|
|
||||||||

Departments of
*
Microbiology and Immunology, and
Pathology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Oklahoma City, OK 73104
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Experimental autoimmune myocarditis (EAM)3 is a model of inflammatory heart disease generated by immunizing susceptible rats or mice with cardiac myosin or its myocarditic epitopes. In the EAM model, cellular infiltrates consist primarily of T cells and macrophages, and T lymphocytes responsive to cardiac myosin can transfer disease (8, 22, 23, 24, 25). The pathogenic role of autoantibodies involved in the myocardial damage is not clear, although they were found to deposit in the hearts of mice with EAM (5, 26, 27, 28). Cytokines, such as IL-1, TNF-
, IL-12, and IL-4 have also been shown to be critical for the development of murine autoimmune myocarditis (18, 20, 21, 29), whereas IL-10 protected rats against disease (30). In the mouse model of EAM, particularly in A/J and BALB/c strains of mice, eosinophilia and a TH2 response develop during myocarditis, which is in contrast to the Lewis rat model of giant cell granulomatous EAM in which TH1 responses may be more prevalent in the disease (21, 29). Myocarditis in the human may be a heterogeneous disease and TH1- or TH2-mediated depending on the individual immune response pattern in the host.
Previous studies have demonstrated that cardiac myosin is an immunodominant Ag in autoimmune myocarditis, and pathogenic regions of cardiac myosin have been identified using the EAM model in both rats and mice (10, 22, 31, 32, 33, 34, 35, 36, 37, 38). Cardiac myosin is a large peptide, which is composed of two H chains and two pair of L chains. Proteolysis of myosin yields three subfragments including a globular head or subfragment 1 (S1) region, an
helical-coiled coil rod comprised of subfragment 2 (S2), and light meromyosin (LMM) (39). In the Lewis rat, the S2 subfragment has been shown to produce the most severe myocarditis (38). In addition, peptide fragments within residues 10701165 of cardiac myosin S2 rod region produced myocarditis (32, 36, 37), and residues 13041320 and 15391555 in the LMM region induced mild myocarditis in Lewis rats (31). A pathogenic epitope in BALB/c mice contained amino acid residues 614643 of mouse cardiac myosin, which is located in the S1 head portion of the molecule (33). In addition, residues 735-1032 in S1 and S2 portions were shown to induce EAM in both BALB/c and C57B/6 mice (34). In A/J mice, the pathogenic epitope in mouse cardiac myosin was located in the S1 subfragment and contained residues 334352, which binds strongly to MHC class I-Ak molecules on the cell surface of APCs (10). Studies in mice show most epitopes that produce disease are in the S1 region, which is in contrast to the Lewis rat model in which the S1 subfragment did not produce myocarditis. In addition,
-myosin was shown to be the immunodominant isoform to induce EAM in mice, whereas in rats, fragments derived from both
- and
-isoforms of cardiac myosin were equally myocarditic (33, 36, 37).
Our previous studies show that both human cardiac myosin (HCM) and rat cardiac myosin (RCM) induced severe myocarditis in the Lewis rat, and overlapping synthetic peptides of cardiac myosin
-chain LMM residues 15291611 produced moderate myocarditis, but a purified S2 subfragment produced severe disease (38). The purpose of our present study was to identify the pathogenic epitopes of cardiac myosin and to develop a greater understanding of mechanisms underlying autoimmune myocarditis. We tested a panel of synthetic peptides from the S2 region of HCM for production of myocarditis. We chose initially to use the panel of HCM peptides because of their availability in our laboratory for the study of both HCM and RCM and the high homology (96%) between HCM and RCM amino acid sequences. By this strategy, we identified a pathogenic epitope in the S2 rod region (residues 10521073) of cardiac myosin and found that its amino acid sequence was identical in human and rat. The pathogenic epitope was contained within synthetic peptide S216 (residues 10521076). S216 was highly pathogenic in Lewis rats, whereas three other rat strains were resistant to S216-induced myocarditis. S216 was characterized as a cryptic epitope because it was not recognized by cardiac myosin sensitized lymphocytes, and S216 sensitized lymphocytes did not demonstrate a strong anti-cardiac myosin response. The T cell response against S216 was found to be reactive with S228, a dominant epitope in intact cardiac myosin, which may correlate with the high pathogenicity of S216. S216 peptide-induced myocarditis was accompanied by gene expression of cytokines in myocardium and TH1 cytokine production by Ag-specific T cells. Our study provides a defined EAM model that is induced by a cryptic epitope of cardiac myosin. To our knowledge, this is the first report showing that a cryptic epitope shared between RCM and HCM has a strong myocarditic pathogenicity in the Lewis rat. The characterization of the Lewis rat EAM model will allow a better understanding of human inflammatory heart disease, and can be used to study modulation of autoimmune myocarditis.
| Materials and Methods |
|---|
|
|
|---|
Thirty-two overlapping peptides from the S2 region of HCM (Table I) were synthesized and purified as 25-mers with an 11 aa overlap by Genemed Synthesis (South San Francisco, CA).
|
Cardiac myosin was purified from human and Lewis rat heart tissue according to the method of Tobacman and Adelstein (39), with slight modification. Briefly, heart tissue was homogenized in a low-salt buffer (40 mM KCL, 20 mM imidazole, (pH 7.0), 5 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 µg of leupeptin/ml) for 15 s on ice. The washed myofibrils were collected by centrifugation at 16,000 x g for 10 min. The pellets were then resuspended in high-salt buffer (0.3 M KCL, 0.15 M K2HPO4, 1 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 µg of leupeptin/ml) and homogenized for three 30-s bursts on ice. The homogenized tissue was further incubated on ice with stirring for 30 min to facilitate actomyosin extraction. After clarification by centrifugation, actomyosin was precipitated by addition of 10 volumes of cold water, followed by a pH adjustment to 6.5. DTT was added to 5 mM, and the precipitation was allowed to proceed for 30 min. The actomyosin was then pelleted by centrifugation at 16,000 x g. The actomyosin pellet was then resuspended in high-salt buffer, ammonium sulfate was increased to 33%, and the KCL concentration was increased to 0.5 M. After the actomyosin pellet and salts were dissolved, ATP was added to 10 mM and MgCl2 was added to 5 mM, and then the solution was centrifuged at 20,000 x g for 15 min to remove actin filaments. The supernatant was removed and stored at 4°C in the presence of the following inhibitors: 0.5 mM PMSF, 5 µg/ml N-tosyl-L-lysine chloromethyl ketone, and 1 µg of leupeptin/ml.
Immunization of animals
Female Lewis, Brown Norway, F344, and BB/DR rats (68 wk old) were purchased from Harlan Sprague Dawley (Indianapolis, IN) and maintained in groups of three at the Animal Resources Unit at the University of Oklahoma Health Sciences Center (Oklahoma City, OK). The study was conducted under an Institutional Animal Care and Use Committee approved protocol. The rats, after being anesthetized with 10 mg of ketamine/0.2 mg of xylazine, were injected in one hind footpad with 500 µg of cardiac myosin or S2 peptide emulsified in CFA at 1:1 ratio (v/v). On day 0 and day 3 after immunization, the rats were injected i.p. with 1 x 1010 heat-killed Bordetella pertussis. Seven days after primary immunization, the rats were boosted s.c. with 500 µg Ag emulsified in IFA at 1:1 ratio (v/v). Control rats received PBS plus adjuvants. All rats were sacrificed at day 21 by cardiac puncture under anesthesia.
Histopathological examination of tissue
Skeletal muscle, hearts, livers, and kidneys were fixed in 10% buffered Formalin and imbedded in paraffin. Sections (5 µM) were stained with H&E for microscopic histological examination. Myocardium was blindly scored for the presence of histopathological myocarditis according to the scale: 0 = normal, 1 = mild (<5% of heart cross-section involved), 2 = moderate (510% of cross-section involved), 3 = marked (1025% of cross-section involved), and 4 = severe (>25% of cross-section involved). Skeletal muscle, livers, and kidneys were also evaluated for cellular infiltrates as well as myocardium.
ELISA for Ab detection
For sera IgG Ab detection, 10 µg/ml Ag was coated onto Immulon-4 96-well microtiter plates (Dynatech Laboratories, Chantilly, VA) at 50 µl/well in 0.1 M carbonate-bicarbonate coating buffer (pH 9.6), then incubated overnight at 4°C. Plates were washed three times with PBS containing 0.05% Tween 20, then blocked with 1% BSA in PBS for 1 h at 37°C, and washed with PBS Tween 20. Diluted rat serum samples (50 µl, 1/200 dilution for epitope mapping) in PBS with 1% BSA were added to wells in duplicate and incubated overnight at 4°C. Plates were washed with PBS with Tween 20, and 50 µl of goat anti-rat IgG whole molecule (Sigma-Aldrich, St. Louis, MO) conjugated with alkaline phosphatase (1/250 dilution for epitope mapping) was added and incubated at 37°C for 1 h. Plates were washed and 50 µl of substrate para-nitrophenyl phosphate 104 (Sigma-Aldrich) in 0.1 M diethanolamine buffer (pH 9.8) was added. After 30 min, OD was measured at 410 nm in an ELISA plate reader (Dynex Technologies, Chantilly, VA). Controls included Ab conjugate alone and BSA alone.
Lymphocyte proliferation assays
Spleens were removed from rats and pressed through fine mesh screens. The single cell suspension was prepared, counted by trypan blue exclusion, and resuspended to 5 x 106/ml in culture medium (RPMI 1640 supplemented with 10% FBS, 1% sodium pyruvate, 1% nonessential amino acids, and antibiotics). The cells were plated in 96well round-bottom tissue culture plates (Nunc, Naperville, IL) in 100 µl of culture medium. Splenocytes were incubated at 37°C in 5% CO2 for 6 days with protein or peptide Ags at various concentrations before addition of 0.5 µCi of tritiated thymidine (ICN, Irvine, CA). After 1824 h, cells were harvested onto filters with a cell harvester (MACH II; Wallac, Turku, Finland), and tritiated thymidine incorporation was measured in a liquid scintillation counter (Betaplate 1250; Wallac). Values represent the stimulation index with the equation: Stimulation index = (mean test cpm/mean of medium control cpm). MHC restriction was determined by measuring proliferation of splenic T cells in the presence of 0.5 µg/ml anti-RT1.B (OX-6) or anti-RT1.D (OX-17) Abs (Serotec, Raleigh, NC).
Adoptive transfer of EAM
Female 6- to 8-wk-old Lewis rats were immunized with S216 or PBS in CFA as previously described. Fourteen days after first injection, spleens were removed from rats, and single cell suspension was prepared and cultured with 10 µg/ml S216 at 5 x 106/ml for 2 days. Cells were then washed three times, and 0.51 x 108 cells were injected into the inguinal veins of naive syngeneic recipients. Fourteen days following transfer, the recipients were sacrificed for histological examination.
RT-PCR for detection of cytokine mRNA
On day 14 and day 21 postimmunization, poly(A)+ RNA extraction from myocardium of rats, and cDNA synthesis were performed according to manufacturers instruction (Qiagen, Valencia, CA; Invitrogen, Carlsbad, CA). In a total volume of 50 µl of PCR buffer, 4 µl of cDNA were incubated with 1.25 U of TaqDNA polymerase, 0.5 mM deoxynucleotide triphosphates, and 1 µM sense and antisense cytokine-specific primers. Samples were placed in a thermocycler, and each cycle consisted of 94°C denaturing for 60 s, 54°C annealing for 60 s, and 72°C extension for 90 s. Five percent of the PCR were electrophoresed in agarose/ethidium bromide gels and visualized under UV light. The sizes of the bands were determined by m.w. standards (DNA low mass ladder; Invitrogen, Carlsbad, CA). The sequences of primer pairs specific for rat IL-6, IL-12 (p40), IFN-
, TNF-
, and G3PDH are as follows: IL-2, GCGCACCCACTTCAAGCCCT and CCACCACAGTTGCTGGCTCA; IL-6, GAAATACAAAGAAATGATGG and GTGTTTCAACATTCATATTGC; IL-12 (p40), CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG; IL-10, TGCCTTCAGTCAAGTGAAGACT and AAACTCATTCATGGCCTTGTA; IFN-
, GCTCTGCCTCATGGCCCTCTCTGGC and GCACCGACTCCTTTTCCGCTTCCTT; TNF-
, GAGATGTGGAACTGGCAGAG and CTTGAAGAGACCCTGGGAGTA; G3PDH, TCCACCACCCTGTTGCTGTA and ACCACAGTCCATGCCATCAC.
ELISA for cytokine detection
To determine cytokine production, splenocytes were cultured in culture medium alone or culture medium containing 10 µg/ml Ags for 2472 h. Cytokine levels were assayed in 24 h (IL-2) or 48 h (IL-4, IL-10, TNF-
, and IFN-
) culture supernatants by cytokine-specific ELISA according to the manufacturers protocol (BD PharMingen, San Diego, CA). OD was measured at 450 nm in the ELISA plate reader (Dynatech Laboratories). Sample cytokine concentrations were determined according to the standard curves established using known concentration of each cytokine.
Statistical analysis
Means, SEMs, and unpaired Students t test were used to analyze the data. Groups were considered statistically different if p
0.05.
| Results |
|---|
|
|
|---|
Thirty-two overlapping synthetic peptides (25-mers) spanning the amino acid sequence of the S2 region of HCM were divided into eight groups with four contiguous peptides in each group (Table I). Groups of 6- to 8-wk-old female Lewis rats were immunized with each of the S2 peptide groups. Examination of heart sections from rats immunized with the S213 to S216 peptide group revealed myocarditis in all animals tested (Table II and Fig. 1C). Two other S2 peptide groups shown to induce mild myocarditis in immunized rats were peptide groups S29 to S212, and S225 to S228, which had average scores of 0.5 and 0.7, respectively (Table II). HCM immunized rats, comprising the positive control group, developed moderate to severe myocarditis (Table II and Fig. 1B). Heart tissue sections from rats immunized with PBS and CFA had no cellular infiltrate and exhibited normal myocardium (Table II and Figure 1A). Rats immunized with other peptide groups were negative for myocarditis (Table II and Fig. 1D).
|
|
|
The myocarditis inducing capacity of S216 was Lewis strain-specific
Immunization of Brown Norway, F344, and BB/DR rats with S216 failed to induce severe (3+ to 4+) histopathological myocarditis (Table IV). Heart tissue sections from PBS/CFA immunized control rats and other rat strains immunized with S216 had little or no cellular infiltration in myocardium (Table IV and Fig. 1I). F344 rat strain immunized with S216 showed little (0.1+) myocardial infiltration (Table IV and Fig. 1J), whereas the BB/DR and Brown Norway rat strains demonstrated no myocarditis lesions (Table IV). Therefore, Lewis rats were the most susceptible strain to S216-induced EAM.
|
Enhanced cellular immune responses against S216 correlate with disease in immunized Lewis rats
We first detected the proliferative responses of lymphocytes from S216 immunized multistrain rats. Splenic lymphocytes were isolated, and in vitro stimulated with various concentrations of S216 peptide (Fig. 2). Lymphocytes from Lewis rats responded strongly against S216 restimulation in a dose-dependent pattern. Although S216 reactive lymphocytes were also present in BB/DR and F344 rats after immunization with S216, the lymphocyte proliferative response to S216 was much lower than that of Lewis rats. None or very low lymphocyte reaction to S216 was detected in Brown Norway rats. Therefore, the high reactivity of S216 specific T cell responses was associated with EAM induction.
|
For Lewis rats, we mapped the peptide epitopes recognized by T cells and Abs from S216 immunized rats, and compared them with those of cardiac myosin immunized rats and PBS/CFA immunized control rats. We measured both Ab (Fig. 3) and T cell (Fig. 4) responses against 32 overlapping synthetic peptides spanning the HCM S2 region after immunization. Ab from S216 immunized Lewis rats recognized not only S216, but also S24, S217, and S218 peptides. However, sera from HCM and RCM (data similar for the RCM) immunized Lewis rats did not show strong reactivity with any specific S2 peptide although sera reacted strongly with HCM and RCM (Fig. 3). A similar IgG Ab response pattern was also observed at day 14 and day 28 after immunization. No peptide reactivity was shown by PBS/CFA control Ab (OD 0.30.5 for each peptide).
|
|
To define the Ag specificity of S216 sensitized T cells, a series of modified S216 peptides and HCM were tested in vitro for their capacity to induce proliferative responses by splenocytes from S216 immunized rats. Human S216 peptide, and rat S216 peptide as well as truncated S216d, the truncated identical sequence of rat and human S216, stimulated strong recall proliferative responses in an Ag dose-dependent pattern (Fig. 5A). T cells primed with S216 did not respond well to HCM (Fig. 5A) and RCM (data not shown). The three 11-mer truncated peptides tS216a, tS216b, and tS216c were nonstimulatory, which was consistent with the absence of pathogenicity of these 11-mer S2 peptides.
|
To characterize the MHC restriction of the S216 specific in vitro lymphocyte response and compare it with that of HCM-induced lymphocyte response, Abs against rat MHC class II RT1.B (OX-6) and RT1. D (OX-17) loci were added into S216 and HCM stimulated splenocyte culture. As shown in Fig. 5B, the addition of both RT1.B and RT1.D blocking Abs substantially reduced proliferation responses initiated by S216 as well as HCM, compared with the control mouse IgG1 Ab addition (p < 0.05). Therefore, both S216 peptide and HCM were presented by MHC class II RT1.B and RT1.D molecules.
Cytokine expression of S2 and HCM immunized rats
To determine the cytokine profile in S216-induced EAM and compare it with that of HCM-induced EAM, RT-PCR of inflammatory cytokine genes were performed by using RNA isolated from the myocardium of S216 and HCM immunized rats, as well as myocardium of adjuvant control rats. Marked mRNA expression of IL-6, IL-2, IL-12, IFN-
, TNF-
, and IL-10 were detected in the maximum inflammatory phase (day 21), in the myocardium of both S216 and HCM immunized rats, but not in myocardium of control rats. IL-6 and IL-12 gene expression was also observed on day 14 in S216 and HCM immunized rats (Fig. 6A). In addition, S216 stimulated spleen cells from S216 immunized rats (day 21) secreted significantly higher levels of IFN-
(p < 0.005), IL-2, and TNF-
(p < 0.05), compared with cells from PBS/CFA only injected rats. In contrast, there was no significant difference in IL-10 production for these two groups of rats when cell culture supernatants were assayed by cytokine-specific ELISA (Fig. 6B). The production of IL-4 by splenocytes from S216/CFA and PBS/CFA immunized rats was virtually nondetectable (data not shown).
|
| Discussion |
|---|
|
|
|---|
Previously in the rat EAM model, Wegmann et al. (31) reported two synthetic peptides corresponding to amino acids 13041320 and 15391555 in LMM of RCM
H chain which induced myocarditis. However, their pathogenicity required enhancement by acetylation of the N-terminal amino acids. In our studies of LMM peptides, it was clear that in comparison to the S2 fragment that the LMM peptides produced milder disease (38). Using enzymatically digested porcine cardiac myosin fragments, Inomata et al. (32) identified a myocarditic epitope located within a 96 amino acid fragment of cardiac myosin S2 region residues 10701165. Kohno et al. (36) used recombinant technology to further determine that residues 11241153 of cardiac myosin S2 region could induce severe myocarditis in Lewis rats. In addition, they showed both
and
H chains of cardiac myosin could provoke active myocarditis in the Lewis rat (37). Although we did not find a myocarditic epitope within residues 10701165 in our panel of peptides (S221 to S224), this may be explained by different Ag processing of the fragments of cardiac myosin in a 96 residue fragment that may be presented in a different way than our 25-mer peptides. The 11 amino acid overlap in our synthetic peptides was used as an attempt to prevent loss of epitopes, but in our peptides the 10701165 epitope was apparently lost.
The synthetic overlapping peptides of the S2 region used in this study were made according to the amino acid sequence of HCM
-chain, which is the dominant isoform in human ventricle tissue. RCM
H chain, the dominant isoform for adult rat heart, and HCM
H chain are 93% identical and 98% homologous in amino acid sequence. The myocarditic 22-mer within the S216 peptide (residues 10521073) has exactly the same amino acid sequence in both RCM and HCM H chains. Although the S2 peptides contain HCM sequences, they were successful in identifying a myocarditic epitope identical in RCM and HCM.
To determine whether the myocarditic nature of the S216 peptide was specific to the susceptible Lewis strain and restricted to certain MHC class II molecules for Ag presentation, we immunized three other different rat strains with the S216 peptide. The S216 peptide induced marked myocarditis in the Lewis rat, but not in the other three strains of rats. The reduced pathogenicity of S216 in other rat strains might be due to their different MHC haplotypes. S216 immunized F344 rats, which express same RT1-B/D (rat MHC class II) but are different in RT1-C/E/M (rat MHC telomeric class I region), did not develop marked myocarditis, which suggested that factors in addition to the RT1-B/D may contribute to the development of myocarditis after S216 immunization. In the rat model of experimental allergic encephalomyelitis, it was shown that congenic BN-1L rats, which have LEW MHC on a BN-derived background, similar to the wild-type BN rats, were resistant to experimental allergic encephalomyelitis. This non-MHC encoded resistance was associated with the ability to produce regulatory cytokines such as TGF-
and increased frequency of CD45RClow regulatory CD4+ T cells (41). Our study showed that S216-specific T cells were present not only in the Lewis rat, but also in the resistant strains such as BB/DR and F344 rats. However, S216-specific recall responses in the Lewis rat were much stronger than those in the resistant rats (Fig. 2). This might be due to the existence of higher quantity or affinity of S216-specific T cells in Lewis rats. Although the MHC-class II restriction of S216 presentation was suggested by in vitro anti-RT1.B and anti-RT1.D blocking experiments, both MHC-linked and non-MHC-linked mechanisms, such as the nature of the S216-specific T cell repertoire, should be considered in the susceptibility of the Lewis rat strain and the resistance of 3 other rat strains to the S216 induced myocarditis.
Numerous studies have demonstrated the importance of cellular immunity in autoimmune myocarditis (8, 24, 25). T cell infiltration of myocardium has been demonstrated following immunization with cardiac myosin or its myocarditic epitopes (6, 10, 22, 31, 42, 43). In our study, we characterized T cell responses after S216 and cardiac myosin immunization and found that S216 was a cryptic determinant of cardiac myosin. Peptide S216 was incapable of inducing proliferative responses of T cells from rats immunized with HCM or RCM, and HCM or RCM did not strongly stimulate S216 sensitized T cells (Fig. 4 and Fig. 5A). It should be noted that cardiac myosin, in contrast to the S216 peptide, was not a strong Ag in vitro in our proliferation assays because in HCM or RCM immunized rats, the response to cardiac myosin was moderate (Fig. 4). The cryptic nature of the S216 Ag was also suggested by B cell responses in cardiac myosin immunized rats (Fig. 3). S216 was not recognized by HCM induced Abs, although IgG Abs against cardiac myosin were produced after S216 immunization as detected in the ELISA and Western immunoblot when using high sera concentrations (data not shown). This may suggest that T cell-dependent B cell recognition of cardiac myosin was induced after S216 immunization.
Although cryptic epitopes may not be exposed after native Ag priming and processing, they may play an important role in perpetuation of chronic inflammatory disease due to epitope spreading or mimicry within cardiac myosin. Our data show that both cardiac myosin and S216 sensitization induced T cell responses against common epitopes such as S228, S229, S231, and S232. B cell Ab responses were directed against S216 and S24, S217 and S218 as well which were different from the T cell epitopes. A similar B and T cell response pattern was observed during the early and late phases of myocarditis in the Lewis rats, which suggested that the multiple peptide reaction of S216 primed T cells or Abs may not be due to the epitope spreading. The amino acid sequence alignments of S216 and S228 and S231/S232 peptides shows 40% identity and 7080% homology between S216 and these peptides in a 15 amino acid overlap. The data support a cross-reactive response at the T cell level that may be due to epitope mimicry within cardiac myosin. When we immunized rats with peptide S228, a lower disease incidence (30%) and milder infiltrate than S216 and intact cardiac myosin immunization were observed (data not shown). S228 was the most dominant epitope in proliferation assays of lymphocytes from HCM and RCM immunized rats (Fig. 4). This result was consistent with the hypothesis that undeleted T cells specific to the dominant S228 epitope of cardiac myosin might have been partially tolerized in the Lewis rat. The data support the mechanism that cryptic epitope S216 may induce disease in part by activation of T cells specific for the dominant epitope S228 as well as against itself. However, we did not detect a T cell proliferative response to S216 when rats were immunized with S228 in our model system (data not shown). The data suggest that T cells specific for S216 can recognize S228 but not vice versa. T cell degeneracy could also be a mechanism by which S216 sensitized T cells recognize S228 (44).
In addition to T cell repertoire recognition of myocarditic epitopes, other factors such as activation of APCs and the local production of cytokines may influence and perpetuate autoimmune reactivity in vivo (18, 21, 45, 46). Normal heart may not be susceptible to autoreactive T cell attack unless interstitial APCs of myocardium are activated and up-regulate their surface MHC class II expression, which is mediated through the cytokines such as IFN-
and TNF-
(46, 47, 48, 49). We demonstrated that in S216-induced EAM, a high level of inflammatory cytokines including IL-6, IL-12, TNF-
, IL-2, and IFN-
were expressed in the myocardium after S216 immunization, which was similar to the cytokine expression pattern in HCM treated Lewis rats myocardium. Although IL-10 mRNA from myocardium was also detected on day 21 for rats immunized with S216 or HCM, the up-regulation of IL-10 production by S216 sensitized T cells at or before day 21 was not detected. Our data suggest that at the induction phase of S216-induced EAM, cytokines induced by TH1 cells were predominant. TH1 cytokines expressed in S216-induced EAM are in contrast to certain mouse models of EAM in which TH2 cytokine production is associated with myocarditis induction (16, 29).
In conclusion, our study identified a strong pathogenic cryptic epitope of cardiac myosin that induced EAM in the Lewis rat. Disease induction was closely associated with Ag-specific T cell reactivities, MHC complex restriction and other non-MHC factors, and inflammatory cytokine expression. Because the S216 epitope stimulates such a strong T cell response, it may be an ideal peptide ligand for the study of T cell degeneracy in myocarditis (44). The highly myocarditic peptide S216 will continue to be useful in the investigation of the role of epitope mimicry or spreading in the progression of myocarditis, as well as for a better understanding the mechanisms in disease or immune tolerance and for the design of immunotherapies for myocarditis.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Madeleine W. Cunningham, Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Room 217, 975 NE 10th Street, Oklahoma City, Oklahoma 73104. E-mail address: madeleine-cunningham{at}ouhsc.edu ![]()
3 Abbreviations used in this paper: EAM, experimental autoimmune myocarditis; HCM, human cardiac myosin; RCM, rat cardiac myosin; LMM, light meromyosin. ![]()
Received for publication April 28, 2003. Accepted for publication December 18, 2003.
| References |
|---|
|
|
|---|
-independent pathway. Circulation 104:3145.
-myosin heavy chains differ in their induction of myocarditis: identification of pathogenic epitopes. J. Clin. Invest. 92:2877.
cardiac myosin heavy chain (
-CMHC) can provoke autoimmune myocarditis as well as the corresponding
cardiac myosin heavy chain (
-CMHC) fragment. Autoimmunity 34:177.[Medline]
in the natural resistance to experimental allergic encephalomyelitis in rats. Eur. J. Immunol. 31:1132.[Medline]
and tumor necrosis factor-
expression in vivo: effects of cycloheximide and cyclosporine in normal and lipopolysaccharide-treated mice. J. Immunol. 150:342.[Abstract]
-myosin heavy chain gene and a comparative analysis of its product. Genomics 8:194.[Medline]This article has been cited by other articles:
![]() |
P. Zhang, C. J. Cox, K. M. Alvarez, and M. W. Cunningham Cutting Edge: Cardiac Myosin Activates Innate Immune Responses through TLRs J. Immunol., July 1, 2009; 183(1): 27 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. S. Heuser, L. C. Cunningham, S. D. Kosanke, and M. W. Cunningham Mimicry and Antibody-Mediated Cell Signaling in Autoimmune Myocarditis J. Immunol., December 1, 2006; 177(11): 8234 - 8240. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Cooper, R. Virmani, N. M. Chapman, A. Frustaci, R. J. Rodeheffer, M. W. Cunningham, and D. M. McNamara National Institutes of Health-Sponsored Workshop on Inflammation and Immunity in Dilated Cardiomyopathy Mayo Clin. Proc., February 1, 2006; 81(2): 199 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. J. Ellis, Y. Li, W. Hildebrand, V. A. Fischetti, and M. W. Cunningham T Cell Mimicry and Epitope Specificity of Cross-Reactive T Cell Clones from Rheumatic Heart Disease J. Immunol., October 15, 2005; 175(8): 5448 - 5456. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Fett Peripartum cardiomyopathy (PPCM) in both surrogate and biological mother Hum. Reprod., September 1, 2005; 20(9): 2666 - 2668. [Full Text] [PDF] |
||||
![]() |
F. Mor, M. Izak, and I. R. Cohen Identification of Aldolase as a Target Antigen in Alzheimer's Disease J. Immunol., September 1, 2005; 175(5): 3439 - 3445. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham Protection against Experimental Autoimmune Myocarditis Is Mediated by Interleukin-10-Producing T Cells that Are Controlled by Dendritic Cells Am. J. Pathol., July 1, 2005; 167(1): 5 - 15. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |