in the follicular lumen that morphologically resembled macrophages. In contrast, leukocytic infiltrates were absent from nontransgenic mouse thyroids. Immunohistochemical staining of these infiltrating cells using myeloid-specific markers revealed expression of CD11b- and F4/80-specific epitopes (Fig. 4, A and B), consistent with the presence of activated macrophages. These cells, however, did not express detectable levels of DEC-205, or Gr-1 (Fig. 4D and data not shown), a phenotype that would be characteristic of mature dendritic cells or granulocytes. Moreover, these infiltrated macrophages clearly contributed to the cytokine environment of the thyroid as indicated by the production of Il6 (Fig. 4C).



View larger version (124K):
[in this window]
[in a new window]
 
FIGURE 4. RP3-transgenic thyroid stained with antisera against leukocytic markers. Serial RP3-transgenic thyroid sections stained with antisera specific for the following molecules: A, CD11b; B, F4/80; C, Il6; and D, IgG control. Magnification, x40.

 
Thyroid tumors in B6-RP3, but not C3H-RP3, mice progress to large sizes

RP3-transgenic mice were originally developed on a B6C3F1 background and the reports of carcinoma incidence were specific for this background. In this strain, background expression of RP3 induced secondary hyperplasia in all mice and invasive carcinomas in ~30% of the mice by 8 mo of age ( 22). Since thyroid malignancies did not progress in 100% of the RP3-transgenic mice in the mixed B6C3F1 background, we investigated the tumorigenic effects of RP3 expression on C3H/HeJ and C57BL/6 backgrounds. Accordingly, transgenic mice were backcrossed to C3H/HeJ for 10 generations and C57BL/6 for 2 generations and these new strains were referred to as C3H-RP3 and B6-RP3, respectively. Age-matched thyroids were removed from B6-RP3-negative transgenic littermates, C3H-RP3, and B6-RP3-transgenic mice and weighed to quantify tumor growth as a measure of cancer progression. The mean thyroid weight from B6-RP3 tissue was significantly greater than thyroids isolated from nontransgenic and C3H-RP3 thyroids (Fig. 5A). Indeed, unlike thyroid tissue from C3H-RP3 mice, thyroids from B6-RP3 mice were segregated into separate groups based on organ weight. One group was a similar size to C3H-RP3 thyroids while the other group was four times larger, on average, than C3H-RP3 thyroids (Fig. 5B). These two populations of B6-RP3 thyroid tumors were composed of one group of small thyroids weighing 0.02 g or less and a second group composed of large tumors weighing >0.02 g. The difference in thyroid weight between strains was highly significant (Fig. 5B). Gross morphological analysis of nontransgenic, C3H-RP3, B6-RP3 small, and B6-RP3 large thyroid tumors is shown in Fig. 6, B, D, F, and H. Histologically, the increased organ size was coincident with disruption of the normal thyroid follicular architecture by multifocal, poorly circumscribed proliferations of cells which formed packets or nests with occasional irregular lumina. These nests of cells distorted and compressed adjacent thyroid parenchyma. Furthermore, the cells within these nests demonstrated relatively distinct cytoplasmic margins with moderate nuclear pleomorphism in size and shape ranging from elongate-ovoid to plump and indented nuclei. The chromatin within these nuclei was finely stippled to coarsely clumped with occasional small nucleoli. Multifocal follicles contained rafts of exfoliated cells of similar morphology as well as macrophages (Fig. 6, A, C, E, and G). These features were especially evident in the B6-RP3 strain with follicular epithelial cells that developed solid-type thyroid carcinomas (Fig. 6G). Histologically, the group with small thyroid glands showed multifocal dilation of thyroid follicles typically composed of a single layer of epithelial cells attenuated to cuboidal morphology. However, occasional follicles were lined by multiple layers of crowded cuboidal to columnar epithelial cells that form papilliferous projections into the follicular center. Interestingly, in RP3 expressing, but not in control, glands mononuclear cells (stained positive for CD11b and F4/80) were located within the interstitium as well as throughout the section. Intralumenal rafts of mononuclear cells were more frequent in the group with larger thyroid glands then in the group with smaller glands.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 5. Weights of nontransgenic (Non-tg), C3H-RP3, and B6-RP3 thyroids. A, Mean thyroid weights derived from age-matched nontransgenic, C3H-RP3, and B6-RP3 mice ± SEM. B, Separation of B6-RP3 thyroids into two groups based on tumor size. B6-RP3 small thyroids were <=0.02 g while B6-RP3 large thyroids were >0.02 g. For data presented in both A and B, the thyroid weights were compared by two nonparametric tests. We first used the Wilcoxon rank sum analysis to test for a change of median. Using this statistic, the p values for comparisons between B6 and B6-RP6, B6 and B6-RP3, and B6-RP3 and C3H-RP3 were 0.030, 0.008, and 0.096, respectively. Since we recognized that at least part of the difference in weights between groups (especially in B6 mice) may be due to a subset of organs with high weights, we also compared the groups using Conover’s test for variability. In this case, p values were 0.096, 0.001, and <0.001 for C3H-RP3 vs B6-RP3 small, B6-RP3 small vs B6-RP3 small, and B6-RP3 large vs C3H-RP3, respectively. For both tests, we used the exact form to allow for small sample sizes and the many duplicate weights. The p values reported are two tailed and are not corrected for multiple testing. Calculations were done using the StatXact software (Sytel Software).

 


View larger version (112K):
[in this window]
[in a new window]
 
FIGURE 6. A comparison of age-matched nontransgenic, C3H-RP3, and B6-RP3 thyroids. A and B, Nontransgenic; C and D, C3H-RP3; E and F, B6-RP3 small; and G and H, B6-RP3 large thyroids were stained with an Ab specific for CD11b (A, C, E, and G). Representative thyroids from nontransgenic (B), C3H-RP3 (D), B6-RP3 small (F), and B6-RP3 large (H) mice. Magnification, x40.

 
RP3-transgenic thyroids have leukocytic infiltrates while the synthesis of proinflammatory cytokines is restricted to large B6-RP3 thyroids

Staining of thyroid sections for the monocytic marker CD11b revealed that all RP3-transgenic thyroid tumors were infiltrated with monocytic cells (Fig. 6, C, E, and G). Moreover, the anatomical localization of these infiltrates was consistently different in the progressing tumors compared with the smaller carcinomas (Fig. 7). We found that the CD11b+ cells were restricted to the interstitial areas between follicles in both C3H-RP3 and B6-RP3 small tumors (Figs. 6 and 7), whereas CD11b+ cells were mostly clustered in the colloid of the follicular lumen in B6-RP3 large tumors (Fig. 7). To help explain why these infiltrates develop, we measured the presence of proinflammatory cytokines in progressing tumors and in thyroid tissue from individual nontransgenic, C3H-RP3, or B6-RP3 mice. These tissues were analyzed for cytokine synthesis and Il6 and Cox2 were designated as a representative of this analysis (Fig. 8). The mean expression of Cox2 by B6-RP3 large tumors was significantly greater in comparison to nontransgenic, C3H-RP3, and B6-RP3 small thyroids (Fig. 8). Similarly, large B6-RP3-transgenic tumors expressed significantly more Il6 than other tumors examined (Fig. 8).



View larger version (113K):
[in this window]
[in a new window]
 
FIGURE 7. Infiltrated CD11b+leukocytes in thyroid tumors of B6-RP3 mice show anatomical differences in their location. Higher magnification of E and G from Fig. 6 showing CD11b staining for B6-RP3 small (A) and B6-RP3 large (B) thyroid specimens. Arrows point to regions of strongly CD11b+-stained cells within and around the thyroid follicle. Magnification, x60.

 


View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 8. Cox2 and Il6 expression in age-matched nontransgenic, C3H-RP3, and B6-RP3 small and B6-RP3 large thyroids. cDNA synthesized from nontransgenic (Non-tg) and individual C3H-RP3 and B6-RP3 small and B6-RP3 large thyroids was amplified with primers specific for either Cox2 (A) or Il6(B). RNA expression was quantified by measuring the intensity of cytokine-specific PCR products and normalizing these values to that of products derived from G3pdh. The data are the mean of 7 nontransgenic, 14 C3H-RP3, 11 B6-RP3 small, and 7 B6-RP3 large thyroids ± SEM. With the exception of C3H vs B6-RP3 small, comparison of the four mouse strains with the production of Cox2 or Il6 was statistically significant (<=0.001) using Conover’s test for variability ( 54 ).

 
Highly progressive thyroid tumors ectopically produce RNA for proinflammatory cytokines

We were interested in assessing the extent of inflammatory cytokines produced by progressing thyroid tumors by examining the effects of RP3 on a tumor-prone (tumor suppressor-deficient) background. The differentiated thyroid tumors of RP3 mice do not progress further than solid subtype carcinoma and rarely invade the surrounding tissue ( 22). In contrast, RP3 mice that have been crossed onto the Trp53-/- genetic background frequently develop large invasive and poorly differentiated carcinomas ( 27). Tumors from these mice develop into large invasive carcinomas by 4 mo of age and continue to grow in SCID mice for up to 8 mo following transplantation ( 27). Thus, to assess the extent of cytokine synthesis at early stages of these poorly differentiated thyroid carcinomas, we measured the production of inflammatory cytokines by neoplastic thyroid tissue of 4- to 5-mo-old RP3p53-/- mice. Interestingly, rapidly progressing neoplasms derived from RP3p53-/- mice revealed significantly increased amounts of the tested cytokines compared with nontransgenic and RP3-transgenic tissue (Fig. 1). Not all cytokines were up-regulated however, since Kc/Gro{alpha} was expressed at the levels observed in RP3-transgenic mice.

Expression of cytokines in highly malignant thyroid tumors is restricted to regions of the tumor containing differentiated morphologies

RP3p53-/--transgenic mice develop tumors with a mixed phenotype containing differentiated and undifferentiated features that vary throughout the specimen and with the age of the tumor ( 27). For instance, RP3p53-/- tumors obtained from mice that were 3–6 mo old maintain RP3 expression and a differentiated papillary phenotype, whereas tumors from mice older than 6 mo fail to express RP3 and lose differentiated morphology as measured by the loss of thyroglobulin, thyroid peroxidase, and thyroid-stimulating hormone receptor expression ( 27). Similar to RP3 transgenic thyroids, immunohistochemical analysis revealed that Cox2 expression within RP3p53-/- tumors was restricted to regions that show differentiated follicular epithelial cell markers and expressed RP3 (Fig. 3, C and F). In contrast, neither RP3 nor Cox2 was detected in poorly differentiated sections of RP3p53-/- thyroid tumors (Fig. 3, C and F).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although numerous studies have described the production of inflammatory cytokines from freshly isolated solid tumors or from cell lines, the mechanism driving this activation has not been elucidated ( 16). Furthermore, since these mediators can have both host and cell autonomous effects, the biological significance of tumor-derived cytokine synthesis is not clear. Reports describing the production of cytokines by thyroid tumor cells ( 14, 24, 25, 30, 31) cannot distinguish whether this reflects a process coincident with early stages of tumorigenesis or a process that developed as a consequence of the late stages of malignancy. Additionally, the analysis of tumor cell lines following in vitro culture may reflect the activation of genes from factors in culture medium (e.g., serum) or from accumulated mutations which occur following long periods of continuous growth. Although cytokine expression may reflect the need of tumor cells to produce factors enabling autocrine growth and survival, few studies have shown the activation of this property during the onset of tumor development. To address this, we have developed a system to study the mechanism connecting immunity to cancer by investigating the cell signaling properties of the well-described thyroid oncogene RET/PTC. We have previously demonstrated that a kinase functioning, but not a signaling deficient mutant of RP3, can directly induce the nuclear translocation of NF-{kappa}B which leads to the synthesis and secretion of large amounts of inflammatory cytokines from thyrocytes ( 12). To extend these findings, we sought to analyze tissue from RP3 transgenics and in this study we have made an association among cytokine expression, oncogene expression, and tumor pathology.

Oncogene expression is thought to precede or cause cellular transformation and may temporally overlap with the expression of various cytokines during the course of tumorigenesis. Although oncogene expression occurs within thyroid epithelium during the early stages of cancer, the notion that it was directly responsible for the reported cytokine induction, if other cell types participate in producing cytokines or if cytokine expression is functionally associated with thyroid tumor progression, was not previously tested in an animal model ( 16). The coincident expression of RET/PTC oncogenes in thyroid cancer ( 22, 32, 33) and autoimmune disease in humans provided a clue potentially linking the inflammation observed in each of these disorders with the pathophysiology of the disease. In addition, direct evidence of the role of RP3 in cytokine synthesis and inflammation was recently demonstrated following ectopic expression of RP3 in thyroid cells in culture ( 12). Thus, the capability of RP3 to induce expression of proinflammatory cytokines in cultured thyrocytes provided the preliminary framework to perform the present studies ( 12). However, deciphering the mechanism for this effect in vitro fails to accommodate the complexities of what occurs in vivo. To begin this comparison, we studied the effects of RP3 on the production of cytokines and the correlation with tumor progression in an animal model. We find that the effects of RP3 in vivo are consistent with our previous in vitro findings and suggest that a similar mechanism may be acting. We also found that additional factors come into play in vivo that cannot be studied in vitro, including the effects of strain background which we find is providing a modifier of the RP3 effects. Accordingly, we have found that, like studies using cultured cells expressing RP3, transgenic thyroid tissue from mice demonstrated expression of the cytokines and, surprisingly, unlike the effects of RP3 on cells in culture, the expression of cytokine RNA correlated with significant tissue expansion, leading to thyroid organs four times their physiological size. Accordingly, we suggest that the presence of these cytokines is capable of altering tumor progression and that these effects may occur only in the appropriate genetic background.

Leukocytic infiltration was common to all RP3-expressing thyroid tissue and absent from nontransgenic thyroid tissue consistent with a proinflammatory or "adjuvant" effect of RP3. The cells residing within thyroid follicles of large thyroid tumors expressed the myeloid markers CD11b and F4/80, a phenotype consistent with macrophages ( 34), a cell type known to secrete a variety of mediators contributing to the cytokine expression profile observed in RP3-transgenic thyroids ( 35). Indeed, intrafollicular macrophages, fibroblasts, and vascular endothelium produced Il6, whereas only Cox2 protein was found within thyroid epithelial cells, data consistent with the expression of RET/PTC proteins in PTC ( 29). Thus, the transformed thyroid microenvironment may be modeled as a complex mixture of resident thyroid epithelial cells producing chemokines that induce the infiltration of inflammatory cells, including activated macrophages, that respond to these mediators and secrete additional factors. The interplay between the inflammatory mediators produced by the organ and those produced by the responding inflammatory cells may accelerate tumor progression by promoting angiogenesis and encourage tumor cell growth through induction of antiapoptotic proteins or soluble growth factors.

The cytokines induced by RP3 may also mediate effects through the attraction of leukocytes that interact with nascent cancer and form the tumor stroma. The notion that early stages of cancer are dependent on the host (via interaction with leukocytes) at early stages of carcinogenesis has been previously postulated ( 36) and more recently shown using animal models ( 37, 38, 39). Likewise, in studies of methylcholanthrene-induced carcinomas, the role of host leukocytes in causing a paradoxical supporting, rather than inhibiting, role in tumor growth was referred to as a "lymphodependent" stage of cancer ( 40). In support of a similar host leukocyte-dependent stage of malignancy, the macrophages observed in the thyroid lumen of transgenic mice may provide a growth-enhancing effect from IL-6 secretion. Indeed, macrophage-derived IL-6 has been described as an autocrine growth factor for prostate and renal cell carcinoma and can promote prostate, brain, and breast tumor progression ( 41, 42, 43, 44). The contribution of the thyroid epithelium to the development of the cytokine milieu in the organ is illustrated by the expression of the cytoplasmic enzyme Cox2, which was produced by thyroid epithelium from RP3-transgenic but not normal mice ( 12). Not only an indicator of the direct proinflammatory effects of RP3, COX2 is abnormally expressed in human colorectal, gastric, lung, prostate, and squamous cell carcinoma and promotes colorectal and prostate tumor progression ( 45, 46, 47, 48, 49). Although, the functional role of cox2 in thyroid cancer is not known, it may signal the recruitment of macrophages and dendritic cells potentially activating anti-RP3 T cells. However, in this case, RP3-transgenic mice are tolerant to the epitopes generated from its processing ( 50), and thus the role of cytokines in influencing tumor progression appear to be independent from any potential endogenous tumor Ag-specific lymphocytic response in these transgenic mice.

In addition to the extrinsic factors produced in the tumor microenvironment, the malignant progression of thyroid cancers is also guided by intrinsic factors, as revealed by the alteration of the host genetic background ( 51). Consistent with this effect we show that tumor progression occurs more readily when oncogene expression coincides on a mixed C57BL/6 and C3H rather than on a pure C3H background suggesting that a genetic modifier may segragate these two mouse strains. Interestingly, analysis of C57BL/6 and C3H/HeJ mice has shown that C57BL/6 mice are also more susceptible to cell injury-induced inflammation caused by hyperoxia, indicating that reactive oxygen intermediates produced by inflammatory cells may be one of the host components influencing thyroid tumor progression ( 52).

These studies show that the expression of RP3 and the production of cytokines correlated with the progression of tumor growth and that this correlation only appeared on a "permissive" genetic background. These data suggest a dependency of tumor progression on specific host parameters, which may help to explain the variability of phenotype penetrance and tumor latency that exists in numerous oncogene-expressing animal models. Finding genetic modifiers through crosses of RP3 transgenics with mice null or transgenic for specific cytokine genes will provide better insight into the role(s) that these factors may play in promoting neoplastic progression. The positive contribution inflammatory cells make in enhancing the transition of transformed epithelium from hyperplasia to overt carcinoma has been illustrated in other tumor models by the use of mice harboring defects in cytokine signaling pathways ( 53). The consequences of RP3 oncogene-induced mediators on thyroid cell growth and differentiation may provide the framework for a biological process that determines when or if tumors expand and progress or simply remain as benign conditions. Understanding this difference may be the key to deciphering the link between cancer and inflammation.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants CA-21124, CA-76259 (to J.L.R.), and T32-CA09678 (to J.P.R.) and Abbott Laboratories. Back

2 Address correspondence and reprint requests to Dr. Jay L. Rothstein, Department of Microbiology/Immunology and Otolaryngology-Head and Neck Surgery, Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street, BLSB 909, Philadelphia, PA 19107. E-mail address: rothstei{at}lac.jci.tju.edu Back

3 Abbreviations used in this paper: PTC, papillary thyroid carcinoma; RP3, RET/PTC oncogene; Cox 2, cyclooxygenase 2; Mcp1, macrophage chemotactic protein 1; RP3, RET/PTC oncogene. Back

Received for publication August 1, 2003. Accepted for publication January 22, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Balkwill, F., A. Mantovani. 2001. Inflammation and cancer: back to Virchow?. Lancet 357:539.[Medline]
  2. Mantovani, A., B. Bottazzi, F. Colotta, S. Sozzani, L. Ruco. 1992. The origin and function of tumor-associated macrophages. Immunol. Today 13:265.[Medline]
  3. Hunter, T.. 1997. Oncoprotein networks. Cell 88:333.[Medline]
  4. Portella, G., D. Vitagliano, C. Borselli, R. M. Melillo, D. Salvatore, J. L. Rothstein, G. Vecchio, A. Fusco, M. Santoro. 1999. Human N-ras, TRK-T1, and RET/PTC3 oncogenes, driven by a thyroglobulin promoter, differently affect the expression of differentiation markers and the proliferation of thyroid epithelial cells. Oncol. Res. 11:421.[Medline]
  5. Buckwalter, T. L., A. Venkateswaran, M. Lavender, K. M. La Perle, J. Y. Cho, M. L. Robinson, S. M. Jhiang. 2002. The roles of phosphotyrosines-294, -404, and -451 in RET/PTC1-induced thyroid tumor formation. Oncogene 21:8166.[Medline]
  6. Durick, K., V. J. Yao, M. G. Borrello, I. Bongarzone, M. A. Pierotti, S. S. Taylor. 1995. Tyrosines outside the kinase core and dimerization are required for the mitogenic activity of RET/ptc2. J. Biol. Chem. 270:24642.[Abstract/Free Full Text]
  7. Borrello, M. G., L. Alberti, E. Arighi, I. Bongarzone, C. Battistini, A. Bardelli, B. Pasini, C. Piutti, M. G. Rizzetti, P. Mondellini, M. T. Radice, M. A. Pierotti. 1996. The full oncogenic activity of Ret/ptc2 depends on tyrosine 539, a docking site for phospholipase C{gamma}. Mol. Cell. Biol. 16:2151.[Medline]
  8. Takahashi, M.. 2001. The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev. 12:361.[Medline]
  9. Manie, S., M. Santoro, A. Fusco, M. Billaud. 2001. The RET receptor: function in development and dysfunction in congenital malformation. Trends Genet. 17:580.[Medline]
  10. Hayashi, H., M. Ichihara, T. Iwashita, H. Murakami, Y. Shimono, K. Kawai, K. Kurokawa, Y. Murakumo, T. Imai, H. Funahashi, et al 2000. Characterization of intracellular signals via tyrosine 1062 in RET activated by glial cell line-derived neurotrophic factor. Oncogene 19:4469.[Medline]
  11. Karin, M., A. Lin. 2002. NF-{kappa}B at the crossroads of life and death. Nat. Immunol. 3:221.[Medline]
  12. Russell, J. P., S. Shinohara, R. M. Melillo, M. D. Castellone, M. Santoro, J. L. Rothstein. 2003. Tyrosine kinase oncoprotein, RET/PTC3, induces the secretion of myeloid growth and chemotactic factors. Oncogene 22:4569.[Medline]
  13. Knauf, J. A., H. Kuroda, S. Basu, J. A. Fagin. 2003. RET/PTC-induced dedifferentiation of thyroid cells is mediated throught Y1062 signaling through SHC-RAS-MAP kinase. Oncogene 22:4406.[Medline]
  14. Yoshida, A., T. Asaga, C. Masuzawa, S. Kawahara, S. Yanoma, M. Harada, T. Okamoto. 1994. Production of cytokines by thyroid carcinoma cell lines. J. Surg. Oncol. 55:104.[Medline]
  15. Aust, G., W. A. Scherbaum. 1996. Expression of cytokines in the thyroid: thyrocytes as potential cytokine producers. Exp. Clin. Endocrinol. Diabetes 104:64.
  16. Rasmussen, A. K.. 2000. Cytokine actions on the thyroid gland. Dan. Med. Bull. 47:94.[Medline]
  17. Stassi, G., M. Todaro, M. Zerilli, L. Ricci-Vitiani, D. Di Liberto, M. Patti, A. Florena, F. Di Gaudio, G. Di Gesu, R. De Maria. 2003. Thyroid cancer resistance to chemotherapeutic drugs via autocrine production of interleukin-4 and interleukin-10. Cancer Res. 63:6784.[Abstract/Free Full Text]
  18. Rasmussen, A. K., K. Bendtzen, U. Feldt-Rasmussen. 2000. Thyrocyte-interleukin-1 interactions. Exp. Clin. Endocrinol. Diabetes 108:67.[Medline]
  19. Deuss, U., M. Buscema, H. Schumacher, W. Winkelmann. 1992. In vitro effects of tumor necrosis factor-{alpha} on human thyroid follicular cells. Acta Endocrinol. 127:220.
  20. Zeki, K., Y. Nakano, N. Inokuchi, K. Watanabe, I. Morimoto, U. Yamashita, S. Eto. 1993. Autocrine stimulation of interleukin-1 in the growth of human thyroid carcinoma cell line NIM 1. J. Clin. Endocrinol. Metab. 76:127.[Abstract]
  21. Basolo, F., R. Giannini, C. Monaco, R. M. Melillo, F. Carlomagno, M. Pancrazi, G. Salvatore, G. Chiappetta, F. Pacini, R. Elisei, et al 2002. Potent mitogenicity of the RET/PTC3 oncogene correlates with its prevalence in tall-cell variant of papillary thyroid carcinoma. Am. J. Pathol. 160:247.[Abstract/Free Full Text]
  22. Powell, D. J., Jr, J. Russell, K. Nibu, G. Li, E. Rhee, M. Liao, M. Goldstein, W. M. Keane, M. Santoro, A. Fusco, J. L. Rothstein. 1998. The RET/PTC3 oncogene: metastatic solid-type papillary carcinomas in murine thyroids. Cancer Res. 58:5523.[Abstract/Free Full Text]
  23. Scarpino, S., A. Stoppacciaro, F. Ballerini, M. Marchesi, M. Prat, M. C. Stella, S. Sozzani, P. Allavena, A. Mantovani, L. P. Ruco. 2000. Papillary carcinoma of the thyroid: hepatocyte growth factor (HGF) stimulates tumor cells to release chemokines active in recruiting dendritic cells. Am. J. Pathol. 156:831.[Abstract/Free Full Text]
  24. Yoshida, M., H. Matsuzaki, K. Sakata, M. Takeya, K. Kato, S. Mizushima, M. Kawakita, K. Takatsuki. 1992. Neutrophil chemotactic factors produced by a cell line from thyroid carcinoma. Cancer Res. 52:464.[Abstract/Free Full Text]
  25. Tohyama, K., Y. Yoshida, K. Ohashi, E. Sano, H. Kobayashi, K. Endo, M. Naruto, T. Nakamura. 1992. Production of multiple growth factors by a newly established human thyroid carcinoma cell line. Jpn. J. Cancer Res. 83:153.[Medline]
  26. Russell, J. P., D. J. Powell, M. Cunnane, A. Greco, G. Portella, M. Santoro, A. Fusco, J. L. Rothstein. 2000. The TRK-T1 fusion protein induces neoplastic transformation of thyroid epithelium. Oncogene 19:5729.[Medline]
  27. Powell, D. J., Jr, J. P. Russell, G. Li, B. A. Kuo, V. Fidanza, K. Huebner, J. L. Rothstein. 2001. Altered gene expression in immunogenic poorly differentiated thyroid carcinomas from RET/PTC3(p53-/-) mice. Oncogene 20:3235.[Medline]
  28. Rothstein, J. L., D. Johnson, J. Jessee, J. Skowronski, J. A. DeLoia, D. Solter, B. B. Knowles. 1993. Construction of primary and subtracted cDNA libraries from early embryos. Methods Enzymol. 225:587.[Medline]
  29. Cornetta, A. J., J. P. Russell, M. Cunnane, W. M. Keane, J. L. Rothstein. 2002. Cyclooxygenase-2 expression in human thyroid carcinoma and Hashimoto’s thyroiditis. Laryngoscope 112:238.[Medline]
  30. Oka, Y., T. Kobayashi, S. Fujita, N. Matsuura, S. Okamoto, H. Asakawa, A. Murata, T. Mori. 1993. Establishment of a human anaplastic thyroid cancer cell line secreting granulocyte colony-stimulating factor in response to cytokines. In Vitro Cell Dev. Biol. Anim. 29A:537.[Medline]
  31. Enomoto, T., H. Sugawa, D. Inoue, M. Miyamoto, S. Kosugi, T. Takahashi, N. Kitamura, I. Yamamoto, J. Konishi, T. Mori, et al 1990. Establishment of a human undifferentiated thyroid cancer cell line producing several growth factors and cytokines. Cancer 65:1971.[Medline]
  32. Santoro, M., G. Chiappetta, A. Cerrato, D. Salvatore, L. Zhang, G. Manzo, A. Picone, G. Portella, G. Santelli, G. Vecchio, A. Fusco. 1996. Development of thyroid papillary carcinomas secondary to tissue- specific expression of the RET/PTC1 oncogene in transgenic mice. Oncogene 12:1821.[Medline]
  33. Jhiang, S. M., J. E. Sagartz, Q. Tong, J. Parker-Thornburg, C. C. Capen, J. Y. Cho, S. Xing, C. Ledent. 1996. Targeted expression of the ret/PTC1 oncogene induces papillary thyroid carcinomas. Endocrinology 137:375.[Abstract]
  34. Ajuebor, M. N., R. J. Flower, R. Hannon, M. Christie, K. Bowers, A. Verity, M. Perretti. 1998. Endogenous monocyte chemoattractant protein-1 recruits monocytes in the zymosan peritonitis model. J. Leukocyte Biol. 63:108.[Abstract]
  35. Mantovani, A.. 1994. Tumor-associated macrophages in neoplastic progression: a paradigm for the in vivo function of chemokines. Lab. Invest. 71:5.[Medline]
  36. Nicolson, G. L.. 1993. Cancer progression and growth: relationship of paracrine and autocrine growth mechanisms to organ preference of metastasis. Exp. Cell Res. 204:171.[Medline]
  37. Seung, L. P., S. K. Seung, H. Schreiber. 1995. Antigenic cancer cells that escape immune destruction are stimulated by host cells. Cancer Res. 55:5094.[Abstract/Free Full Text]
  38. Seung, L. P., D. A. Rowley, P. Dubey, H. Schreiber. 1995. Synergy between T-cell immunity and inhibition of paracrine stimulation causes tumor rejection. Proc. Natl. Acad. Sci. USA 92:6254.[Abstract/Free Full Text]
  39. Pekarek, L. A., B. A. Starr, A. Y. Toledano, H. Schreiber. 1995. Inhibition of tumor growth by elimination of granulocytes. J. Exp. Med. 181:435.[Abstract/Free Full Text]
  40. Prehn, R. T.. 1977. Immunostimulation of the lymphodependent phase of neoplastic growth. J. Natl. Cancer Inst. 59:1043.
  41. Smith, P. C., A. Hobisch, D. L. Lin, Z. Culig, E. T. Keller. 2001. Interleukin-6 and prostate cancer progression. Cytokine Growth Factor Rev. 12:33.[Medline]
  42. Angelo, L. S., M. Talpaz, R. Kurzrock. 2002. Autocrine interleukin-6 production in renal cell carcinoma: evidence for the involvement of p53. Cancer Res. 62:932.[Abstract/Free Full Text]
  43. Neumark, E., M. A. Cohn, E. Lukanidin, I. P. Witz, A. Ben-Baruch. 2002. Possible co-regulation of genes associated with enhanced progression of mammary adenocarcinomas. Immunol. Lett. 82:111.[Medline]
  44. Sasaki, A., S. Ishiuchi, T. Kanda, M. Hasegawa, Y. Nakazato. 2001. Analysis of interleukin-6 gene expression in primary human gliomas, glioblastoma xenografts, and glioblastoma cell lines. Brain Tumor Pathol. 18:13.[Medline]
  45. Hida, T., Y. Yatabe, H. Achiwa, H. Muramatsu, K. Kozaki, S. Nakamura, M. Ogawa, T. Mitsudomi, T. Sugiura, T. Takahashi. 1998. Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res. 58:3761.[Abstract/Free Full Text]
  46. Ristimaki, A., N. Honkanen, H. Jankala, P. Sipponen, M. Harkonen. 1997. Expression of cyclooxygenase-2 in human gastric carcinoma. Cancer Res. 57:1276.[Abstract/Free Full Text]
  47. Eberhart, C. E., R. J. Coffey, A. Radhika, F. M. Giardiello, S. Ferrenbach, R. N. DuBois. 1994. Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas. Gastroenterology 107:1183.[Medline]
  48. Chan, G., J. O. Boyle, E. K. Yang, F. Zhang, P. G. Sacks, J. P. Shah, D. Edelstein, R. A. Soslow, A. T. Koki, B. M. Woerner, et al 1999. Cyclooxygenase-2 expression is up-regulated in squamous cell carcinoma of the head and neck. Cancer Res. 59:991.[Abstract/Free Full Text]
  49. Nose, F., T. Ichikawa, M. Fujiwara, I. Okayasu. 2002. Up-regulation of cyclooxygenase-2 expression in lymphocytic thyroiditis and thyroid tumors: significant correlation with inducible nitric oxide synthase. Am. J. Clin. Pathol. 117:546.[Abstract/Free Full Text]
  50. Powell, D. J., Jr, L. C. Eisenlohr, J. L. Rothstein. 2003. A thyroid tumor-specific antigen formed by the fusion of two self-proteins. J. Immunol. 170:861.[Abstract/Free Full Text]
  51. Wynford-Thomas, D.. 1997. Origin and progression of thyroid epithelial tumours: cellular and molecular mechanisms. Horm. Res. 47:145.[Medline]
  52. Cho, H. Y., A. E. Jedlicka, S. P. Reddy, T. W. Kensler, M. Yamamoto, L. Y. Zhang, S. R. Kleeberger. 2002. Role of NRF2 in protection against hyperoxic lung injury in mice. Am. J. Respir. Cell Mol. Biol. 26:175.[Abstract/Free Full Text]
  53. Lin, E. Y., A. V. Nguyen, R. G. Russell, J. W. Pollard. 2001. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J. Exp. Med. 193:727.[Abstract/Free Full Text]
  54. Conover, W.. 1980. Practical Nonparametric Statistics Wiley, New York.



This article has been cited by other articles:


Home page
INT J SURG PATHOLHome page
R. Flavin, G. Jackl, S. Finn, P. Smyth, M. Ring, E. O'Regan, S. Cahill, K. Unger, K. Denning, Jinghuan Li, et al.
RET/PTC Rearrangement Occurring in Primary Peritoneal Carcinoma
International Journal of Surgical Pathology, June 1, 2009; 17(3): 187 - 197.
[Abstract] [PDF]


Home page
J. Immunol.Home page
J. S. Pufnock and J. L. Rothstein
Oncoprotein Signaling Mediates Tumor-Specific Inflammation and Enhances Tumor Progression
J. Immunol., May 1, 2009; 182(9): 5498 - 5506.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
A. Mantovani
Cancer-related Inflammation: The Seventh Hallmark of Cancer
ASCO Educational Book, January 1, 2009; 2009(1): 723 - 726.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Burniat, L. Jin, V. Detours, N. Driessens, J.-C. Goffard, M. Santoro, J. Rothstein, J. E. Dumont, F. Miot, and B. Corvilain
Gene Expression in RET/PTC3 and E7 Transgenic Mouse Thyroids: RET/PTC3 But Not E7 Tumors Are Partial and Transient Models of Human Papillary Thyroid Cancers
Endocrinology, October 1, 2008; 149(10): 5107 - 5117.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
O. J. Finn
Cancer Immunology
N. Engl. J. Med., June 19, 2008; 358(25): 2704 - 2715.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Gasparre, A. M. Porcelli, E. Bonora, L. F. Pennisi, M. Toller, L. Iommarini, A. Ghelli, M. Moretti, C. M. Betts, G. N. Martinelli, et al.
Disruptive mitochondrial DNA mutations in complex I subunits are markers of oncocytic phenotype in thyroid tumors
PNAS, May 22, 2007; 104(21): 9001 - 9006.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. Santoro, R. M. Melillo, and A. Fusco
RET/PTC activation in papillary thyroid carcinoma: European Journal of Endocrinology Prize Lecture.
Eur. J. Endocrinol., November 1, 2006; 155(5): 645 - 653.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Mesa Jr., M. Mirza, N. Mitsutake, M. Sartor, M. Medvedovic, C. Tomlinson, J. A Knauf, G. F. Weber, and J. A. Fagin
Conditional Activation of RET/PTC3 and BRAFV600E in Thyroid Cells Is Associated with Gene Expression Profiles that Predict a Preferential Role of BRAF in Extracellular Matrix Remodeling.
Cancer Res., July 1, 2006; 66(13): 6521 - 6529.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al.
RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. J. Weber, S. E. Choe, K. A. Dooley, N. N. Paffett-Lugassy, Y. Zhou, and L. I. Zon
Mutant-specific gene programs in the zebrafish
Blood, July 15, 2005; 106(2): 521 - 530.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, J. P.
Right arrow Articles by Rothstein, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, J. P.
Right arrow Articles by Rothstein, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS