The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Cunningham, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Cunningham, M. W.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Cardiomyopathy
The Journal of Immunology, 2004, 172: 3225-3234.
Copyright © 2004 by The American Association of Immunologists

Cryptic Epitope Identified in Rat and Human Cardiac Myosin S2 Region Induces Myocarditis in the Lewis Rat1

Ya Li*, Janet S. Heuser*, Stanley D. Kosanke{dagger}, Mark Hemric* and Madeleine W. Cunningham2,*

Departments of * Microbiology and Immunology, and {dagger} Pathology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Oklahoma City, OK 73104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Myocarditis is a common cause of dilated cardiomyopathy leading to heart failure. Chronic stages of myocarditis may be initiated by autoimmune responses to exposed cardiac Ags after myocyte damage. Cardiac myosin, a heart autoantigen, induced experimental autoimmune myocarditis (EAM) in susceptible animals. Although cardiac myosin-induced myocarditis has been reported in Lewis rats, the main pathogenic epitope has not been identified. Using overlapping synthetic peptides of the S2 region of human cardiac myosin, we identified an amino acid sequence, S2–16 (residues 1052–1076), that induced severe myocarditis in Lewis rats. The myocarditic epitope was localized to a truncated S2–16 peptide (residues 1052–1073), which contained a sequence identical in human and rat cardiac myosin. The S2–16 peptide was not myocarditic for three other strains of rats, in which the lack of myocarditis was accompanied by the absence of strong S2–16-specific lymphocyte responses in vitro. For Lewis rats, S2–16 was characterized as a cryptic epitope of cardiac myosin because it did not recall lymphocyte and Ab responses after immunization with cardiac myosin. Lymphocytes from S2–16 immunized rats recognized not only S2–16, but also peptides in the S2–28 region. Furthermore, peptide S2–28 was the dominant epitope recognized by T cells from cardiac myosin immunized rats. S2–16 was presented by Lewis rat MHC class II molecules, and myocarditis induction was associated with an up-regulation of inflammatory cytokine production. S2–16-induced EAM provides a defined animal model to investigate mechanisms of EAM and modulation of immune responses to prevent autoimmune myocarditis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Myocarditis is an inflammatory heart disease often associated with a previous viral infection (1, 2, 3, 4, 5). Evidence has suggested that myocarditis may be due to autoimmune responses directed against cardiac tissue (6, 7, 8, 9, 10). The inflammatory immune response caused after infection may break tolerance by mechanisms of molecular mimicry, bystander activation, and loss of immune regulation (11, 12, 13, 14, 15, 16). The innate immune response to infection and release of cardiac myosin or other cardiac Ag may contribute to the overall enhanced inflammatory state in the myocardium (17). Once initiated, the immune responses leading to myocarditis can be perpetuated by exposed and presented cardiac Ags in the presence of inflammatory cytokines (18, 19, 20, 21).

Experimental autoimmune myocarditis (EAM)3 is a model of inflammatory heart disease generated by immunizing susceptible rats or mice with cardiac myosin or its myocarditic epitopes. In the EAM model, cellular infiltrates consist primarily of T cells and macrophages, and T lymphocytes responsive to cardiac myosin can transfer disease (8, 22, 23, 24, 25). The pathogenic role of autoantibodies involved in the myocardial damage is not clear, although they were found to deposit in the hearts of mice with EAM (5, 26, 27, 28). Cytokines, such as IL-1, TNF-{alpha}, IL-12, and IL-4 have also been shown to be critical for the development of murine autoimmune myocarditis (18, 20, 21, 29), whereas IL-10 protected rats against disease (30). In the mouse model of EAM, particularly in A/J and BALB/c strains of mice, eosinophilia and a TH2 response develop during myocarditis, which is in contrast to the Lewis rat model of giant cell granulomatous EAM in which TH1 responses may be more prevalent in the disease (21, 29). Myocarditis in the human may be a heterogeneous disease and TH1- or TH2-mediated depending on the individual immune response pattern in the host.

Previous studies have demonstrated that cardiac myosin is an immunodominant Ag in autoimmune myocarditis, and pathogenic regions of cardiac myosin have been identified using the EAM model in both rats and mice (10, 22, 31, 32, 33, 34, 35, 36, 37, 38). Cardiac myosin is a large peptide, which is composed of two H chains and two pair of L chains. Proteolysis of myosin yields three subfragments including a globular head or subfragment 1 (S1) region, an {alpha} helical-coiled coil rod comprised of subfragment 2 (S2), and light meromyosin (LMM) (39). In the Lewis rat, the S2 subfragment has been shown to produce the most severe myocarditis (38). In addition, peptide fragments within residues 1070–1165 of cardiac myosin S2 rod region produced myocarditis (32, 36, 37), and residues 1304–1320 and 1539–1555 in the LMM region induced mild myocarditis in Lewis rats (31). A pathogenic epitope in BALB/c mice contained amino acid residues 614–643 of mouse cardiac myosin, which is located in the S1 head portion of the molecule (33). In addition, residues 735-1032 in S1 and S2 portions were shown to induce EAM in both BALB/c and C57B/6 mice (34). In A/J mice, the pathogenic epitope in mouse cardiac myosin was located in the S1 subfragment and contained residues 334–352, which binds strongly to MHC class I-Ak molecules on the cell surface of APCs (10). Studies in mice show most epitopes that produce disease are in the S1 region, which is in contrast to the Lewis rat model in which the S1 subfragment did not produce myocarditis. In addition, {alpha}-myosin was shown to be the immunodominant isoform to induce EAM in mice, whereas in rats, fragments derived from both {alpha}- and {beta}-isoforms of cardiac myosin were equally myocarditic (33, 36, 37).

Our previous studies show that both human cardiac myosin (HCM) and rat cardiac myosin (RCM) induced severe myocarditis in the Lewis rat, and overlapping synthetic peptides of cardiac myosin {beta}-chain LMM residues 1529–1611 produced moderate myocarditis, but a purified S2 subfragment produced severe disease (38). The purpose of our present study was to identify the pathogenic epitopes of cardiac myosin and to develop a greater understanding of mechanisms underlying autoimmune myocarditis. We tested a panel of synthetic peptides from the S2 region of HCM for production of myocarditis. We chose initially to use the panel of HCM peptides because of their availability in our laboratory for the study of both HCM and RCM and the high homology (96%) between HCM and RCM amino acid sequences. By this strategy, we identified a pathogenic epitope in the S2 rod region (residues 1052–1073) of cardiac myosin and found that its amino acid sequence was identical in human and rat. The pathogenic epitope was contained within synthetic peptide S2–16 (residues 1052–1076). S2–16 was highly pathogenic in Lewis rats, whereas three other rat strains were resistant to S2–16-induced myocarditis. S2–16 was characterized as a cryptic epitope because it was not recognized by cardiac myosin sensitized lymphocytes, and S2–16 sensitized lymphocytes did not demonstrate a strong anti-cardiac myosin response. The T cell response against S2–16 was found to be reactive with S2–28, a dominant epitope in intact cardiac myosin, which may correlate with the high pathogenicity of S2–16. S2–16 peptide-induced myocarditis was accompanied by gene expression of cytokines in myocardium and TH1 cytokine production by Ag-specific T cells. Our study provides a defined EAM model that is induced by a cryptic epitope of cardiac myosin. To our knowledge, this is the first report showing that a cryptic epitope shared between RCM and HCM has a strong myocarditic pathogenicity in the Lewis rat. The characterization of the Lewis rat EAM model will allow a better understanding of human inflammatory heart disease, and can be used to study modulation of autoimmune myocarditis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antigens

Thirty-two overlapping peptides from the S2 region of HCM (Table I) were synthesized and purified as 25-mers with an 11 aa overlap by Genemed Synthesis (South San Francisco, CA).


View this table:
[in this window]
[in a new window]
 
Table I. Overlapping synthetic peptides (25-mer) of HCM S2 region

 
Preparation of purified HCM or RCM and its subfragment

Cardiac myosin was purified from human and Lewis rat heart tissue according to the method of Tobacman and Adelstein (39), with slight modification. Briefly, heart tissue was homogenized in a low-salt buffer (40 mM KCL, 20 mM imidazole, (pH 7.0), 5 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 µg of leupeptin/ml) for 15 s on ice. The washed myofibrils were collected by centrifugation at 16,000 x g for 10 min. The pellets were then resuspended in high-salt buffer (0.3 M KCL, 0.15 M K2HPO4, 1 mM EGTA, 5 mM DTT, 0.5 mM PMSF, 1 µg of leupeptin/ml) and homogenized for three 30-s bursts on ice. The homogenized tissue was further incubated on ice with stirring for 30 min to facilitate actomyosin extraction. After clarification by centrifugation, actomyosin was precipitated by addition of 10 volumes of cold water, followed by a pH adjustment to 6.5. DTT was added to 5 mM, and the precipitation was allowed to proceed for 30 min. The actomyosin was then pelleted by centrifugation at 16,000 x g. The actomyosin pellet was then resuspended in high-salt buffer, ammonium sulfate was increased to 33%, and the KCL concentration was increased to 0.5 M. After the actomyosin pellet and salts were dissolved, ATP was added to 10 mM and MgCl2 was added to 5 mM, and then the solution was centrifuged at 20,000 x g for 15 min to remove actin filaments. The supernatant was removed and stored at 4°C in the presence of the following inhibitors: 0.5 mM PMSF, 5 µg/ml N-tosyl-L-lysine chloromethyl ketone, and 1 µg of leupeptin/ml.

Immunization of animals

Female Lewis, Brown Norway, F344, and BB/DR rats (6–8 wk old) were purchased from Harlan Sprague Dawley (Indianapolis, IN) and maintained in groups of three at the Animal Resources Unit at the University of Oklahoma Health Sciences Center (Oklahoma City, OK). The study was conducted under an Institutional Animal Care and Use Committee approved protocol. The rats, after being anesthetized with 10 mg of ketamine/0.2 mg of xylazine, were injected in one hind footpad with 500 µg of cardiac myosin or S2 peptide emulsified in CFA at 1:1 ratio (v/v). On day 0 and day 3 after immunization, the rats were injected i.p. with 1 x 1010 heat-killed Bordetella pertussis. Seven days after primary immunization, the rats were boosted s.c. with 500 µg Ag emulsified in IFA at 1:1 ratio (v/v). Control rats received PBS plus adjuvants. All rats were sacrificed at day 21 by cardiac puncture under anesthesia.

Histopathological examination of tissue

Skeletal muscle, hearts, livers, and kidneys were fixed in 10% buffered Formalin and imbedded in paraffin. Sections (5 µM) were stained with H&E for microscopic histological examination. Myocardium was blindly scored for the presence of histopathological myocarditis according to the scale: 0 = normal, 1 = mild (<5% of heart cross-section involved), 2 = moderate (5–10% of cross-section involved), 3 = marked (10–25% of cross-section involved), and 4 = severe (>25% of cross-section involved). Skeletal muscle, livers, and kidneys were also evaluated for cellular infiltrates as well as myocardium.

ELISA for Ab detection

For sera IgG Ab detection, 10 µg/ml Ag was coated onto Immulon-4 96-well microtiter plates (Dynatech Laboratories, Chantilly, VA) at 50 µl/well in 0.1 M carbonate-bicarbonate coating buffer (pH 9.6), then incubated overnight at 4°C. Plates were washed three times with PBS containing 0.05% Tween 20, then blocked with 1% BSA in PBS for 1 h at 37°C, and washed with PBS Tween 20. Diluted rat serum samples (50 µl, 1/200 dilution for epitope mapping) in PBS with 1% BSA were added to wells in duplicate and incubated overnight at 4°C. Plates were washed with PBS with Tween 20, and 50 µl of goat anti-rat IgG whole molecule (Sigma-Aldrich, St. Louis, MO) conjugated with alkaline phosphatase (1/250 dilution for epitope mapping) was added and incubated at 37°C for 1 h. Plates were washed and 50 µl of substrate para-nitrophenyl phosphate 104 (Sigma-Aldrich) in 0.1 M diethanolamine buffer (pH 9.8) was added. After 30 min, OD was measured at 410 nm in an ELISA plate reader (Dynex Technologies, Chantilly, VA). Controls included Ab conjugate alone and BSA alone.

Lymphocyte proliferation assays

Spleens were removed from rats and pressed through fine mesh screens. The single cell suspension was prepared, counted by trypan blue exclusion, and resuspended to 5 x 106/ml in culture medium (RPMI 1640 supplemented with 10% FBS, 1% sodium pyruvate, 1% nonessential amino acids, and antibiotics). The cells were plated in 96–well round-bottom tissue culture plates (Nunc, Naperville, IL) in 100 µl of culture medium. Splenocytes were incubated at 37°C in 5% CO2 for 6 days with protein or peptide Ags at various concentrations before addition of 0.5 µCi of tritiated thymidine (ICN, Irvine, CA). After 18–24 h, cells were harvested onto filters with a cell harvester (MACH II; Wallac, Turku, Finland), and tritiated thymidine incorporation was measured in a liquid scintillation counter (Betaplate 1250; Wallac). Values represent the stimulation index with the equation: Stimulation index = (mean test cpm/mean of medium control cpm). MHC restriction was determined by measuring proliferation of splenic T cells in the presence of 0.5 µg/ml anti-RT1.B (OX-6) or anti-RT1.D (OX-17) Abs (Serotec, Raleigh, NC).

Adoptive transfer of EAM

Female 6- to 8-wk-old Lewis rats were immunized with S2–16 or PBS in CFA as previously described. Fourteen days after first injection, spleens were removed from rats, and single cell suspension was prepared and cultured with 10 µg/ml S2–16 at 5 x 106/ml for 2 days. Cells were then washed three times, and 0.5–1 x 108 cells were injected into the inguinal veins of naive syngeneic recipients. Fourteen days following transfer, the recipients were sacrificed for histological examination.

RT-PCR for detection of cytokine mRNA

On day 14 and day 21 postimmunization, poly(A)+ RNA extraction from myocardium of rats, and cDNA synthesis were performed according to manufacturer’s instruction (Qiagen, Valencia, CA; Invitrogen, Carlsbad, CA). In a total volume of 50 µl of PCR buffer, 4 µl of cDNA were incubated with 1.25 U of TaqDNA polymerase, 0.5 mM deoxynucleotide triphosphates, and 1 µM sense and antisense cytokine-specific primers. Samples were placed in a thermocycler, and each cycle consisted of 94°C denaturing for 60 s, 54°C annealing for 60 s, and 72°C extension for 90 s. Five percent of the PCR were electrophoresed in agarose/ethidium bromide gels and visualized under UV light. The sizes of the bands were determined by m.w. standards (DNA low mass ladder; Invitrogen, Carlsbad, CA). The sequences of primer pairs specific for rat IL-6, IL-12 (p40), IFN-{gamma}, TNF-{alpha}, and G3PDH are as follows: IL-2, GCGCACCCACTTCAAGCCCT and CCACCACAGTTGCTGGCTCA; IL-6, GAAATACAAAGAAATGATGG and GTGTTTCAACATTCATATTGC; IL-12 (p40), CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG; IL-10, TGCCTTCAGTCAAGTGAAGACT and AAACTCATTCATGGCCTTGTA; IFN-{gamma}, GCTCTGCCTCATGGCCCTCTCTGGC and GCACCGACTCCTTTTCCGCTTCCTT; TNF-{alpha}, GAGATGTGGAACTGGCAGAG and CTTGAAGAGACCCTGGGAGTA; G3PDH, TCCACCACCCTGTTGCTGTA and ACCACAGTCCATGCCATCAC.

ELISA for cytokine detection

To determine cytokine production, splenocytes were cultured in culture medium alone or culture medium containing 10 µg/ml Ags for 24–72 h. Cytokine levels were assayed in 24 h (IL-2) or 48 h (IL-4, IL-10, TNF-{alpha}, and IFN-{gamma}) culture supernatants by cytokine-specific ELISA according to the manufacturer’s protocol (BD PharMingen, San Diego, CA). OD was measured at 450 nm in the ELISA plate reader (Dynatech Laboratories). Sample cytokine concentrations were determined according to the standard curves established using known concentration of each cytokine.

Statistical analysis

Means, SEMs, and unpaired Student’s t test were used to analyze the data. Groups were considered statistically different if p <= 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Myocarditic epitope is located in the S2 fragment of cardiac myosin

Thirty-two overlapping synthetic peptides (25-mers) spanning the amino acid sequence of the S2 region of HCM were divided into eight groups with four contiguous peptides in each group (Table I). Groups of 6- to 8-wk-old female Lewis rats were immunized with each of the S2 peptide groups. Examination of heart sections from rats immunized with the S2–13 to S2–16 peptide group revealed myocarditis in all animals tested (Table II and Fig. 1C). Two other S2 peptide groups shown to induce mild myocarditis in immunized rats were peptide groups S2–9 to S2–12, and S2–25 to S2–28, which had average scores of 0.5 and 0.7, respectively (Table II). HCM immunized rats, comprising the positive control group, developed moderate to severe myocarditis (Table II and Fig. 1B). Heart tissue sections from rats immunized with PBS and CFA had no cellular infiltrate and exhibited normal myocardium (Table II and Figure 1A). Rats immunized with other peptide groups were negative for myocarditis (Table II and Fig. 1D).


View this table:
[in this window]
[in a new window]
 
Table II. Induction of myocarditis in Lewis rats by immunization with cardiac myosin or S2 peptides

 


View larger version (117K):
[in this window]
[in a new window]
 
FIGURE 1. Histopathologic features of autoimmune myocarditis in rats. Female 6–8-wk-old Lewis rats were immunized with PBS (A), HCM (B), S2 peptide group 13–16 (C), and S2 peptide group 21–24 (D), S2–16 peptide (E), rS2–16 (rat S2–16 sequence) (F), tS2–16d (the truncated sequence identical in RCM and HCM) (G), and tS2–16a (the truncated 11-mer peptides) (H) in CFA. Experiments in several rat strains revealed that the Lewis rat (E) was most susceptible, whereas other strains (Table IV) including F344 were more resistant to developing myocarditis after S2–16 immunization (I). BB/DR rats (I) and Brown Norway rats did not develop myocarditis, whereas F344 rats developed weak myocarditis (J).

 
To further identify the highly pathogenic epitope in the S2 subfragment of cardiac myosin, Lewis rats were immunized with single S2 peptides from S2–13 to S2–16. S2–16 peptide (residues 1052–1076) induced moderate to severe myocarditis in all six peptide-immunized rats, with average histopathological score of 2.9 (Table III and Fig. 1E). The frequency and severity of myocarditis induced by S2–16 was comparable to that induced by intact cardiac myosin. S2–13, S2–14, and S2–15 did not induce myocarditis in most tested rats. In addition to actively inducing EAM, S2–16 primed lymphocytes were also found to be capable of passively transferring the disease after adoptive transfer of S2–16 peptide activated splenic T cells into naive syngeneic rats. Results showed myocarditis in five of six recipients of S2–16 primed T cells, whereas none of the rats receiving CFA-primed T cells developed EAM (Table III).


View this table:
[in this window]
[in a new window]
 
Table III. Induction of myocarditis in Lewis rats by a single cardiac myosin S2 peptide sequence

 
To delineate the myocarditic sequence within S2–16, we generated a panel of truncated or modified peptides based on the S2–16 sequence (Table III). Among them, rS2–16 was designed based upon the rat S2–16 sequence, which has only one amino acid difference from S2–16 derived from HCM sequence (leucine vs glutamine at residue 1074). To identify the optimal length of the pathogenic S2–16 epitope, we also generated four truncated peptides of S2–16 including tS2–16a, tS2–16b, and tS2–16c, which are three shortened 11-mer peptides, and tS2–16d, which was synthesized as a 22-mer with the last three amino acids in S2–16 deleted. The design of the truncated peptide tS2–16d eliminated the single amino acid difference between the rat and human sequence. Therefore, tS2–16d sequence was identical in both RCM and HCM. We found both rS2–16 and tS2–16d produced moderate to severe myocarditis in Lewis rats (Table III and Fig. 1, F and G, respectively), whereas the three truncated shorter 11-mer tS2–16 peptides were completely nonmyocarditic (Table III and Fig. 1H). Therefore, the myocarditic portion of S2–16 was localized to a 22 amino acid sequence (residues 1052–1073), which is identical in both RCM and HCM.

The myocarditis inducing capacity of S2–16 was Lewis strain-specific

Immunization of Brown Norway, F344, and BB/DR rats with S2–16 failed to induce severe (3+ to 4+) histopathological myocarditis (Table IV). Heart tissue sections from PBS/CFA immunized control rats and other rat strains immunized with S2–16 had little or no cellular infiltration in myocardium (Table IV and Fig. 1I). F344 rat strain immunized with S2–16 showed little (0.1+) myocardial infiltration (Table IV and Fig. 1J), whereas the BB/DR and Brown Norway rat strains demonstrated no myocarditis lesions (Table IV). Therefore, Lewis rats were the most susceptible strain to S2–16-induced EAM.


View this table:
[in this window]
[in a new window]
 
Table IV. Immunization of different rat strains with S2-16 or PBS in adjuvants

 
Fig. 1 shows cellular infiltrates in sections of rat myocardium stained with H&E. Lesions contained mononuclear cell infiltrates and were granulomatous with myocyte necrosis. Multinucleated giant cells were present in the inflammatory lesions. Inflammatory infiltrates were similar in hearts of rats immunized with HCM (Fig. 1B), S2–16 (Fig. 1E), rat S2–16 peptide (rS2–16, Fig. 1F), and the truncated 22-mer S2–16 peptide (tS2–16d, Fig. 1G). Heart tissue sections from PBS immunized control rats had no cellular infiltration and showed normal myocardium (Fig. 1A). Examination of multiple sections of skeletal muscle, liver, and kidney from rats with myocarditis did not find evidence of tissue infiltration of mononuclear cells (data not shown).

Enhanced cellular immune responses against S2–16 correlate with disease in immunized Lewis rats

We first detected the proliferative responses of lymphocytes from S2–16 immunized multistrain rats. Splenic lymphocytes were isolated, and in vitro stimulated with various concentrations of S2–16 peptide (Fig. 2). Lymphocytes from Lewis rats responded strongly against S2–16 restimulation in a dose-dependent pattern. Although S2–16 reactive lymphocytes were also present in BB/DR and F344 rats after immunization with S2–16, the lymphocyte proliferative response to S2–16 was much lower than that of Lewis rats. None or very low lymphocyte reaction to S2–16 was detected in Brown Norway rats. Therefore, the high reactivity of S2–16 specific T cell responses was associated with EAM induction.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 2. Recall proliferative response of lymphocytes from S2–16 immunized Lewis rats as compared with F344, Brown Norway (BN), and BB/DR strain of rats. Splenic lymphocytes were isolated from four strains of rats 21 days after they were immunized with S2–16. Lymphocytes were stimulated with various concentrations of S2–16 peptides for 6 days, and the proliferative responses were measured by [3H]thymidine incorporation. Results of the proliferation assay were expressed as stimulation index = (mean test cpm/mean of medium control cpm) ± SEM. Results presented represent an average of two independent experiments.

 
S2–16 is a cryptic epitope with characterization of Ab and lymphocyte responses in S2–16 and HCM immunized Lewis rats

For Lewis rats, we mapped the peptide epitopes recognized by T cells and Abs from S2–16 immunized rats, and compared them with those of cardiac myosin immunized rats and PBS/CFA immunized control rats. We measured both Ab (Fig. 3) and T cell (Fig. 4) responses against 32 overlapping synthetic peptides spanning the HCM S2 region after immunization. Ab from S2–16 immunized Lewis rats recognized not only S2–16, but also S2–4, S2–17, and S2–18 peptides. However, sera from HCM and RCM (data similar for the RCM) immunized Lewis rats did not show strong reactivity with any specific S2 peptide although sera reacted strongly with HCM and RCM (Fig. 3). A similar IgG Ab response pattern was also observed at day 14 and day 28 after immunization. No peptide reactivity was shown by PBS/CFA control Ab (OD 0.3–0.5 for each peptide).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3. IgG Ab responses of S2–16 and HCM immunized Lewis rats to synthetic S2 peptides. Sera were collected from S2–16 and HCM immunized Lewis rats at day 21. The reaction of IgG Ab to 32 overlapping synthetic peptides of the HCM S2 region were measured by ELISA. Multiple serum dilutions were tested, but the serum dilution used for this figure was 1/200. Error bars represent SEMs. The same assay was also performed for PBS/CFA immunized control Lewis rats. No peptide-specific IgG response was observed in control rats (OD 0.3–0.5) with each peptide. RCM immunized Lewis rats demonstrated little response against the S2 peptides similar to that shown for HCM (data not shown).

 


View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Proliferative responses of splenic lymphocytes from Lewis rats immunized with S2–16, HCM, RCM, and PBS in CFA. Lymphocytes taken from spleens at day 21 were cultured in vitro with each of 32 overlapping S2 peptides. Results of proliferative assay were expressed as stimulation index = (mean test cpm/mean of medium control cpm) ± SEM. Results presented represent an average of 3–5 independent experiments. A mean SI >= 2 was considered positive.

 
Lymphocytes from spleens of S2–16 and HCM immunized rats were stimulated in vitro with overlapping synthetic peptides of the S2 fragment of HCM or the native Ag HCM, and proliferative responses were measured by tritiated thymidine incorporation. Lymphocytes from S2–16 immunized rats proliferated with a stimulation index greater than 2 in response to S2–16, S2–17, S2–22, S2–28, S2–29, S2–31, and S2–32, but not HCM, whereas lymphocytes from HCM immunized rats proliferated in the presence of S2–28, S2–29, S2–31, S2–32, and HCM (Fig. 4). As a comparison, lymphocytes from RCM immunized rats proliferated to S2–10, S2–15, S2–21, S2–22, S2–27, S2–28, S2–29, S2–31, S2–32, and HCM, but not S2–16 (Fig. 4). Lymphocytes from adjuvant control rats did not proliferate in response to any S2 peptides. T cells primed with intact RCM and HCM did not recognize and respond in proliferation assays to the S2–16 peptide (Fig. 4), even when S2–16 was given at higher concentrations (data not shown), indicating that S2–16 is a cryptic epitope of both RCM and HCM. The definition of a cryptic epitope is an epitope not recognized by Ab or T cells of animals immunized with intact Ag (40). The immune dominant epitope of both RCM and HCM was observed in peptide S2–28/S2–29 (Fig. 4). Furthermore, S2–16- and cardiac myosin-primed T cells had common S2 peptide reactivity in peptides S2–28, S2–29, S2–31, and S2–32. A similar lymphocyte proliferation response pattern was also observed at day 14 and at day 28 of disease (data not shown).

To define the Ag specificity of S2–16 sensitized T cells, a series of modified S2–16 peptides and HCM were tested in vitro for their capacity to induce proliferative responses by splenocytes from S2–16 immunized rats. Human S2–16 peptide, and rat S2–16 peptide as well as truncated S2–16d, the truncated identical sequence of rat and human S2–16, stimulated strong recall proliferative responses in an Ag dose-dependent pattern (Fig. 5A). T cells primed with S2–16 did not respond well to HCM (Fig. 5A) and RCM (data not shown). The three 11-mer truncated peptides tS2–16a, tS2–16b, and tS2–16c were nonstimulatory, which was consistent with the absence of pathogenicity of these 11-mer S2 peptides.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Proliferative responses of lymphocytes from spleens of Lewis rats immunized with S2–16. A, Lymphocytes were isolated from Lewis rats at 21 days after immunization with S2–16, and cultured in vitro with S2–16, rS2–16, and truncated 11-mer peptides tS2–16a, tS2–16b, tS2–16c, and tS2–16d. Ags were added to a final concentration from 0.1 µg/ml to 100 µg/ml. Results of proliferative assays were expressed as stimulation index = (mean test cpm/mean of medium control cpm) and represent averages of three independent experiments. B, MHC restriction of S2–16 response. Abs against rat MHC class II molecule RT1.B (OX-6), RTI.D (OX-17), as well as an isotype control Ab mouse IgG1 (mIgG1) were added to the cell culture when testing the recall response of splenocytes from S2–16 immunized rats ({blacksquare}) and HCM immunized rats (). The Ags S2–16 and HCM were used respectively in the proliferative assay. The percentage of inhibition of proliferation by Ab was calculated relative to the SI without Ab addition. Data are representative of three to five experiments. Error bars represent SEMs, and Student’s t test was used to determine the significant differences between anti-RT1.B or anti-RT1.D and an isotype control Ab mouse IgG1 inhibition (*, p <= 0.05; ***, p <= 0.0005).

 
MHC restriction indicates dual recognition of S2–16 and HCM by RT1.B and RT1.D

To characterize the MHC restriction of the S2–16 specific in vitro lymphocyte response and compare it with that of HCM-induced lymphocyte response, Abs against rat MHC class II RT1.B (OX-6) and RT1. D (OX-17) loci were added into S2–16 and HCM stimulated splenocyte culture. As shown in Fig. 5B, the addition of both RT1.B and RT1.D blocking Abs substantially reduced proliferation responses initiated by S2–16 as well as HCM, compared with the control mouse IgG1 Ab addition (p < 0.05). Therefore, both S2–16 peptide and HCM were presented by MHC class II RT1.B and RT1.D molecules.

Cytokine expression of S2 and HCM immunized rats

To determine the cytokine profile in S2–16-induced EAM and compare it with that of HCM-induced EAM, RT-PCR of inflammatory cytokine genes were performed by using RNA isolated from the myocardium of S2–16 and HCM immunized rats, as well as myocardium of adjuvant control rats. Marked mRNA expression of IL-6, IL-2, IL-12, IFN-{gamma}, TNF-{alpha}, and IL-10 were detected in the maximum inflammatory phase (day 21), in the myocardium of both S2–16 and HCM immunized rats, but not in myocardium of control rats. IL-6 and IL-12 gene expression was also observed on day 14 in S2–16 and HCM immunized rats (Fig. 6A). In addition, S2–16 stimulated spleen cells from S2–16 immunized rats (day 21) secreted significantly higher levels of IFN-{gamma} (p < 0.005), IL-2, and TNF-{alpha} (p < 0.05), compared with cells from PBS/CFA only injected rats. In contrast, there was no significant difference in IL-10 production for these two groups of rats when cell culture supernatants were assayed by cytokine-specific ELISA (Fig. 6B). The production of IL-4 by splenocytes from S2–16/CFA and PBS/CFA immunized rats was virtually nondetectable (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 6. Cytokine mRNA expression in S2–16, HCM, and PBS immunized rat heart as detected by RT-PCR. A, Poly(A)+ RNA was extracted from hearts of each group of rats, and was reverse transcribed using oligo(dT) primers. Reverse transcriptase reaction (10%) was used in PCR to detect the presence of the indicated cytokine mRNA. Cytokine mRNA expression (lanes 1–3) in day 14 hearts of immunized rats and that of day 21 hearts (lanes 4–6) of immunized rats. Control rats (lanes 1 and 4), HCM immunized rats (lanes 2 and 5), and S2–16 immunized rats (lanes 3 and 6) are shown. Size of the amplified fragments are indicated to the right and were determined by comparison to DNA standards separated by electrophoresis on the same gel. B, Cytokine production in cell culture supernatant. Spleen cells were collected after Lewis rats were immunized with S2–16 in CFA or CFA only were sacrificed on day 21 and were cultured in the presence of medium alone or medium containing S2–16. Cytokine levels were assayed in 24 h (IL-2), or 48 h (IL-4, IL-10, TNF-{alpha}, and IFN-{gamma}) culture supernatants by cytokine-specific ELISA. Data are representative of three independent experiments. Error bars represent SEMs, and Student’s t test was used to determine the significant differences between S2–16/CFA immunized group and CFA only injected group. *, p <= 0.05, **, p <= 0.005. Cytokine levels of cells cultured with medium alone were below 20% of specific response (data not shown).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously reported that myocarditic epitopes for the Lewis rat were located within the rod region of cardiac myosin in S2 and LMM with the most pathogenic epitopes located in the S2 subfragment (38). In this study, we identified a peptide in the cardiac myosin S2 region (residues 1052 to 1076) that induced autoimmune myocarditis in the Lewis rat following immunization. Our results demonstrated that myocarditis induced by the S2–16 peptide was as severe as and indistinguishable from the disease induced by HCM. Characterization of the myocarditic S2–16 determinant showed that the length of the pathogenic S2–16 epitope could be reduced from a 25-amino acid sequence to a 22-amino acid sequence containing residues 1052 to 1073, an identical amino acid sequence in both RCM and HCM. The myocarditic character of the S2–16 epitope was closely associated with cellular immune responses against S2–16, as shown by in vitro T cell recall responses in myocarditic animals and passive transfer of myocarditis by S2–16 primed T cells.

Previously in the rat EAM model, Wegmann et al. (31) reported two synthetic peptides corresponding to amino acids 1304–1320 and 1539–1555 in LMM of RCM {alpha}H chain which induced myocarditis. However, their pathogenicity required enhancement by acetylation of the N-terminal amino acids. In our studies of LMM peptides, it was clear that in comparison to the S2 fragment that the LMM peptides produced milder disease (38). Using enzymatically digested porcine cardiac myosin fragments, Inomata et al. (32) identified a myocarditic epitope located within a 96 amino acid fragment of cardiac myosin S2 region residues 1070–1165. Kohno et al. (36) used recombinant technology to further determine that residues 1124–1153 of cardiac myosin S2 region could induce severe myocarditis in Lewis rats. In addition, they showed both {beta} and {alpha}H chains of cardiac myosin could provoke active myocarditis in the Lewis rat (37). Although we did not find a myocarditic epitope within residues 1070–1165 in our panel of peptides (S2–21 to S2–24), this may be explained by different Ag processing of the fragments of cardiac myosin in a 96 residue fragment that may be presented in a different way than our 25-mer peptides. The 11 amino acid overlap in our synthetic peptides was used as an attempt to prevent loss of epitopes, but in our peptides the 1070–1165 epitope was apparently lost.

The synthetic overlapping peptides of the S2 region used in this study were made according to the amino acid sequence of HCM {beta}-chain, which is the dominant isoform in human ventricle tissue. RCM {alpha}H chain, the dominant isoform for adult rat heart, and HCM {beta}H chain are 93% identical and 98% homologous in amino acid sequence. The myocarditic 22-mer within the S2–16 peptide (residues 1052–1073) has exactly the same amino acid sequence in both RCM and HCM H chains. Although the S2 peptides contain HCM sequences, they were successful in identifying a myocarditic epitope identical in RCM and HCM.

To determine whether the myocarditic nature of the S2–16 peptide was specific to the susceptible Lewis strain and restricted to certain MHC class II molecules for Ag presentation, we immunized three other different rat strains with the S2–16 peptide. The S2–16 peptide induced marked myocarditis in the Lewis rat, but not in the other three strains of rats. The reduced pathogenicity of S2–16 in other rat strains might be due to their different MHC haplotypes. S2–16 immunized F344 rats, which express same RT1-B/D (rat MHC class II) but are different in RT1-C/E/M (rat MHC telomeric class I region), did not develop marked myocarditis, which suggested that factors in addition to the RT1-B/D may contribute to the development of myocarditis after S2–16 immunization. In the rat model of experimental allergic encephalomyelitis, it was shown that congenic BN-1L rats, which have LEW MHC on a BN-derived background, similar to the wild-type BN rats, were resistant to experimental allergic encephalomyelitis. This non-MHC encoded resistance was associated with the ability to produce regulatory cytokines such as TGF-{beta} and increased frequency of CD45RClow regulatory CD4+ T cells (41). Our study showed that S2–16-specific T cells were present not only in the Lewis rat, but also in the resistant strains such as BB/DR and F344 rats. However, S2–16-specific recall responses in the Lewis rat were much stronger than those in the resistant rats (Fig. 2). This might be due to the existence of higher quantity or affinity of S2–16-specific T cells in Lewis rats. Although the MHC-class II restriction of S2–16 presentation was suggested by in vitro anti-RT1.B and anti-RT1.D blocking experiments, both MHC-linked and non-MHC-linked mechanisms, such as the nature of the S2–16-specific T cell repertoire, should be considered in the susceptibility of the Lewis rat strain and the resistance of 3 other rat strains to the S2–16 induced myocarditis.

Numerous studies have demonstrated the importance of cellular immunity in autoimmune myocarditis (8, 24, 25). T cell infiltration of myocardium has been demonstrated following immunization with cardiac myosin or its myocarditic epitopes (6, 10, 22, 31, 42, 43). In our study, we characterized T cell responses after S2–16 and cardiac myosin immunization and found that S2–16 was a cryptic determinant of cardiac myosin. Peptide S2–16 was incapable of inducing proliferative responses of T cells from rats immunized with HCM or RCM, and HCM or RCM did not strongly stimulate S2–16 sensitized T cells (Fig. 4 and Fig. 5A). It should be noted that cardiac myosin, in contrast to the S2–16 peptide, was not a strong Ag in vitro in our proliferation assays because in HCM or RCM immunized rats, the response to cardiac myosin was moderate (Fig. 4). The cryptic nature of the S2–16 Ag was also suggested by B cell responses in cardiac myosin immunized rats (Fig. 3). S2–16 was not recognized by HCM induced Abs, although IgG Abs against cardiac myosin were produced after S2–16 immunization as detected in the ELISA and Western immunoblot when using high sera concentrations (data not shown). This may suggest that T cell-dependent B cell recognition of cardiac myosin was induced after S2–16 immunization.

Although cryptic epitopes may not be exposed after native Ag priming and processing, they may play an important role in perpetuation of chronic inflammatory disease due to epitope spreading or mimicry within cardiac myosin. Our data show that both cardiac myosin and S2–16 sensitization induced T cell responses against common epitopes such as S2–28, S2–29, S2–31, and S2–32. B cell Ab responses were directed against S2–16 and S2–4, S2–17 and S2–18 as well which were different from the T cell epitopes. A similar B and T cell response pattern was observed during the early and late phases of myocarditis in the Lewis rats, which suggested that the multiple peptide reaction of S2–16 primed T cells or Abs may not be due to the epitope spreading. The amino acid sequence alignments of S2–16 and S2–28 and S2–31/S2–32 peptides shows 40% identity and 70–80% homology between S2–16 and these peptides in a 15 amino acid overlap. The data support a cross-reactive response at the T cell level that may be due to epitope mimicry within cardiac myosin. When we immunized rats with peptide S2–28, a lower disease incidence (30%) and milder infiltrate than S2–16 and intact cardiac myosin immunization were observed (data not shown). S2–28 was the most dominant epitope in proliferation assays of lymphocytes from HCM and RCM immunized rats (Fig. 4). This result was consistent with the hypothesis that undeleted T cells specific to the dominant S2–28 epitope of cardiac myosin might have been partially tolerized in the Lewis rat. The data support the mechanism that cryptic epitope S2–16 may induce disease in part by activation of T cells specific for the dominant epitope S2–28 as well as against itself. However, we did not detect a T cell proliferative response to S2–16 when rats were immunized with S2–28 in our model system (data not shown). The data suggest that T cells specific for S2–16 can recognize S2–28 but not vice versa. T cell degeneracy could also be a mechanism by which S2–16 sensitized T cells recognize S2–28 (44).

In addition to T cell repertoire recognition of myocarditic epitopes, other factors such as activation of APCs and the local production of cytokines may influence and perpetuate autoimmune reactivity in vivo (18, 21, 45, 46). Normal heart may not be susceptible to autoreactive T cell attack unless interstitial APCs of myocardium are activated and up-regulate their surface MHC class II expression, which is mediated through the cytokines such as IFN-{gamma} and TNF-{alpha} (46, 47, 48, 49). We demonstrated that in S2–16-induced EAM, a high level of inflammatory cytokines including IL-6, IL-12, TNF-{alpha}, IL-2, and IFN-{gamma} were expressed in the myocardium after S2–16 immunization, which was similar to the cytokine expression pattern in HCM treated Lewis rats myocardium. Although IL-10 mRNA from myocardium was also detected on day 21 for rats immunized with S2–16 or HCM, the up-regulation of IL-10 production by S2–16 sensitized T cells at or before day 21 was not detected. Our data suggest that at the induction phase of S2–16-induced EAM, cytokines induced by TH1 cells were predominant. TH1 cytokines expressed in S2–16-induced EAM are in contrast to certain mouse models of EAM in which TH2 cytokine production is associated with myocarditis induction (16, 29).

In conclusion, our study identified a strong pathogenic cryptic epitope of cardiac myosin that induced EAM in the Lewis rat. Disease induction was closely associated with Ag-specific T cell reactivities, MHC complex restriction and other non-MHC factors, and inflammatory cytokine expression. Because the S2–16 epitope stimulates such a strong T cell response, it may be an ideal peptide ligand for the study of T cell degeneracy in myocarditis (44). The highly myocarditic peptide S2–16 will continue to be useful in the investigation of the role of epitope mimicry or spreading in the progression of myocarditis, as well as for a better understanding the mechanisms in disease or immune tolerance and for the design of immunotherapies for myocarditis.


    Footnotes
 
1 This work is supported by Grant HL 56267 from the National Heart, Lung, and Blood Institute and the American Heart Association. M.W.C. is the recipient of a National Heart, Lung, and Blood Institute Merit Award, and Y.L. is the recipient of an American Heart Association predoctoral fellowship. Back

2 Address correspondence and reprint requests to Dr. Madeleine W. Cunningham, Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Room 217, 975 NE 10th Street, Oklahoma City, Oklahoma 73104. E-mail address: madeleine-cunningham{at}ouhsc.edu Back

3 Abbreviations used in this paper: EAM, experimental autoimmune myocarditis; HCM, human cardiac myosin; RCM, rat cardiac myosin; LMM, light meromyosin. Back

Received for publication April 28, 2003. Accepted for publication December 18, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Herskowitz, A., K. W. Beisel, L. J. Wolfgram, N. R. Rose. 1985. Coxsackievirus B3 murine myocarditis: wide pathologic spectrum in genetically defined inbred strains. Hum. Pathol. 16:671.[Medline]
  2. Leslie, K., R. Blay, C. Haisch, A. Lodge, A. Weller, S. Huber. 1989. Clinical and experimental aspects of viral myocarditis. Clin. Microbiol. Rev. 2:191.[Abstract/Free Full Text]
  3. McManus, B. M., L. H. Chow, J. E. Wilson, D. R. Anderson, J. M. Gulizia, C. J. Gauntt, K. E. Klingel, K. W. Beisel, R. Kandolf. 1993. Direct myocardial injury by enterovirus: a central role in the evolution of murine myocarditis. Clin. Immunol. Immunopathol. 68:159.[Medline]
  4. Herskowitz, A., S. Willoughby, T. C. Wu, W. E. Beschorner, D. A. Neumann, N. R. Rose, K. L. Baughman, A. A. Ansari. 1993. Immunopathogenesis of HIV-1-associated cardiomyopathy. Clin. Immunol. Immunopathol. 68:234.[Medline]
  5. Fairweather, D., C. M. Lawson, A. J. Chapman, C. M. Brown, T. W. Booth, J. M. Papadimitriou, G. R. Shellam. 1998. Wild isolates of murine cytomegalovirus induce myocarditis and antibodies that cross-react with virus and cardiac myosin. Immunology 94:263.[Medline]
  6. Neu, N., N. R. Rose, K. W. Beisel, A. Herskowitz, G. Gurri-Glass, S. W. Craig. 1987. Cardiac myosin induces myocarditis in genetically predisposed mice. J. Immunol. 139:3630.[Abstract]
  7. Neumann, D. A., C. L. Burek, K. L. Baughman, N. R. Rose, A. Herskowitz. 1990. Circulating heart-reactive antibodies in patients with myocarditis or cardiomyopathy. J. Am. Coll. Cardiol. 16:839.
  8. Smith, S. C., P. M. Allen. 1991. Myosin-induced acute myocarditis is a T cell-mediated disease. J. Immunol. 147:2141.[Abstract]
  9. Brown, C. A., J. B. O’Connell. 1995. Myocarditis and idiopathic dilated cardiomyopathy. Am. J. Med. 99:309.[Medline]
  10. Donermeyer, D. L., K. W. Beisel, P. M. Allen, S. C. Smith. 1995. Myocarditis-inducing epitope of myosin binds constitutively and stably to I-Ak on antigen-presenting cells in the heart. J. Exp. Med. 182:1291.[Abstract/Free Full Text]
  11. Lawson, C. M., H. L. O’Donoghue, W. D. Reed. 1992. Mouse cytomegalovirus infection induces antibodies which cross-react with virus and cardiac myosin: a model for the study of molecular mimicry in the pathogenesis of viral myocarditis. Immunology 75:513.[Medline]
  12. Gauntt, C. J., H. M. Arizpe, A. L. Higdon, H. J. Wood, D. F. Bowers, M. M. Rozek, R. Crawley. 1995. Molecular mimicry, anti-coxsackievirus B3 neutralizing monoclonal antibodies, and myocarditis. J. Immunol. 154:2983.[Abstract]
  13. Huber, S. A., C. J. Gauntt, P. Sakkinen. 1998. Enteroviruses and myocarditis: viral pathogenesis through replication, cytokine induction, and immunopathogenicity. Adv. Virus Res. 51:35.[Medline]
  14. Hill, S. L., N. R. Rose. 2001. The transition from viral to autoimmune myocarditis. Autoimmunity 34:169.[Medline]
  15. Shevach, E. M.. 2000. Regulatory T cells in autoimmmunity. Annu. Rev. Immunol. 18:423.[Medline]
  16. Cunningham, M. W.. 2001. Cardiac myosin and the TH1/TH2 paradigm in autoimmune myocarditis [comment]. Am. J. Pathol. 159:5.[Free Full Text]
  17. Kaya, Z., M. Afanasyeva, Y. Wang, K. M. Dohmen, J. Schlichting, T. Tretter, D. Fairweather, V. M. Holers, N. R. Rose. 2001. Contribution of the innate immune system to autoimmune myocarditis: a role for complement. Nat. Immun. 2:739.
  18. Lane, J. R., D. A. Neumann, A. Lafond-Walker, A. Herskowitz, N. R. Rose. 1992. Interleukin 1 or tumor necrosis factor can promote Coxsackie B3-induced myocarditis in resistant B10.A mice. J. Exp. Med. 175:1123.[Abstract/Free Full Text]
  19. Neumann, D. A., J. R. Lane, G. S. Allen, A. Herskowitz, N. R. Rose. 1993. Viral myocarditis leading to cardiomyopathy: do cytokines contribute to pathogenesis?. Clin. Immunol. Immunopathol. 68:181.[Medline]
  20. Afanasyeva, M., Y. Wang, Z. Kaya, E. A. Stafford, K. M. Dohmen, A. A. Sadighi Akha, N. R. Rose. 2001. Interleukin-12 receptor/STAT4 signaling is required for the development of autoimmune myocarditis in mice by an interferon-{gamma}-independent pathway. Circulation 104:3145.[Abstract/Free Full Text]
  21. Okura, Y., T. Kazuyoshi, S. Honda, H. Hanawa, H. Watanabe, M. Kodama, T. Izumi, Y. Aizawa, S. Seki, T. Abo, T. . 1998. Recombinant murine interleukin-12 facilitates induction of cardiac myosin-specific type 1 helper T cells in rats. Circ. Res. 82:1035.[Abstract/Free Full Text]
  22. Kodama, M., Y. Matsumoto, M. Fujiwara, F. Masani, T. Izumi, A. Shibata. 1990. A novel experimental model of giant cell myocarditis induced in rats by immunization with cardiac myosin fraction. Clin. Immunol. Immunopathol. 57:250.[Medline]
  23. Jones, W. K., J. Gulick, S. Wert, J. Neumann, J. Robbins, C. Pummerer. 1991. Cellular infiltrate, major histocompatibility antigen expression and immunopathogenic mechanisms in cardiac myosin-induced myocarditis. J. Biol. Chem. 266:24613.[Abstract/Free Full Text]
  24. Smith, S. C., P. M. Allen. 1993. The role of T cells in myosin-induced autoimmune myocarditis. Clin. Immunol. Immunopathol. 68:100.[Medline]
  25. Kodama, M., Y. Matsumoto, M. Fujiwara. 1992. In vivo lymphocyte-mediated myocardial injuries demonstrated by adoptive transfer of experimental autoimmune myocarditis. Circulation 85:1918.[Abstract/Free Full Text]
  26. Neu, N., K. W. Beisel, M. D. Traystman, N. R. Rose, S. W. Craig. 1987. Autoantibodies specific for the cardiac myosin isoform are found in mice susceptible to Coxsackievirus B3-induced myocarditis. J. Immunol. 138:2488.[Abstract]
  27. Neumann, D. A., J. R. Lane, S. M. Wulff, G. S. Allen, A. LaFond-Walker, A. Herskowitz, N. R. Rose. 1992. In vivo deposition of myosin-specific autoantibodies in the hearts of mice with experimental autoimmune myocarditis. J. Immunol. 148:3806.[Abstract]
  28. Liao, L., R. Sindhwani, M. Rojkind, S. Factor, L. Leinwand, B. Diamond. 1995. Antibody-mediated autoimmune myocarditis depends on genetically determined target organ sensitivity. J. Exp. Med. 181:1123.[Abstract/Free Full Text]
  29. Afanasyeva, M., Y. Wang, Z. Kaya, S. Park, J. Zilliox, B. H. Schofield, S. L. Hill, N. R. Rose. 2001. Experimental autoimmune myocarditis in A/J mice is an interleukin-4-dependent disease with a Th2 phenotype. Am. J. Pathol. 159:193.[Abstract/Free Full Text]
  30. Watanabe, K., M. Nakazawa, K. Fuse, H. Hanawa, M. Kodama, Y. Aizawa, T. Ohnuki, F. Gejyo, H. Maruyama, J. Miyazaki. 2001. Protection against autoimmune myocarditis by gene transfer of interleukin-10 by electroporation. Circulation 104:1098.[Abstract/Free Full Text]
  31. Wegmann, K. W., W. Zhao, A. C. Griffin, W. F. Hickey. 1994. Identification of myocarditogenic peptides derived from cardiac myosin capable of inducing experimental allergic myocarditis in the Lewis rat: the utility of a class II binding motif in selecting self-reactive peptides. J. Immunol. 153:892.[Abstract]
  32. Inomata, T., H. Hanawa, T. Miyanishi, E. Yajima, S. Nakayama, T. Maita, M. Kodama, T. Izumi, A. Shibata, T. Abo. 1995. Localization of porcine cardiac myosin epitopes that induce experimental autoimmune myocarditis. Circ. Res. 76:726.
  33. Pummerer, C. L., K. Luze, G. Grassl, K. Bachmaier, F. Offner, S. K. Burrell, D. M. Lenz, T. J. Zamborelli, J. M. Penninger, N. Neu. 1996. Identification of cardiac myosin peptides capable of inducing autoimmune myocarditis in BALB/c mice. J. Clin. Invest. 97:2057.[Medline]
  34. Liao, L., R. Sindhwani, L. Leinwand, B. Diamond, S. Factor. 1993. Cardiac {alpha}-myosin heavy chains differ in their induction of myocarditis: identification of pathogenic epitopes. J. Clin. Invest. 92:2877.
  35. Bachmaier, K., N. Neu, R. S. Yeung, T. W. Mak, P. Liu, J. M. Penninger. 1999. Generation of humanized mice susceptible to peptide-induced inflammatory heart disease. Circulation 99:1885.[Abstract/Free Full Text]
  36. Kohno, K., Y. Takagaki, Y. Nakajima, T. Izumi. 2000. Advantage of recombinant technology for the identification of cardiac myosin epitope of severe autoimmune myocarditis in Lewis rats. Jpn. Heart J. 41:67.[Medline]
  37. Kohno, K., Y. Takagaki, N. Aoyama, H. Yokoyama, H. Takehana, T. Izumi. 2001. A peptide fragment of {beta} cardiac myosin heavy chain ({beta}-CMHC) can provoke autoimmune myocarditis as well as the corresponding {alpha} cardiac myosin heavy chain ({alpha}-CMHC) fragment. Autoimmunity 34:177.[Medline]
  38. Galvin, J. E., M. E. Hemric, S. D. Kosanke, S. M. Factor, A. Quinn, M. W. Cunningham. 2002. Induction of myocarditis and valvulitis in Lewis rats by different epitopes of cardiac myosin and its implications in rheumatic carditis. Am. J. Pathol. 160:297.[Abstract/Free Full Text]
  39. Tobacman, L. S., R. S. Adelstein. 1984. Enzymatic comparisons between light chain isozymes of human cardiac myosin subfragment-1. J. Biol. Chem. 259:11226.[Abstract/Free Full Text]
  40. Sercarz, E. E., P. V. Lehmann, A. Ametani, G. Benichou, A. Miller, K. Moudgil. 1993. Dominance and crypticity of T cell antigenic determinants. Annu. Rev. Immunol. 11:729.[Medline]
  41. Cautain, B., J. Damoiseaux, I. Bernard, H. van Straaten, P. van Breda Vriesman, B. Boneu, P. Druet, A. Saoudi. 2001. Essential role of TGF-{beta} in the natural resistance to experimental allergic encephalomyelitis in rats. Eur. J. Immunol. 31:1132.[Medline]
  42. Tsuchida, T., R. V. Turner, K. C. Parker, J. E. Coligan, W. E. Biddison, H. Hanawa. 1993. Characterization of T cells infiltrating the heart in rats with experimental autoimmune myocarditis: their similarity to extrathymic T cells in mice and the site of proliferation. J. Immunol. 151:5930.[Abstract]
  43. Neu, N., E. Timms, V. A. Wallace, D. R. Koh, K. Kishihara, C. Pummerer, T. W. Mak. 1993. T cells in cardiac myosin-induced myocarditis. J. Exp. Med. 178:1837.[Abstract/Free Full Text]
  44. Hemmer, B.. 1997. Identification of high potency microbial and self ligands for a human autoreactive class II-restricted T cell clone. J. Exp. Med. 185:1651.[Abstract/Free Full Text]
  45. Lane, J. R., D. A. Neumann, A. Lafond-Walker, A. Herskowitz, N. R. Rose. 1991. LPS promotes CB3-induced myocarditis in resistant B10.A mice. Cell. Immunol. 136:219.[Medline]
  46. Pummerer, C. L., G. Grassl, M. Sailer, K. W. Bachmaier, J. M. Penninger, N. Neu. 1996. Cardiac myosin-induced myocarditis: target recognition by autoreactive T cells requires prior activation of cardiac interstitial cells. Lab. Invest. 74:845.[Medline]
  47. Pummerer, C., P. Berger, M. Fruhwirth, C. Ofner, N. Neu. 1991. Cellular infiltrate, major histocompatibility antigen expression and immunopathogenic mechanisms in cardiac myosin-induced myocarditis. Lab. Invest. 65:538.[Medline]
  48. Smith, S. C., P. M. Allen. 1992. Expression of myosin-class II major histocompatibility complexes in the normal myocardium occurs before induction of autoimmune myocarditis. Proc. Natl. Acad. Sci. USA 89:9131.[Abstract/Free Full Text]
  49. Cockfield, S. M., V. Ramassar, P. F. Halloran. 1993. Regulation of IFN-{gamma} and tumor necrosis factor-{alpha} expression in vivo: effects of cycloheximide and cyclosporine in normal and lipopolysaccharide-treated mice. J. Immunol. 150:342.[Abstract]
  50. Jaenicke, T., K. W. Diederich, W. Haas, J. Schleich, P. Lichter, M. Pfordt, A. Bach, H. P. Vosberg. 1990. The complete sequence of the human {beta}-myosin heavy chain gene and a comparative analysis of its product. Genomics 8:194.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
P. Zhang, C. J. Cox, K. M. Alvarez, and M. W. Cunningham
Cutting Edge: Cardiac Myosin Activates Innate Immune Responses through TLRs
J. Immunol., July 1, 2009; 183(1): 27 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Li, J. S. Heuser, L. C. Cunningham, S. D. Kosanke, and M. W. Cunningham
Mimicry and Antibody-Mediated Cell Signaling in Autoimmune Myocarditis
J. Immunol., December 1, 2006; 177(11): 8234 - 8240.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
L. T. Cooper, R. Virmani, N. M. Chapman, A. Frustaci, R. J. Rodeheffer, M. W. Cunningham, and D. M. McNamara
National Institutes of Health-Sponsored Workshop on Inflammation and Immunity in Dilated Cardiomyopathy
Mayo Clin. Proc., February 1, 2006; 81(2): 199 - 204.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. M. J. Ellis, Y. Li, W. Hildebrand, V. A. Fischetti, and M. W. Cunningham
T Cell Mimicry and Epitope Specificity of Cross-Reactive T Cell Clones from Rheumatic Heart Disease
J. Immunol., October 15, 2005; 175(8): 5448 - 5456.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
J. D. Fett
Peripartum cardiomyopathy (PPCM) in both surrogate and biological mother
Hum. Reprod., September 1, 2005; 20(9): 2666 - 2668.
[Full Text] [PDF]


Home page
J. Immunol.Home page
F. Mor, M. Izak, and I. R. Cohen
Identification of Aldolase as a Target Antigen in Alzheimer's Disease
J. Immunol., September 1, 2005; 175(5): 3439 - 3445.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham
Protection against Experimental Autoimmune Myocarditis Is Mediated by Interleukin-10-Producing T Cells that Are Controlled by Dendritic Cells
Am. J. Pathol., July 1, 2005; 167(1): 5 - 15.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Cunningham, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Cunningham, M. W.
Right arrowPubmed/NCBI databases
Medline Plus Health Information
*Cardiomyopathy


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS