The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ria, F.
Right arrow Articles by Adorini, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ria, F.
Right arrow Articles by Adorini, L.
The Journal of Immunology, 2004, 172: 3447-3453.
Copyright © 2004 by The American Association of Immunologists

Selection of Similar Naive T Cell Repertoires but Induction of Distinct T Cell Responses by Native and Modified Antigen1

Francesco Ria*,§, Alexandra Gallard{dagger}, Claudia Raja Gabaglia{ddagger}, Jean-Charles Guéry{dagger}, Eli E. Sercarz{ddagger} and Luciano Adorini2,*

* BioXell, Milano, Italy; {dagger} Institut National de la Santé et de la Recherche Médicale Unité 563, Hôpital Purpan, Toulouse, France; {ddagger} Torrey Pines Institute for Molecular Studies, San Diego, CA 92121; and § Institute of General Pathology, Catholic University, Rome, Italy


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To study the T cell responses induced by native and modified Ag, we have followed in vivo TCR selection and cytokine profile of T cells, as well as the isotype of induced Abs, in response to the model Ag hen egg-white lysozyme (HEL) and its reduced and carboxymethylated form (RCM-HEL). RCM-HEL induces in vivo a T cell response focused on the same immunodominant determinant characterizing the response to native HEL, but further skewed to the Th1 pathway. No difference between HEL and RCM-HEL could be observed in the efficiency of processing, nor in the type of APCs involved. In vivo experiments show that coimmunization with HEL and RCM-HEL generates distinct Th2 or Th1 responses in naive mice, but the two forms of Ag expand the same HEL-specific public clonotype, characterized by the V{beta}8.2-J{beta}1.5 rearrangement, indicating that the populations of naive T cells activated by the two Ag forms overlap. T cells primed by RCM-HEL are restimulated by soluble HEL in vivo, but divert the phenotype of the HEL-specific response to Th1, implying that priming of naive T cells by a structurally modified Ag can induce Th1-type memory/effector T cells more efficiently than native Ag.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Upon cognate interaction with APCs, Ag-specific naive CD4+ T cells differentiate into two subsets, characterized by distinct patterns of cytokine secretion. Th1 cells secrete IFN-{gamma}, TNF-{alpha}, and IL-2, and induce, in the mouse, B cell switching to IgG2a and IgG2b isotype production. Th2 cells secrete, among other cytokines, IL-4 and IL-5, and promote a B cell switch to IgG1 and IgE (1). Several factors contribute to determining the Th1 or Th2 dominance. The type of Ag and the adjuvant used (2, 3, 4), the dose and route of administration (5, 6, 7, 8), and the type of APC involved in T cell priming (9) all play a role in the polarization of T cell responses. Other key factors are the genetic background (10), the affinity of antigenic determinants for the MHC and the TCR (11), the previous immunological history (12), and the cytokine and chemokine milieu in which T cell priming occurs (13).

The factors influencing the strength of the TCR-ligand interaction and their relationship to the intracellular signals that drive the differentiation to Th1 or Th2 cells are now becoming better understood (14). A high density of Ag-MHC complexes on the surface of the APC, owing to high affinity of the peptide for the MHC molecule (15), or to a TCR with high affinity for a given Ag-MHC complex would favor the generation of a Th1 response. Conversely, TCR-Ag/MHC interactions characterized by a lower affinity or a low ligand density promote Th2 differentiation (11), possibly by limiting the duration of peptide/MHC-TCR interactions (16). Altered peptide ligands, peptides modified in their TCR-contacting residues, have been used both in human and model studies for the therapy of autoimmune diseases, and have been shown to modulate the Th phenotype in vivo by acting as TCR antagonists, as partial agonists, or by inducing regulatory T cells (17). Modification of side chains in antigenic proteins has also been shown to alter the Th cell phenotype of the immune response (18).

The polarization of pathogen-specific CD4 T cell responses strongly influences the resistance and susceptibility to many infectious diseases, and inappropriate vaccine strategies may exacerbate rather than protect against subsequent infection, as shown in individuals vaccinated with formalin-inactivated respiratory syncytial virus (19). Thus, understanding how the form of Ag may influence the polarization of T cell responses could be useful in vaccine development, in which the ability to selectively induce Ag-specific memory/effector T cells of the appropriate phenotype would be advantageous. Indeed, previous work has shown that chemically modified protein Ag can be used to selectively elicit Th1-dominated responses (20). Because B cells have been implicated in the induction and maintenance of Th2 responses (21, 22), designing recombinant protein vaccines that lack B cell cross-reactivity with native Ag could favor the induction of effector/memory Th1 cells. We have tested this possibility in the hen egg-white lysozyme (HEL)3 model, in which the reduced and carboxymethylated form of this protein (RCM-HEL) induces a cross-reactive T cell, but a noncross-reactive B cell response to the native HEL (23).

In the present study, we show that HEL and RCM-HEL prime the same population of specific T cells, characterized by the TCR rearrangement V{beta}8.2-J{beta}1.5, but induce distinct Th1 responses. The enhanced Th1 response induced by RCM-HEL compared with HEL may be relevant for vaccine design.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and Ags

Two-month-old female BALB/c, C3H, and CBA mice (Charles River Breeding Laboratories, Calco, Italy) were used. HEL was purchased from Sigma-Aldrich (St. Louis, MO) and recrystallized three times. RCM-HEL was prepared by reduction of HEL in a 8 M urea with 100-fold molar excess of 2-ME, followed by treatment with iodoacetic acid (23). Synthetic peptides were prepared, as previously described (24).

Immunizations and T cell proliferation

Mice were immunized s.c. into the hind footpads with different amounts (from 0.01 to 10 nmol/mouse) of native HEL or RCM-HEL, emulsified in CFA or IFA (Difco, Detroit, MI), or in water. Popliteal lymph nodes were harvested 8–12 days after immunization, and lymph node cells (LNCs) were seeded in 96-well plates (Costar, Cambridge, MA) at 5 x 105 cells/well in the presence of graded concentration of Ag. In all experiments, the culture medium was RPMI 1640 (Life Technologies, Basel, Switzerland), supplemented with 2 mM L-glutamine, 50 µM 2-ME, 50 µg/ml gentamicin (Sigma-Aldrich), and 10% FCS (Life Technologies). Forty-eight hours later, Ag-specific T cell proliferation was assessed by [3H]thymidine incorporation.

Cytokine quantification

Cytokine concentration was quantified in pooled supernatants from triplicate cultures, as previously described (7, 25). All mAbs, except anti-IFN-{gamma}, were purchased from BD PharMingen (San Diego, CA). The anti-IFN-{gamma} mAb used for capture was AN.18.17.24, and the mAb used for detection was peroxidase-conjugated XMG1.2, as previously described (25). In some experiments, IL-2 was also measured by measuring the proliferation of IL-2-sensitive CTLL-2 cells, seeded at 5 x l04 cells/well in 96-well plates for 24 h. Cytokines were quantified in duplicate from three to four titration points using standard curves generated by purified recombinant mouse cytokines (IFN-{gamma} and IL-4 from Hoffmann-LaRoche (Nutley, NJ), and IL-2 from BD PharMingen).

ELISPOT assays

IFN-{gamma}- and IL-4-producing cells were enumerated by a cellular ELISPOT assay, as described (26). Briefly, LNCs (5 x 106/ml) were cultured for 48 h in 24-well plates with the indicated Ag. Millititer hemagglutinin nitrocellulose plates (Millipore, Bedford, MA) were coated overnight at 4°C with anti-IFN-{gamma} or anti-IL-4 Ab. Plates were blocked, and Ag-stimulated cells were added at different concentrations for 24 h at 37°C. The wells were then incubated with biotin-conjugated anti-IFN-{gamma} or anti-IL-4 Ab, followed by incubation with avidin-peroxidase (Vector Laboratories, Burlingame, CA). Spots were developed by the addition of 400 µg/ml 3-amino-9-ethylcarbazole substrate (Sigma-Aldrich) and enumerated by a computerized image analysis system (Lightools Research, Encinitas, CA) using the image analyzer program National Institutes of Health Image 1.61 (National Institutes of Health, Bethesda, MD).

Detection of HEL- and RCM-HEL-specific Abs

Abs specific for HEL and RCM-HEL were quantified in mouse serum, as described (7). Briefly, mice were immunized, as described above, and bled 15 days later. HEL- or RCM-HEL-coated polyvinyl microtiter plates (Falcon 3012) were incubated with serially diluted sera in PBS-Tween for 90 min at 37°C. Plates were then washed and incubated with a mixture or individual biotin-conjugated, goat anti-mouse Abs specific for IgM, IgG1, IgG2a, IgG2b, and IgG3 isotypes (100 ng/ml each). The bound Abs were revealed with alkaline phosphatase-conjugated streptavidin (Jackson ImmunoResearch Laboratories, Avondale, PA). Standard curves were generated using pooled anti-HEL antisera, and the results are expressed as arbitrary units per milliliter (U/ml, 1 U corresponding to 50% of maximum OD).

TCR repertoire analysis

Repertoire analysis was performed using a modification of a previously described protocol (27). LNCs were cultured for 3 days in HL-1 medium (BioWhittaker, Walkersville, MD) in the presence or absence of HEL or RCM-HEL. Total RNA was isolated from cell suspensions using RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. cDNA was synthesized using an oligo(dT) primer (dT15) (Life Technologies). From each cDNA, PCR were then performed using a V{beta}8.2 primer (CATTATTCATATGGTGCTGGC) and a common C{beta} primer (CACTGATGTTCTGTGTGACA). Using 2 µl of this product as a template, runoff reactions were performed with a single internal fluorescent primer for each J{beta} tested. These products were then denatured in formamide and analyzed on an Applied Biosystems (Foster City, CA) 310 Prism using Gene-scan 2.0 software.

Quantitative transcript analysis

Public V{beta}8.2-J{beta}1.5 rearrangement quantification was performed by real-time quantitative RT-PCR using an ABI Prism 5700 sequence BioDetector (Applied Biosystems), as previously described (28, 29). Briefly, total RNA was extracted and reverse transcribed. Primers and probes included: V{beta}8.2 sense, 5'-ATCCATTATTCATATGGTGCTGGC-3'; J{beta}1.5 antisense, 5'-AGTCCCCTCTCCAAAAAGCG-3'; V{beta}8.2-J{beta}1.5 complementarity-determining region 3 (CDR3)-specific probe FAM-5'-GCGGTACAGGGAACAACCAGGCT-3'-TAMRA; TCR {beta}-chain antisense, 5'-GTGAGCCCTCTGGCCACTT-3'; TCR {beta}-chain probe, FAM-5'-TCCTCCTGTGAAAGCCCATGGAACTG-3'-TAMRA. Transcripts for TCR {beta}-chain CDR3 motifs and for TCR {beta}-chain C regions were determined in the same samples for normalization. Data were expressed as the ratio of public CDR3 over TCR {beta}-chain mRNA copies.

Enrichment of APC populations

The Ag-presenting activity of lymph node APCs was measured using as readout the T cell hybridomas 1H11.3 (I-Ed, HEL108–116) (30) and 2G12.1 (I-Ad, {beta}2-microglobulin 26–39) (24). APC populations were enriched from popliteal LNCs, as previously described (12, 25). Briefly, T cell-depleted LNCs were separated into low and high buoyancy density populations by centrifugation over a discontinuous Percoll (Pharmacia Biotech, Uppsala, Sweden) gradient containing a 55% layer. High buoyancy cells were shown to contain small B cells. Low buoyancy cells were separated by MiniMACS columns (Miltenyi Biotec GmBH, Bergisch Gladbach, Germany) using CD11c-specific microbeads, coated with the Ab N418. The negatively separated fraction was enriched in large B cells, while the positive fraction was enriched in N418+ dendritic cells (DCs). Alternatively, the low buoyancy cells were first sorted with MiniMACS columns using CD8{alpha}-specific microbeads to enrich for lymphoid DCs. The negative fraction was then purified with CD11c-specific microbeads to obtain a population enriched in myeloid DCs. The APC population enrichment was checked by cytofluorimetry using a FACScan flow cytometer (BD Biosciences, Mountain View, CA) equipped with Lysis II software. CD11c positively sorted cells were between 85 and 95% N418+ cells, in agreement with previous data (12, 25). Low buoyancy, CD8{alpha}-selected populations usually contained 65% N418+ cells.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HEL and RCM-HEL induce in vivo cross-reactive T cells and noncross-reactive B cells

Irrespective of the form of Ag used for immunization, HEL and RCM-HEL are completely cross-reactive in the restimulation of T cell proliferation in vitro (Fig. 1A), in agreement with previous data (23). In the BALB/c mouse, the T cell response of mice immunized with HEL is dominated by the recognition of the immunodominant determinant located in the region 108–116, with a subdominant epitope spanning residues 9–25 (30). The T cell response of LNCs from BALB/c mice immunized with RCM-HEL shows a fine specificity superimposable to that induced by HEL (Fig. 1B), suggesting the engagement of overlapping T cell populations by both Ag forms. Notably, no additional HEL epitopes are recognized following priming of H-2d mice with RCM-HEL, and the fine specificity of the response to HEL is maintained irrespective of the carboxymethylation at Cys115 of the dominant epitope in the priming Ag, whereas the subdominant epitope located in the region 9–25 does not contain any Cys residue, and therefore is not modified by reduction and carboxymethylation. Conversely, Abs against HEL fail to recognize RCM-HEL and vice versa (Fig. 1C), as expected (23).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. HEL and RCM-HEL generate cross-reactive T cells and noncross-reactive Ab responses. BALB/c mice were immunized into the hind footpad with 1 nmol of HEL or RCM-HEL in CFA. Ag-specific T cell proliferation of draining LNCs and HEL- and RCM-HEL-specific Ab titers in the sera were measured, as described in Materials and Methods. The results are from one representative experiment of four performed. A, T cell proliferative response of HEL-primed (left panel) and RCM-HEL-primed (right panel) mice stimulated in vitro with graded concentrations of HEL (open symbols) or RCM-HEL (filled symbols). The average response of three mice/group is shown. B, Epitope mapping of the T cell response to RCM-HEL. Peptide sequences eliciting a response in LNCs from RCM-HEL-primed mice are indicated. C, HEL- and RCM-HEL-specific Ab titers detected in the sera of individual mice immunized with HEL (open symbols) or RCM-HEL (filled symbols).

 
RCM-HEL, compared with HEL, primes for an enhanced Th1 response

LNCs from mice immunized with HEL secrete lower IFN-{gamma} and higher IL-4 levels compared with cells from RCM-HEL-primed mice following in vitro restimulation with either HEL or RCM-HEL (Fig. 2A). This is paralleled by a significantly lower number of Ag-activated IFN-{gamma}-producing cells and a significantly higher number of IL-4-producing T cells in mice immunized with HEL compared with RCM-HEL, as determined by ELISPOT assays (Fig. 2B). The distinct pattern of cytokine secretion is mirrored by the isotype of Ag-specific serum Abs (Fig. 2C). Anti-HEL Abs are predominantly of IgG1 isotype, while this isotype is much less abundant among RCM-HEL-specific Abs. Abs of IgG2a isotype are relatively low in both cases. The difference in IgG1 isotype distribution further indicates that denaturation of HEL skews the in vivo response toward the Th1 pathway.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2. HEL and RCM-HEL induce a Th2- or Th1-dominated response. BALB/c mice were immunized, as described in the legend to Fig. 1. Open and filled symbols refer to mice immunized with HEL or RCM-HEL, respectively. The results are from one representative experiment of four performed. A, Ag-induced IFN-{gamma} and IL-4 production by pooled LNCs obtained from mice immunized with HEL or RCM-HEL (n = 3). LNCs were stimulated in vitro with the indicated concentrations of HEL (upper panels) or RCM-HEL (lower panels). Seventy-two hours later, supernatants were harvested and IFN-{gamma} and IL-4 concentrations were measured by two-site ELISA. B, IFN-{gamma}- and IL-4-producing cells were measured by ELISPOT assay. Data are mean ± SE from eight individual mice per group, immunized s.c. with 1 nmol of HEL ({square}) or RCM-HEL () in CFA. Cells were restimulated in vitro with 1 µM RCM-HEL. *, p < 0.05 by Student’s t test. C, Ag-specific serum IgGl and IgG2a Ab isotypes produced by four to five individual mice immunized with HEL or RCM-HEL.

 
The enhanced Th1 response induced by RCM-HEL compared with HEL is independent from the dose of Ag and the adjuvant used for priming. In the experiments reported in Fig. 3, we compared the responses to HEL and RCM-HEL obtained by immunizing BALB/c mice with different doses of Ag either emulsified in different adjuvants (CFA or IFA) or administered without adjuvant, in soluble form. In all cases, enhanced IFN-{gamma} and reduced IL-4 production, indicative of a skewing to the Th1 pattern, could be observed in LNCs from mice immunized with RCM-HEL compared with HEL and restimulated in vitro with HEL, irrespective of the adjuvant used and even in the absence of adjuvant. This pattern of cytokine secretion was consistent with the drastically reduced (>90%) levels of Ag-specific IgG1 Abs (data not shown). It could be suggested that the chemical modification of HEL results in the generation of additional epitopes that preferentially drive Th1 responses. However, HEL and RCM-HEL are completely cross-reactive in the restimulation of T cell proliferation in vitro (Fig. 1A). In addition, the epitope mapping reported in Fig. 1B shows that the epitopes generated by HEL and RCM-HEL are superimposable, without new HEL epitopes generated by priming with RCM-HEL, supporting the view that the modification of the Th1/Th2 response does not reflect an epitope shift. An enhanced Th1 response to RCM-HEL compared with HEL was also observed in C3H and CBA mice, both of H-2k haplotype, as demonstrated by the increased IFN-{gamma} secretion as well as by the selective production of RCM-HEL-specific Abs of the IgG2a isotype (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. RCM-HEL skews the immune response toward Th1, independent of Ag dose and type of adjuvant used. BALB/c mice (three/group) were immunized s.c. with the indicated amounts of HEL ({square}) or RCM-HEL ({blacksquare}) in water (soluble) or emulsified in CFA or in IFA. IFN-{gamma} and IL-4 secretion by pooled LNCs was measured by two-site ELISA.

 
HEL and RCM-HEL are presented by the same APCs in vivo

The results described above may suggest that RCM-HEL is presented by an APC type able to drive naive T cells preferentially toward the Th1 phenotype. Reduction and carboxymethylation of HEL profoundly alter its three-dimensional structure, as shown by the inability of HEL-specific Abs to recognize RCM-HEL. Importantly, it adds eight new carboxymethyl groups that strongly modify its solubility. These modifications might favor presentation of RCM-HEL by APCs different from those involved in the presentation of HEL, as hypothesized to explain the shift toward Th1 obtained by maleylation of protein Ags (18).

By using the HEL108–116/I-Ed-specific T cell hybridoma 1H11.3 as a readout, both HEL and RCM-HEL injected s.c. into BALB/c mice were found to be presented in the draining lymph nodes predominantly by DCs rather than B cells (Fig. 4, A and B), consistent with our previous observations on HEL presentation (12, 25). Mouse CD8{alpha}+ and CD8{alpha}- DCs have been reported to selectively induce Th1 and Th2 cells, respectively (31). Therefore, we examined whether RCM-HEL was preferentially presented in vivo by CD8{alpha}+ DCs. Mice were injected s.c. with 10 nmol of either HEL or RCM-HEL emulsified in IFA, and 5 days later the presentation of antigenic complexes by enriched populations of CD8{alpha}+ or CD8{alpha}- DCs from the draining lymph nodes was compared. By using the procedures described in Materials and Methods, CD8{alpha}- DCs were enriched to 85 or 95% N418+ cells, in cells from RCM-HEL- and HEL-primed mice, respectively, whereas the CD8{alpha}+ fraction contained 65% N418+ cells, both in RCM-HEL- and HEL-primed mice. Both CD8{alpha}+ and CD8{alpha}- DCs, from either HEL- or RCM-HEL-primed mice, activated the 1H11.3 T cell hybridoma. The lower T cell activation by APCs bearing antigenic complexes derived from RCM-HEL compared with HEL reflects the lower efficiency of RCM-HEL to activate the readout hybridoma (data not shown), rather than the absolute number of peptide-MHC complexes displayed by APCs. CD8{alpha}-, compared with CD8{alpha}+ DCs, were ~3-fold more efficient APCs, irrespective of the Ag form administered (Fig. 4, C and D). In contrast, the intrinsic Ag-presenting capacity of the two DC subsets was similar, as shown by their ability to present equally well the endogenous, naturally processed {beta}2-microglobulin peptide to the T cell hybridoma 2G12.1 (Fig. 4, E and F).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. HEL and RCM-HEL are presented by the same APCs in vivo. BALB/c mice were immunized with 10 nmol/mouse of Ag in IFA into the hind footpads, and 5 days later APCs from popliteal lymph nodes were enriched, as described in Materials and Methods. The presence of peptide/MHC complexes on the APC surface was detected using as readout the T cell hybridoma 1H11.3, specific for HEL108–116/I-Ed. A and B, Graded numbers of DCs (squares) and large B cells (diamonds) purified from draining lymph nodes of HEL (A)- and RCM-HEL (B)-immunized mice were tested for expression of peptide/MHC complexes. IL-2 secretion from 5 x 104 T hybridoma cells was measured by CTLL-2 proliferation. C–F, Both CD8{alpha}- and CD8{alpha}+ DCs present HEL- and RCM-HEL-derived peptide. CD8{alpha}- (triangles) and CD8{alpha}+ (squares) DCs were enriched, as described in Materials and Methods, from mice immunized with HEL (open symbols) or RCM-HEL (filled symbols). Cell numbers refer to the actual number of N418+ cells/well. IL-2 secretion by T cell hybridoma (in the absence of in vitro added Ag) was measured by two-site ELISA. C and D, Ag-induced IL-2 secretion by HEL-specific hybridoma 1H11.3. E and F, Ability of the same CD8{alpha}- and CD8{alpha}+ DCs shown in C to stimulate the T cell hybridoma 2G12.1, specific for the naturally processed endogenous peptide {beta}2-microglobulin 26–39/I-Ad.

 
The HEL-specific public clonotype V{beta}8.2-J{beta}1.5 is expanded in mice immunized with RCM-HEL

The T cell response to HEL in the BALB/c mouse is consistently associated with the expansion of a public TCR repertoire characterized by the V{beta}8.2-J{beta}1.5 rearrangement, specific for HEL107–116/I-Ed (32). This repertoire has been shown to be specifically associated with Th1 cells in mice immunized with HEL in CFA (27, 33). Therefore, if HEL and RCM-HEL activate overlapping populations of T cells, the same public repertoire should be expanded by immunization with both Ags. To answer this question, the expansion of the public V{beta}8.2-J{beta}1.5 clonotype was determined in these different Ag-stimulated CD4+ T cell populations by CDR3-length spectroscopy, and quantified by fluorogenic PCR (28, 29) directly ex vivo or after in vitro stimulation.

Using CDR3 fragment length analysis, a similar expansion of the public repertoire was observed in mice primed with HEL or RCM-HEL. Fig. 5A shows the BV8S2-J1S5 CDR3 length distribution obtained in one representative mouse (of six mice/group tested) ex vivo or after in vitro restimulation with HEL, RCM-HEL, or the peptide encompassing the immunodominant epitope 103–117. Irrespective of the form of Ag used for immunization, the BV8S2-J1S5 public clonotypic cells are expanded equally well by every form of Ag tested. To quantify more precisely the number of clonotypic cells, we used a quantitative fluorogenic PCR. As shown in Fig. 5B, HEL restimulation of LNCs from mice immunized with RCM-HEL or HEL resulted in the expansion of the public clonotype to a similar frequency. Notably, RCM-HEL supported to the same extent the expansion in vitro of clonotypic cells obtained from mice immunized with HEL or RCM-HEL. Surprisingly, native HEL and the peptide 103–117 stimulated the proliferation of T cells characterized by usage of the public V{beta}8.2-J{beta}1.5 clonotype more effectively when the T cells were obtained from mice immunized with RCM-HEL. Therefore, T cells obtained from mice immunized with RCM-HEL appear to have a peculiar ability to cross-recognize heteroclitically native HEL and the derived peptide 103–117, indicating that immunization with a structurally altered Ag can generate an immune response that is more effective in the recognition of the native Ag than priming with the native Ag itself. Alternatively, the increased proliferation could be explained by the enhanced Th1 differentiation induced by RCM-HEL. Although naive T cells bearing the HEL-specific V{beta}8.2-J{beta}1.5 public rearrangement can be efficiently primed in vivo by RCM-HEL, we cannot exclude that LNCs from RCM-HEL-immunized mice may also contain distinct population(s) of CD4+ T cells that specifically recognize the modified protein.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 5. The public repertoire V{beta}8.2-J{beta}1.5 is expanded in mice immunized with HEL and RCM-HEL. BALB/c mice (six mice/group) were immunized with 3 nmol of HEL or RCM-HEL in CFA, as indicated in Materials and Methods. LNCs from HEL- or RCM-HEL-immunized mice were used directly ex vivo or stimulated for 3 days with 1 µM indicated Ags. cDNA was prepared from purified CD4+ T cells. Expansion of the public clonotype (A) and frequency of TCR {beta}-chain transcripts bearing the HEL107–116/I-Ed-specific V{beta}8.2-J{beta}1.5 rearrangement (B) were quantified by CDR3 fragment length analysis and fluorogenic PCR, respectively, as described in Materials and Methods. A, CDR3 fragment length analysis of T cells obtained from one representative mouse per group. B, Fluorogenic assessment of the frequency of the V{beta}8.2-J{beta}1.5 transcript ex vivo and after in vitro stimulation of LNC obtained from mice immunized with HEL ({square}) or RCM-HEL ({blacksquare}). The SE for each group is indicated.

 
HEL and RCM-HEL generate distinct Ab responses in naive mice, but RCM-HEL primes for a dominant Th1-type response

The lack of cross-reactivity between Abs against HEL and RCM-HEL offers the possibility to follow in vivo, in mice simultaneously immunized with both Ag forms, the Ab isotypes specific for each of them. Mice were immunized with a fixed amount of HEL (0.1 nmol/mouse) together with RCM-HEL at ratios varying from 1:10 (1 nmol) to 10:1 (0.01 nmol), or with the same amounts of RCM-HEL alone. One group of HEL-primed mice was simultaneously treated with IL-12. Fifteen days later, mice were bled, and IgG1 and IgG2a Abs, specific for either HEL or RCM-HEL, were measured (Fig. 6A). Mice that had received 0.1 nmol of HEL and 0.01 nmol of RCM-HEL did not respond to RCM-HEL, as mice immunized with 0.01 nmol of RCM-HEL alone, and the expected IgG1-IgG2a ratio of 12 was observed in response to HEL. Mice primed with HEL plus IL-12 had a response dominated by IgG2a (IgG1-IgG2a ratio 0.39), as expected (34). When the amounts of HEL and RCM-HEL administered were sufficient, the generation of two independent responses was observed. The response to HEL was clearly dominated by IgG1 (IgG1-IgG2a ratio >11), independently from the amount of RCM-HEL coinjected. Similarly, the response to RCM-HEL retained a Th1-dominated phenotype, without a significant increase in the RCM-HEL-specific, Th2-dependent IgG1 Ab response (Fig. 6A).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 6. HEL or RCM-HEL generate independent responses when coinjected, whereas a previous immunization with RCM-HEL diverts the response to HEL toward Th1. A, BALB/c mice (three mice/group) were immunized s.c. with 0.1 nmol of HEL and graded amounts of RCM-HEL (from 0.01 to 1 nmol/mouse) or with 10 µg of IL-12 in CFA, as indicated. The titers of HEL- and RCM-HEL-specific IgG1 ({square}) and IgG2a ({blacksquare}) Abs were measured 15 days later. As controls, the results obtained immunizing mice with 0.1 or 1 nmol/mouse of RCM-HEL alone in CFA or with 0.1 nmol of HEL plus IL-12 are shown. Mice immunized with 0.01 nmol of RCM-HEL did not produce measurable amounts of specific Abs. The ratios between specific IgG1 and IgG2a for each group are reported in brackets. B, BALB/c mice (three mice/group) were immunized s.c. with the indicated amount of 0.1 nmol of HEL or RCM-HEL, or with CFA only. Thirty days later, mice received i.p., where indicated, 100 µg of HEL in PBS. After a further 7 days, HEL-specific IgG1 ({square}) and IgG2a ({blacksquare}) were measured, as indicated in the legend to Fig. 1. The ratios between specific IgG1 and IgG2a for each group are shown in brackets. Values of p were determined by Student’s t test; n.s., not significant.

 
In contrast with the two independent Ab responses induced in naive mice, the presence of an already established Th1 response specific for RCM-HEL is able to divert the primary Ab response to HEL from a Th2 to a Th1 isotype pattern. As shown in Fig. 6B, the B cell response to HEL in mice previously immunized with RCM-HEL is significantly skewed to the Th1 phenotype, reflecting the pre-existing RCM-HEL-specific response. Therefore, primed T cells specific for RCM-HEL are restimulated by HEL-derived peptide/MHC complexes, presented mostly by B cells (35), secrete Th1-type cytokines, and promote an Ig switch to Th1-dependent isotypes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have analyzed the effects of a structural modification in a protein Ag on TCR repertoire selection and developmental pathways of CD4+ cells. RCM-HEL, despite a pronounced alteration of its three-dimensional structure, was presented in vivo by the same APC populations as HEL, induced in vivo the expansion of the public T cell clonotype characterized by the BV8S2-J1S5 rearrangement, typical of HEL107–116-specific CD4+ T cells, but elicited a response further polarized to the Th1 pathway compared with HEL.

The ability of some Ags to preferentially induce a Th1 or Th2 response has been attributed either to epitope density on the APCs or to their ability to engage different APC types. Among professional APCs, DCs have been shown to be critical for T cell priming (36, 37) and, in the mouse, CD8{alpha}- DCs selectively prime Th2 and CD8{alpha}+ DCs Th1 cells (31, 38). We could not observe any difference in the presentation by DC populations by the two Ag forms, nor could we detect an increase of IL-12 secretion by DCs from mice immunized with RCM-HEL (F.R., unpublished results). Thus, HEL and RCM-HEL appear to be presented by the same APCs in vivo, even though they differ dramatically in solubility. However, we cannot exclude that low numbers of B cells (below our detection limit) may present native HEL in naive mice challenged with HEL. Although it has been shown that B cells are not necessary to induce Th2 cell development (37); a low number of B cells might selectively promote the development of Th2 response (20) owing to the lack of IL-12 secretion (39), the failure to sustain CD154 expression (40), or the promotion of Th2 cell survival via OX40-OX40 ligand interaction (22).

Once activated, RCM-HEL-specific T cells are effectively stimulated in vivo by HEL-derived peptides. This in vivo observation confirms the in vitro data, showing that T cell populations obtained from mice primed with HEL or RCM-HEL display a complete cross-recognition of the two Ag forms. The development of cross-reactivity after priming can be due to preferential selection of cross-reactive T cells by the second Ag form, as indicated by the equal expansion of the public clonotypic CDR3 sequence V{beta}8.2-J{beta}1.5 after priming with HEL or RCM-HEL. Identification of T cells using this CDR3 in response to both forms of Ag offers molecular evidence for the possibility that such cross-reactive T cells may be selectively activated upon challenge. The cross-activation of primed T cells could also be favored by functional and biochemical changes distinguishing naive and activated T cells, including requirements for costimulation (41, 42), as well as membrane organization and redistribution of signaling molecules within the immune synapse (43, 44). The result of these modifications is that the TCR avidity for peptide-MHC complexes is considerably higher in activated compared with naive T cells (45), possibly also due to increased cross-linking of the TCR (46), a mechanism that may be involved in memory maintenance (47).

Most importantly, the clonotypic cells appear functionally different, depending on the form of Ag used for priming. Cells obtained from mice primed with RCM-HEL display a proliferative response to HEL103–117 and, surprisingly, to native HEL stronger than the one exhibited by cells bearing the same clonotypic CDR3-{beta} region, but obtained from mice primed with native HEL itself. It would be interesting to establish whether this heteroclitic response reflects the reorganization of membrane microdomains upon activation of the same TCR by distinct ligands. Although the CDR3 of the TCR {beta}-chain engages most of the amino acid residues that are relevant for Ag recognition, the CDR3 region of the {alpha}-chain is also involved in determining the overall affinity of the TCR for peptide-MHC complexes and the flexibility of the TCR itself (48). Thus, although T cells obtained from mice immunized with HEL or RCM-HEL share identical TCR {beta}-chains, they might differ in TCR {alpha}-chain usage, resulting in an altered affinity for the same immunodominant epitope. Indeed, it has been shown recently that resistance to Leishmania major infection in mice transgenic for the TCR {beta}-chain of the Leishmania homologue of receptors for activated C-kinase Ag was associated with the selective expansion of high affinity CD4 T cells expressing a distinct TCR {alpha} repertoire and secreting high levels of IFN-{gamma} (49).

The observation that irreversible disruption of the three-dimensional structure of a globular protein Ag, with defined modifications in TCR-contacting residues such as the addition of carboxymethyl groups to Cys115 in RCM-HEL, can lead to enhanced T cell proliferation and to a response skewed to the Th1 phenotype may be relevant for vaccine design. We could observe these effects independently from the adjuvant used, an important advantage for human vaccination. Indeed, reduction of disulfide bonds and carboxymethylation of cysteine residues in either intact protein or peptide has been shown to be critical for efficient T cell stimulation (50), and by studying the activation of several T cell hybridomas specific for HEL108–116/I-Ed we could observe that the effect of carboxymethylation at Cys115 varies depending on the T cell hybridoma tested (F.R. and J.-C.G., unpublished observations). Of note, one of these T cell clones that was modestly affected by the Cys115 modification expressed the BV8S2-J1S5 public TCR {beta}-chain (33), consistent with our observation that HEL108–116/I-Ed-specific T cells from mice primed with RCM-HEL or HEL can share identical TCR {beta}-chains. Our demonstration that in vivo induced bulk T cells specific for the structurally modified Ag can provide stable Th1-biased help for B cells may be particularly relevant, because the Th1-dependent Ig isotypes are the most efficient in mediating complement activation and Ab-dependent cellular cytotoxicity, key components in the protective response to pathogens. For example, immunity to the malaria sporozoite requires a Th1 response and is transferred by serum (51), most likely involving Th1-dependent isotypes.

In conclusion, a structurally modified Ag can induce an immune response qualitatively and quantitatively different from its native counterpart, although both Ag forms are recognized by a T cell population expressing the same public clonotype. This indicates that appropriate structural modifications of Ags, favoring the induction of desired responses, could improve the efficacy of vaccination and of Ag-based immunointervention in the treatment of autoimmune or allergic diseases.


    Footnotes
 
1 This work was supported in part by Grant 93-99/J/T9 from the Istituto Superiore di Sanità, and by National Institutes of Health Grant AI-48077. Back

2 Address correspondence and reprint requests to Dr. Luciano Adorini, BioXell, Via Olgettina 58, I-20132 Milano, Italy. E-mail address: Luciano.Adorini{at}bioxell.com Back

3 Abbreviations used in this paper: HEL, hen egg-white lysozyme; CDR3, complementarity-determining region 3; DC, dendritic cell; LNC, lymph node cell; RCM-HEL, reduced and carboxymethylated HEL. Back

Received for publication September 25, 2003. Accepted for publication January 8, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  2. Del Prete, G. F., M. De Carli, C. Mastromauro, R. Biagiotti, D. Macchia, P. Falagiani, M. Ricci, S. Romagnani. 1991. Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profile of cytokine production. J. Clin. Invest. 88:346.
  3. Yip, H. C., A. Y. Karulin, M. Tary-Lehmann, M. D. Hesse, H. Radeke, P. S. Heeger, R. P. Trezza, F. P. Heinzel, T. Forsthuber, P. V. Lehmann. 1999. Adjuvant-guided type-1 and type-2 immunity: infectious/noninfectious dichotomy defines the class of response. J. Immunol. 162:3942.[Abstract/Free Full Text]
  4. Janssen, E. M., A. J. van Oosterhout, A. J. van Rensen, W. van Eden, F. P. Nijkamp, M. H. Wauben. 2000. Modulation of Th2 responses by peptide analogues in a murine model of allergic asthma: amelioration or deterioration of the disease process depends on the Th1 or Th2 skewing characteristics of the therapeutic peptide. J. Immunol. 164:580.[Abstract/Free Full Text]
  5. Hosken, N. A., K. Shibuya, A. W. Heath, K. M. Murphy, A. O’Garra. 1995. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-{alpha}{beta}-transgenic model. J. Exp. Med. 182:1579.[Abstract/Free Full Text]
  6. Constant, S., C. Pfeiffer, A. Woodard, T. Pasqualini, K. Bottomly. 1995. Extent of T cell receptor ligation can determine the functional differentiation of naive CD4+ T cells. J. Exp. Med. 182:1591.[Abstract/Free Full Text]
  7. Guery, J. C., F. Galbiati, S. Smiroldo, L. Adorini. 1996. Selective development of T helper (Th)2 cells induced by continuous administration of low dose soluble proteins to normal and {beta}2-microglobulin-deficient BALB/c mice. J. Exp. Med. 183:485.[Abstract/Free Full Text]
  8. Constant, S. L., K. S. Lee, K. Bottomly. 2000. Site of antigen delivery can influence T cell priming: pulmonary environment promotes preferential Th2-type differentiation. Eur. J. Immunol. 30:840.[Medline]
  9. Duncan, D. D., S. L. Swain. 1994. Role of antigen-presenting cells in the polarized development of helper T cell subsets: evidence for differential cytokine production by Th0 cells in response to antigen presentation by B cells and macrophages. Eur. J. Immunol. 24:2506.[Medline]
  10. Hsieh, C. S., S. E. Macatonia, A. O’Garra, K. M. Murphy. 1995. T cell genetic background determines default T helper phenotype development in vitro. J. Exp. Med. 181:713.[Abstract/Free Full Text]
  11. Kumar, V., V. Bhardwaj, L. Soares, J. Alexander, A. Sette, E. Sercarz. 1995. Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon {gamma} by T cells. Proc. Natl. Acad. Sci. USA 92:9510.[Abstract/Free Full Text]
  12. Ria, F., G. Penna, L. Adorini. 1998. Th1 cells induce and Th2 inhibit antigen-dependent IL-12 secretion by dendritic cells. Eur. J. Immunol. 28:2003.[Medline]
  13. O’Garra, A., N. Arai. 2000. The molecular basis of T helper 1 and T helper 2 cell differentiation. Trends Cell Biol. 10:542.[Medline]
  14. Rengarajan, J., S. J. Szabo, L. H. Glimcher. 2000. Transcriptional regulation of Th1/Th2 polarization. Immunol. Today 21:479.[Medline]
  15. Constant, S. L., K. Bottomly. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15:297.[Medline]
  16. Iezzi, G., E. Scotet, D. Scheidegger, A. Lanzavecchia. 1999. The interplay between the duration of TCR and cytokine signaling determines T cell polarization. Eur. J. Immunol. 29:4092.[Medline]
  17. Steinman, L., P. Conlon. 2001. Antigen specific immunotherapy of multiple sclerosis. J. Clin. Immunol. 21:93.[Medline]
  18. Singh, N., S. Bhatia, R. Abraham, S. K. Basu, A. George, V. Bal, S. Rath. 1998. Modulation of T cell cytokine profiles and peptide-MHC complex availability in vivo by delivery to scavenger receptors via antigen maleylation. J. Immunol. 160:4869.[Abstract/Free Full Text]
  19. Kim, H. W., J. G. Canchola, C. D. Brandt, G. Pyles, R. M. Chanock, K. Jensen, R. H. Parrott. 1969. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am. J. Epidemiol. 89:422.[Abstract/Free Full Text]
  20. Yang, X., R. S. Gieni, T. R. Mosmann, K. T. HayGlass. 1993. Chemically modified antigen preferentially elicits induction of Th1-like cytokine synthesis patterns in vivo. J. Exp. Med. 178:349.[Abstract/Free Full Text]
  21. Stockinger, B., T. Zal, A. Zal, D. Gray. 1996. B cells solicit their own help from T cells. J. Exp. Med. 183:891.[Abstract/Free Full Text]
  22. Linton, P. J., B. Bautista, E. Biederman, E. S. Bradley, J. Harbertson, R. M. Kondrack, R. C. Padrick, L. M. Bradley. 2003. Costimulation via OX40L expressed by B cells is sufficient to determine the extent of primary CD4 cell expansion and Th2 cytokine secretion in vivo. J. Exp. Med. 197:875.[Abstract/Free Full Text]
  23. Maizels, R. M., J. A. Clarke, M. A. Harvey, A. Miller, E. E. Sercarz. 1980. Epitope specificity of the T cell proliferative response to lysozyme: proliferative T cells react predominantly to different determinants from those recognized by B cells. Eur. J. Immunol. 10:509.[Medline]
  24. Guery, J. C., A. Sette, E. Appella, L. Adorini. 1995. Constitutive presentation of dominant epitopes from endogenous naturally processed self-{beta}2-microglobulin to class II-restricted T cells leads to self-tolerance. J. Immunol. 154:545.[Abstract]
  25. Guery, J. C., F. Ria, L. Adorini. 1996. Dendritic cells but not B cells present antigenic complexes to class II-restricted T cells after administration of protein in adjuvant. J. Exp. Med. 183:751.[Abstract/Free Full Text]
  26. Soares, L. R., E. E. Sercarz, A. Miller. 1994. Vaccination of the Leishmania major susceptible BALB/c mouse. I. The precise selection of peptide determinant influences CD4+ T cell subset expression. Int. Immunol. 6:785.[Abstract/Free Full Text]
  27. Maverakis, E., J. T. Beech, S. S. Wilson, A. Quinn, B. Pedersen, E. E. Sercarz. 2000. T cell receptor complementarity determining region 3 length analysis reveals the absence of a characteristic public T cell repertoire in neonatal tolerance: the response in the "tolerant" mouse within the residual repertoire is quantitatively similar but qualitatively different. J. Exp. Med. 191:695.[Abstract/Free Full Text]
  28. Gallard, A., G. Foucras, C. Coureau, J. C. Guery. 2002. Tracking T cell clonotypes in complex T lymphocyte populations by real-time quantitative PCR using fluorogenic complementarity-determining region-3-specific probes. J. Immunol. Methods 270:269.[Medline]
  29. Foucras, G., A. Gallard, C. Coureau, J. M. Kanellopoulos, J. C. Guery. 2002. Chronic soluble antigen sensitization primes a unique memory/effector T cell repertoire associated with Th2 phenotype acquisition in vivo. J. Immunol. 168:179.[Abstract/Free Full Text]
  30. Adorini, L., A. Sette, S. Buus, H. M. Grey, M. Darsley, P. V. Lehmann, G. Doria, Z. A. Nagy, E. Appella. 1988. Interaction of an immunodominant epitope with Ia molecules in T-cell activation. Proc. Natl. Acad. Sci. USA 85:5181.[Abstract/Free Full Text]
  31. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8{alpha}+ and CD8{alpha}- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.[Abstract/Free Full Text]
  32. Cibotti, R., J. P. Cabaniols, C. Pannetier, C. Delarbre, I. Vergnon, J. M. Kanellopoulos, P. Kourilsky. 1994. Public and private V{beta} T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice. J. Exp. Med. 180:861.[Abstract/Free Full Text]
  33. Foucras, G., L. Gapin, C. Coureau, J. M. Kannellopoulos, J.-C. Guery. 2000. Interleukin 4-producing CD4 T cells arise from different precursors depending on the conditions of antigen exposure in vivo. J. Exp. Med. 191:683.[Abstract/Free Full Text]
  34. Wynn, T. A., D. Jankovic, S. Hieny, A. W. Cheever, A. Sher. 1995. IL-12 enhances vaccine-induced immunity to Schistosoma mansoni in mice and decreases T helper 2 cytokine expression, IgE production, and tissue eosinophilia. J. Immunol. 154:4701.[Abstract]
  35. Guery, J. C., F. Ria, F. Galbiati, S. Smiroldo, L. Adorini. 1997. The mode of protein antigen administration determines preferential presentation of peptide-class II complexes by lymph node dendritic or B cells. Int. Immunol. 9:9.[Abstract/Free Full Text]
  36. Ronchese, F., B. Hausmann, G. Le Gros. 1994. Interferon-{gamma}- and interleukin-4-producing T cells can be primed on dendritic cells in vivo and do not require the presence of B cells. Eur. J. Immunol. 24:1148.[Medline]
  37. Epstein, M. M., F. Di Rosa, D. Jankovic, A. Sher, P. Matzinger. 1995. Successful T cell priming in B cell-deficient mice. J. Exp. Med. 182:915.[Abstract/Free Full Text]
  38. Pulendran, B., J. L. Smith, G. Caspary, K. Brasel, D. Pettit, E. Maraskovsky, C. R. Maliszewski. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA 96:1036.[Abstract/Free Full Text]
  39. Guery, J. C., F. Ria, F. Galbiati, L. Adorini. 1997. Normal B cells fail to secrete interleukin-12. Eur. J. Immunol. 27:1632.[Medline]
  40. Lee, B. O., L. Haynes, S. M. Eaton, S. L. Swain, T. D. Randall. 2002. The biological outcome of CD40 signaling is dependent on the duration of CD40 ligand expression: reciprocal regulation by interleukin (IL)-4 and IL-12. J. Exp. Med. 196:693.[Abstract/Free Full Text]
  41. Van Bergen, J., Y. Kooy, F. Koning. 2001. CD4-independent T cells impair TCR triggering of CD4-dependent T cells: a putative mechanism for T cell affinity maturation. Eur. J. Immunol. 31:646.[Medline]
  42. Dubey, C., M. Croft, S. L. Swain. 1996. Naive and effector CD4 T cells differ in their requirements for T cell receptor versus costimulatory signals. J. Immunol. 157:3280.[Abstract]
  43. Simons, K., E. Ikonen. 1997. Functional rafts in cell membranes. Nature 387:569.[Medline]
  44. Viola, A., S. Schroeder, Y. Sakakibara, A. Lanzavecchia. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680.[Abstract/Free Full Text]
  45. Hesse, M. D., A. Y. Karulin, B. O. Boehm, P. V. Lehmann, M. Tary-Lehmann. 2001. A T cell clone’s avidity is a function of its activation state. J. Immunol. 167:1353.[Abstract/Free Full Text]
  46. Fahmy, T. M., J. G. Bieler, M. Edidin, J. P. Schneck. 2001. Increased TCR avidity after T cell activation: a mechanism for sensing low-density antigen. Immunity 14:135.[Medline]
  47. Brehm, M. A., A. K. Pinto, K. A. Daniels, J. P. Schneck, R. M. Welsh, L. K. Selin. 2002. T cell immunodominance and maintenance of memory regulated by unexpectedly cross-reactive pathogens. Nat. Immun. 3:627.
  48. Reiser, J. B., C. Darnault, C. Gregoire, T. Mosser, G. Mazza, A. Kearney, P. A. van der Merwe, J. C. Fontecilla-Camps, D. Housset, B. Malissen. 2003. CDR3 loop flexibility contributes to the degeneracy of TCR recognition. Nat. Immun. 4:241.[Medline]
  49. Malherbe, L., C. Filippi, V. Julia, G. Foucras, M. Moro, H. Appel, K. Wucherpfennig, J. C. Guery, N. Glaichenhaus. 2000. Selective activation and expansion of high-affinity CD4+ T cells in resistant mice upon infection with Leishmania major. Immunity 13:771.[Medline]
  50. Kang, H. K., J. A. Mikszta, H. Deng, E. E. Sercarz, P. E. Jensen, B. S. Kim. 2000. Processing and reactivity of T cell epitopes containing two cysteine residues from hen egg-white lysozyme (HEL74–90). J. Immunol. 164:1775.[Abstract/Free Full Text]
  51. Sakai, T., H. Hisaeda, Y. Nakano, M. Zhang, M. Takashima, K. Ishii, Y. Maekawa, S. Matsumoto, Y. Nitta, J. Miyazaki, et al 2003. Gene gun-based co-immunization of merozoite surface protein-1 cDNA with IL-12 expression plasmid confers protection against lethal Plasmodium yoelii in A/J mice. Vaccine 21:1432.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Penitente, C. Nicolo, P. Van den Elzen, G. Di Sante, C. Agrati, F. Aloisi, E. E. Sercarz, and F. Ria
Administration of PLP139-151 Primes T Cells Distinct from Those Spontaneously Responsive In Vitro to This Antigen
J. Immunol., May 15, 2008; 180(10): 6611 - 6622.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Rolla, C. Nicolo, S. Malinarich, M. Orsini, G. Forni, F. Cavallo, and F. Ria
Distinct and Non-Overlapping T Cell Receptor Repertoires Expanded by DNA Vaccination in Wild-Type and HER-2 Transgenic BALB/c Mice
J. Immunol., December 1, 2006; 177(11): 7626 - 7633.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Nicolo, G. Di Sante, M. Orsini, S. Rolla, S. Columba-Cabezas, V. R. Spica, G. Ricciardi, B. M. C. Chan, and F. Ria
Mycobacterium tuberculosis in the adjuvant modulates the balance of Th immune response to self-antigen of the CNS without influencing a "core" repertoire of specific T cells
Int. Immunol., February 1, 2006; 18(2): 363 - 374.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. W. Oli, N. Rhodin, W. P. McArthur, and L. J. Brady
Redirecting the Humoral Immune Response against Streptococcus mutans Antigen P1 with Monoclonal Antibodies
Infect. Immun., December 1, 2004; 72(12): 6951 - 6960.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ria, F.
Right arrow Articles by Adorini, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ria, F.
Right arrow Articles by Adorini, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS