|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
* Section of Rheumatology, Department of Internal Medicine, and Section of Immunobiology, Yale University School of Medicine, New Haven, CT 06520;
Department of Pathology, Immunology, and Laboratory Medicine, College of Medicine, University of Florida, Gainesville, FL 32610; and
North Florida South Georgia Veterans Health System, Gainesville, FL 32608
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A large number of disease susceptibility loci have been identified from several independent screens using various inbred lupus-prone mouse strains that develop lupus. Of these loci, several chromosomal regions stand out, as they were picked up in multiple screens. These include regions on chromosomes 1, 4, 7, and 17 (4). The fact that loci overlap at these positions may point to their importance in lupus etiology; however, their exact significance remains to be determined. In particular, it is not clear whether these represent the same genes involved in pathogenesis in different strains, or different genes falling into the same proximity by chance or evolution. What is clear is that these particular regions have the strongest links to lupus, and combinations of them are sufficient for lupus development (7, 8). Sometimes these loci have a measurable effect on the immune system in isolation, as demonstrated by the construction of various congenic animals that carry them on nonautoimmune backgrounds, such as C57BL/6 (B6) (9, 10). This indeed has been a fruitful approach, as illustrated by the recent identification of candidate genes on chromosome 1. Cr2 (the gene encoding for complement receptor 1/2) from NZM2410 was found to contain a single nucleotide substitution that affects its ligand binding and downstream signaling (11); it was identified by the positional cloning strategy. Ifi202, a member of the IFN-inducible family at the distal end of chromosome 1, was identified through gene expression profile analysis subsequent to a genome-wide screen. It is believed that a polymorphism in the promoter leads to altered expression levels and lupus susceptibility (9).
The current study focuses on another locus that has been picked up in multiple screens. The centromeric region of chromosome 7 was identified as Lmb3 in the Fas-deficient MRL-Faslpr strain (12, 13), and as Sle3/5 in the NZM2410 strain (6). The former was linked to lymphadenopathy, splenomegaly, and anti-dsDNA Abs, while the latter was associated with glomerulonephritis (GN) and with anti-dsDNA Ab synthesis. Subsequently, it has been shown that congenic animals carrying Sle3/5 on the B6 background exhibited altered T cell phenotype in vitro and in vivo (14), suggesting a cellular basis for lupus association in this model, although it is not clear whether the altered phenotype is intrinsic to T cells, or secondary to other cellular defects (15).
The molecular bases of lupus susceptibility for either Lmb3 from the MRL-Faslpr or Sle3/5 from the NZM2410 strains have not been elucidated, and it is not known whether these two overlapping regions carry the same genetic lesion(s). To begin to address these questions, we have generated mice that carry Lmb3 from MRL-Faslpr animals (B6.MRLc7 congenic animals). We find that this locus promotes the lupus phenotype of B6-Faslpr mice, with enhanced autoantibody production, GN, T cell activation, and CD4-CD8- double-negative T cell accumulation. By contrast, in Fas-intact animals, overt lupus traits were not observed. We conclude that this locus carries genetic factors that interact with Fas deficiency and enhance lupus susceptibility. Furthermore, the divergent cellular phenotype seen in our B6.MRLc7 congenics compared with B6.Sle3 animals suggests that the genes involved in Lmb3 are probably different from those in Sle3/5, despite extensive overlap between the two loci.
| Materials and Methods |
|---|
|
|
|---|
B6, MRL/MpJ (MRL), and B6.MRL-Tnfrsf6lpr (B6.lpr) animals were obtained from The Jackson Laboratory (Bar Harbor, ME) and subsequently bred in the animal facilities in University of Florida and Yale School of Medicine. The B6.MRLc7 congenic strain was produced from a series of four successive (B6 x MRL) x B6 crosses by marker-assisted selection (16). The centromeric portion of chromosome 7 was selected with the D7MIT178, D7MIT79, and D7MIT211 microsatellite markers, located at 0.5, 16.0, and 27.8 cM from the centromere, respectively (sequences available on http://www.informatics.jax.org). The resulting congenic interval is shown on Fig. 1. All animals used were MRL across the entire chromosomal region of interest. Unlinked MRL genome was selected against using three markers per chromosome, with special attention for the other MRL loci, Lmb1 on chromosome 4, Lmd2 on chromosome 5, and Lmb4 on chromosome 10 (13). The residual unselected MRL contribution was less than 2%. B6.MRLc7.Faslpr was obtained by intercrossing B6.MRLc7 and B6.Faslpr, and simultaneous selection for the C7 interval and the lpr mutation (Fas forward primer, CAAGCCGTGCCCTAGGAAACACAG, and reverse primer, GCAGAGATGCTAAGCAGCAGCCGG, and a reverse primer specific for the lpr allele, GTGGAGCTCCAATGCAGCGTTCCT). The bicongenic strain B6.NZM.Sle1.MRL.c7 (Sle1.c7) was obtained by intercrossing B6.Sle1 (10) and B6.MRLc7.
|
Serology
Serum was collected by retro-orbital bleeding every 3 mo until sacrifice. Samples were frozen at -20°C until use, when they were diluted to predetermined concentrations for ELISA. Quantification was achieved with either a standard curve (total IgM, IgG) or an MRL-Faslpr or NZM2410 serum sample as an internal standard (Ag-specific autoantibodies) for interplate comparison. Sandwich ELISA was used for determining the titers of Abs (17). For total serum IgM and IgG, plates were coated with the appropriate capture Ab, and blocked with BSA. Diluted sera, as well as serially diluted IgM and IgG standards, were added to the plates and allowed to bind overnight, followed by addition of HRP-coupled secondary Abs. A total of 50 µl of tetramethylbenzidine substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD) was added to the plates, which were incubated at room temperature before the reaction was stopped and read at 450 nm. Similar procedures were used for determining Ag-specific autoantibodies, except that the plates were coated with the target Ag, methylated BSA, dsDNA complex, dsDNA-histone complex (chromatin) (18), purified small nuclear ribonucleoprotein (snRNP) particles (19), or a mouse IgG2a mAb (for rheumatoid factors). Ig concentrations, or relative OD 450, for serum from each animal were plotted individually.
Kidney histology
Kidneys were extracted from animals immediately after sacrifice and fixed in buffered formaldehyde. Sections were cut and stained with H&E and periodic acid-Schiff. They were blindly scored under light microscopy for GN, with scores from 04+, as previously described (7). GN was graded by the extent of involvement based on the percentage of glomeruli involved, with lesions scored as follows: grade 0 = none; grade 1 = 110%; grade 2 = 1125%; grade 3 = 2650%; and grade 4 > 50%. The predominant lesion types were mesangiopathic or proliferative. The presence of glomerular sclerosis and interstitial nephritis was also assessed. Immunofluorescence staining of kidneys was done with goat anti-mouse pan IgG (Southern Biotechnology Associates, Birmingham, AL) or C3 (ICN Pharmaceuticals, Costa Mesa, CA) (18). Staining was graded, as previously described (14), using semiquantitative assessment of distribution (04) and intensity (03) of mesangial deposits, with capillary deposits graded 14 (1 = no deposits). Scores were determined on kidneys of 12-mo-old animals.
FACS analysis
Spleens and peripheral lymph nodes were extracted, homogenized, and treated with red cell lysis buffer (Sigma-Aldrich, St. Louis, MO). Cells were then counted and first blocked with anti-CD16/32 Ab (clone 2.4G2) in staining medium (PBS containing 0.2% BSA and 0.02% NaN3; 5% FCS; and 0.1% sodium azide) on ice. After wash, the cells were stained with predetermined amounts of fluorochrome-conjugated Abs: CD3 (2C11), CD4 (RM4-5), CD5 (53-7.3), CD8
(53-6.7), CD11c (HL3), CD19 (1D3), CD21/35 (7G6), CD23 (B3B4), CD25 (7D4), CD44 (IM7), CD62L (MEL-14), CD69 (H1.2F3), B220 (RA3-6B2), syndecan (281-2), Ig-
(187.1), and I-Ab (KH74) (BD PharMingen, San Diego, CA) on ice for 15 min. Stained cells were read by a FACSCalibur analyzer, and analysis was conducted with Flowjo Software (Tree Star, San Carlos, CA).
T cell purification and stimulation assay
Age- and sex-matched animals were used for purification of splenocytes and CD4+ T cells by negative selection. CD8+ T cells, B cells, and APC were removed by labeling with the following biotinylated Abs: anti-CD8 (clone 53-6.7) (if necessary), anti-B220 (RA3-6B2), anti-CD16/32 (2.4G2), anti-I-Ab (KH74), and anti-CD11b (M1-70) (all from BD PharMingen). T cells were washed and then incubated with streptavidin microbeads (Miltenyi Biotec, Auburn, CA), with magnetic removal by passage through a column using the protocol of the manufacturer. Purity of the cells was typically
8590%.
Whole splenocytes or purified T cells were cultured in 96-well flat-bottom tissue culture plates precoated with anti-CD3 (2C11) Abs with or without soluble anti-CD28 (37.51) at 37°C for 2 days. Tritiated thymidine was added to the plates at 1 µCi/well, and cells were allowed to grow for a further 18 h before harvest. Triplicate wells were used for each data point. For some experiments, T cells were labeled with the intracellular fluorescent dye CFSE to determine their proliferative history (20). Labeling was conducted in PBS containing 5 µM of CFSE (Molecular Probes, Eugene, OR) at 10 x 106 cells/ml for 10 min in 37°C. Unbound CFSE was quenched by the addition of FCS, and cells were washed three times before being added to the plates.
Statistics
The Mann-Whitney test, or the
2 test where appropriate, was used for statistical comparison between strains, as the data usually did not distribute normally. Analysis was done using Prism Software (GraphPad, San Diego, CA), and reported as significant when p < 0.05.
| Results |
|---|
|
|
|---|
Fas-deficient animals were followed up to 12 mo of age. Neither the congenic nor control animals developed significant levels of skin lesions, nor did they have significantly different survivorship (Fig. 1A). At the time of sacrifice, both groups of animals had similar body weights (Fig. 1B). Overall, the presence of the congenic interval did not affect the animals gross well-being.
Detailed analysis of the animals, however, revealed differences in the lymphoid organs in Fas-deficient animals. Fas deficiency typically leads to splenomegaly and lymphadenopathy, as a result of the inability of T cell blasts to undergo apoptosis (21). These cells accumulate as B220+ CD3+ T cells, most of which are double negative for their T cell coreceptors, CD4 and CD8 (22, 23), with the rest being CD4+ positive. The accumulation of these cells leads to splenomegaly and lymphadenopathy in Faslpr animals. We found that these traits were particularly prominent in the MRLc7 congenics compared with B6 controls (Fig. 2A). This was at least in part due to the exaggerated accumulation of B220+CD3+ T cells in B6.MRLc7-Faslpr animals, as well as in heterozygotes, compared with B6-Faslpr controls (Fig. 2B). The differences were seen in both spleens and lymph nodes, and resulted from the accumulation of both double-negative B220+ and CD4+ B220+ T cells.
|
Autoantibody production
Animals were bled at several time points as they aged, and serum samples were analyzed for their total IgM and IgG levels, as well as autoantibody titers against the major autoantigens associated with lupus in MRL mice.
Serum total IgM and IgG levels were elevated in B6.MRLc7-Faslpr animals in comparison with B6-Faslpr animals (Fig. 3A). Separate analyses were done with the males and females, as we found that females had higher Ab levels than males, an observation that has not been reported before in the MRL-Faslpr model, although it has been noted previously that MRL/+Fas-lpr females have slightly worse mortality than males (28). The elevated Ig concentrations in the B6.MRLc7 animals were considerably more striking at 6 mo of age than at 12. It appeared that some animals, especially those with higher Ab levels, had a reduction in their circulating Ab as they aged. The mechanism or the functional significance of this observation is not clear at this point; however, it was not a consequence of accelerated mortality in animals with higher autoantibody levels. Despite this caveat, and the large variability seen between animals, the pattern was consistent across both genders and at both ages tested.
|
Kidney disease
Development of kidney disease in these animals paralleled the serological findings: the MRLc7 locus exacerbates the mild GN observed in the B6-Faslpr animals, because mean GN scores were consistently higher in the MRLc7 congenics than B6 controls, as was disease penetrance. The differences were modest, but statistically significant at 12 mo of age (Fig. 4, A and B). The predominant GN lesions seen in the MRLc7 Fas-deficient congenics were mesangiopathic or proliferative. Glomerular sclerosis was also more common in this group, with 34.6% of animals affected (9 of 26), compared with 5.5% (1 of 18) in B6 controls, as was interstitial nephritis, with 46% (12 of 26) of MRLc7 animals affected compared with 11% (2 of 18) in controls. These animals compared with B6 controls also had increased IgG and C3 immune deposits at age 12 mo, as determined by immunofluorescence, although deposits were primarily limited to the mesangial areas, and did not significantly involve capillary loops in either strain (data not shown). The presence of exacerbated kidney disease in the MRLc7 congenics was also confirmed by measurements of blood urea nitrogen (Fig. 4C). MRLc7 Fas-intact animals, in contrast, developed little or no kidney pathology (data not shown), findings that paralleled their lack of autoantibody generation.
|
To determine the cellular basis of the phenotypic differences described, we next examined the characteristics of secondary lymphoid organs in these animals at the time of sacrifice. Apart from the obvious hypercellularity due to the accumulation of CD3+B220+ T cells described earlier, we also looked at conventional B and T cells in some detail.
Conventional (CD3+B220-) T cells made up a relatively small fraction of splenocytes and lymph node cells in our Faslpr animals; however, it appeared that both CD4+ and CD8+ T cells showed increases in numbers starting at 6 mo of age, with enhancement by 12 mo in the congenic animals (Fig. 5A). This was accompanied by a significant increase in the accumulation of CD4+ and CD8+ T cells that had up-regulated CD44 (CD62Lhigh and CD44high, effector T cells) (29) (Fig. 5B). Cells with other cell surface phenotypes (CD62Lhigh, CD44low and CD62Llow, CD44high, naive and memory T cells, respectively) (30) had presumably compensatory decreases. Other T cell activation markers we examined (CD25, CD69) were unaltered between the strains (data not shown). Furthermore, the CD4:CD8 ratio remained constant between the two strains (Fig. 5C).
|
Given that the overlapping chromosomal 7 region of the NZM genome has been shown to influence T cell behavior in the setting of a B6 congenic animal (14, 15), we next set out to test whether the same were true for the MRLc7 locus. Proliferation capacities of purified T cells from congenic and control animals, both Fas intact and Fas deficient, were tested by culturing with plate-bound anti-CD3, with or without soluble anti-CD28. We did not detect differences in proliferation of T cells from the MRLc7 animals (Fas intact and Fas deficient) compared with cells from B6 mice, as measured by CFSE dilution or tritiated-thymidine uptake (data not shown). Furthermore, activation-induced cell death (AICD) was identical in T cells isolated from both MRLc7 and B6 strains (data not shown). Hence, unlike NZMc7 (Sle3/5), MRLc7 does not appear to affect intrinsic T cell behavior.
Interaction between MRLc7 and NZMS1e1loci in the B6.NZMSle1.MRLc7 double congenics
To further evaluate the pathogenic potential of MRLc7, and to determine whether it was functionally dissimilar to Sle3, we bred double congenics that carry both NZM2410 Sle1 and MRLc7 on the B6 background. There is strong support from genetic studies for a multistep process in lupus pathogenesis (16), in which Sle3 promotes end organ disease after an initial breach of tolerance mediated by Sle1 in the B6.Sle1.Sle3 mice (7). In this study, we set out to determine whether MRLc7 can complement Sle1 in the same way and compared the Sle1.MRLc7 and Sle1.Sle3 phenotypes. We did not see enhanced anti-dsDNA production in the B6.Sle1.MRLc7 double congenics over the B6.Sle1 animals (Fig. 6A). Moreover, the Sle1.MRLc7 animals had minimal mortality over the time period they were tracked, which was significantly different from the mortality observed in Sle1.Sle3 mice (Fig. 6B). Overall, no significant epistasis was found between Sle1 and MRLc7, further suggesting that MRLc7 is genetically distinct from Sle3.
|
| Discussion |
|---|
|
|
|---|
The centromeric region of murine chromosome 7 was the focus of the study presented in this work. This region has been repeatedly linked to lupus susceptibility in multiple genetic screens in both NZM and MRL-Faslpr mice (6, 12, 13), suggesting that it contains a single gene or a cluster of genes that is important in regulating or promoting systemic autoimmunity. In the NZM2410 strain, this locus leads to defects in the T cell compartment, with elevated CD4+ T cell percentages and numbers relative to CD8+ T cells, increased activation marker expression in vivo, increased proliferative capacity to anti-CD3/CD28 stimulation, and reduced AICD (14). This defect could be due to factors extrinsic to T cells, as demonstrated for certain traits (15), or to an intrinsic T cell defect. Such an intrinsic T cell defect has been described recently in our laboratory, using MRL/+Fas-lpr animals as the model (32, 33), and it underscores the notion that lupus etiology is multifactorial, with multiple immune cell types contributing to disease development.
An analysis of (MRL-Faslpr x B6-Faslpr)F2 animals also revealed linkage between chromosome 7 and lupus in the MRL-Faslpr model (13), although it is not known what genes in these overlapping loci, Sle3/5 and Lmb3, are responsible for this linkage, or whether the two loci have the same genes responsible for disease development. To begin to address these issues, we produced the B6.MRLc7 congenic mice, which have a congenic interval corresponding closely to the B6.NZMSle3/5 (Fig. 1).
Because Lmb3 was initially identified in a Fas-deficient background, we first catalogued the phenotype of Fas-deficient animals carrying chromosome 7 derived from MRL animals, B6.MRLc7. Fas-deficient animals are distinguished by their polyclonal autoantibody production and kidney pathology. Both traits are mild on the Fas-deficient B6 background compared with their more severe manifestation in MRL animals (34). We found that B6.MRLc7-Faslpr animals had significantly elevated autoantibody levels compared with B6.MRLc7-Faslpr animals at 6 mo of age, although this difference diminished as the animals aged. It does not appear that animals with high autoantibody titers early on were eliminated by death; rather, certain animals had decreased serum autoantibody levels as they aged. Although the mechanism for this is unclear, it could be due to increased catabolism of Ab in serum (35), or their increased deposition in the tissues, including the kidneys (36).
In parallel with the finding of elevated autoantibodies, we also saw enhanced kidney disease, both histologically and functionally, in the MRLc7 congenic animals. This could be the downstream effect of the elevated autoantibody levels observed in younger animals; alternatively, Ab-independent mechanisms might be operative. It has been shown previously that autoantibody production does not correlate strictly with kidney disease: genetic factors that associate with one do not necessarily associate with the other (13, 37), and animals that are unable to produce secreted Abs still manifest a certain level of kidney pathology (38).
Despite enhanced autoantibody production and kidney disease, there was no exacerbated mortality in the congenic animals in our colony. The overall survival rate was quite high, probably due to the specific pathogen-free environment in which the animals were housed. By contrast, these congenic animals had an exaggerated accumulation of CD3+B220+ (double-negative and CD4+) T cells in the secondary lymphoid organs. These cells are thought to be the product of Fas deficiency, in which T cells, in particular CD8+ T cells, fail to undergo apoptosis after expansion (39) or are misselected in the thymus (40). This increased accumulation was probably not due to a further reduction in cell death in the congenic animals, because AICD and in vitro survival of T cells from these animals did not differ from those from B6-Faslpr animals. Rather, this may reflect a difference in T cell activation in vivo, as indicated by the increases in the percentages of CD4+ and CD8+ T cells that have activated phenotype in these animals. It is not clear whether this T cell phenotype is a result of an intrinsic, or extrinsic, T cell defect. In an attempt to address the possibility of a T cell-intrinsic defect, we isolated T cells and stimulated them in culture, but found no differences between B6.MRLc7 and B6 T cells.
Clinical (autoantibodies and GN) and cellular (CD3+B220+ cell accumulation) data from heterozygotes (animals carrying one copy of the congenic interval from MRL genome) indicated that the effect of the MRLc7 congenic interval was either dominant, or at least exhibited a gene-dosage effect. This result is consistent with the genetic contribution of other SLE susceptibility loci that have been analyzed via congenic strains (16).
Although the altered phenotype described to date was seen in Faslpr animals, a parallel study was conducted in Fas-intact animals. Background genes of the MRL strain are critical for disease development, as Fas deficiency on other strains leads to mild disease (34). Furthermore, MRL/+Fas-lpr animals also develop lupus, and have intrinsic T cell defects (32, 33), demonstrating that background MRL genes are sufficient for disease expression. B6.MRLc7/+Fas-lpr congenics, unlike the Fas-deficient animals, did not have overt lupus traits: their autoantibodies remained low up to 12 mo of age, no splenomegaly or lymphadenopathy developed, and their T and B cells appeared to be normal, when compared with B6 controls. Although there may be more subtle immune defects in these animals that remain to be defined, it is clear that for disease expression the MRLc7 locus primarily acts to modify the Fas locus, to accelerate and enhance disease traits carried by Fas-deficient animals. In isolation, the locus has little effect on the manifestation of overt disease. This is a little surprising to us, but it is important to bear in mind that the locus was identified in a screen on Fas-deficient background (13).
The phenotype described in this work has both similarities and differences to that seen in B6.NZM.Sle3/5 animals. The extensive overlapping between certain loci identified in different screens suggests the possibility that the same genes may be involved in different lupus models, much like the way CTLA-4 polymorphism is involved in multiple autoimmune diseases (41). In our opinion, however, it is unlikely that B6.MRLc7 animals carry the same susceptibility genes as Sle3/5 from the NZM2410 background. Although Lmb3 and Sle3/5 are both promoters of lupus phenotype, the former acts as a modifier of Fas deficiency for disease manifestation, while the latter acts independently. Furthermore, Sle3/5 affects T cells in several ways: altered CD4/CD8 ratio, enhanced T cell proliferation, and reduced AICD in vitro, which are not seen in B6.MRLc7 animals, whether they are Fas intact or not. Finally, Sle3/5, but not MRLc7, participates in epistatic interactions with Sle1 to promote clinical pathology. It must be noted that these evidences are largely circumstantial, and the question of whether these two loci are the same or not cannot be conclusively resolved without further genetic analysis.
Recent studies suggest that among the SLE loci, Sle1 is in epistasis with the Fas locus for disease expression (42, 43). In the case of Lmb3 from chromosome 7 of the MRL genome, the locus contributes to the severe disease seen in MRL-Faslpr animals, similar to the way Sle1 and Fas loci interact to give a severe disease phenotype. And unlike Sle3, this locus does not interact with Sle1 to give severe disease. In contrast, the phenotype of B6.Sle3 animals bears some similarities to that seen in B6-Faslpr mice, particularly with regard to T cell homeostasis and death, suggesting that these two loci may impact functionally similar pathways (42).
The fact that the two loci on chromosome 7, despite their overlap, give distinct cellular phenotypes is intriguing to us. It suggests that different combinations of genes (or perhaps even different pathways) are at work in different lupus-prone strains to promote disease. This should not surprise us, as knockouts of many different genes, with extremely diverse functions, give rise to lupus-like syndromes (44). Furthermore, mouse chromosome 1 has yielded two separate candidate genes with very different functions, as described earlier. It will be intriguing to see precisely what genes correspond to Sle3/5 and MRLc7 in these two mouse strains. The candidate genes in the region include those that encode for TGF-
, Bax, Bcl-3, and CD22, as well as a whole host of genes with unknown functions, any of which could carry the molecular defects that contribute to disease susceptibility in lupus-prone animals.
In summary, centromeric chromosome 7 region of the MRL genome carries a lupus susceptibility locus that enhances and accelerates certain traits seen in Fas-deficient animals, but is insufficient by itself for disease expression. Work is underway to define the precise cellular defects in these animals, and the underlying molecular mechanisms for these defects.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Joseph Craft, Box 208031, The Anlyan Center, Room S541, 300 Cedar Street, New Haven, CT 06520-8031. E-mail address: joseph.craft{at}yale.edu ![]()
3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; AICD, activation-induced cell death; GN, glomerulonephritis; snRNP, small nuclear ribonucleoprotein. ![]()
Received for publication August 11, 2003. Accepted for publication December 19, 2003.
| References |
|---|
|
|
|---|
2-microglobulin-deficient mice are protected from hypergammaglobulinemia and have defective antibody responses because of increased IgG catabolism. J. Immunol. 159:4781.[Abstract]
This article has been cited by other articles:
![]() |
M.-L. Santiago-Raber, M. K. Haraldsson, A. N. Theofilopoulos, and D. H. Kono Characterization of Reciprocal Lmb1-4 Interval MRL-Faslpr and C57BL/6-Faslpr Congenic Mice Reveals Significant Effects from Lmb3 J. Immunol., June 15, 2007; 178(12): 8195 - 8202. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Wenderfer, B. Ke, T. J. Hollmann, R. A. Wetsel, H. Y. Lan, and M. C. Braun C5a Receptor Deficiency Attenuates T Cell Function and Renal Disease in MRLlpr Mice J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3572 - 3582. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wakui, L. Morel, E. J. Butfiloski, C. Kim, and E. S. Sobel Genetic Dissection of Systemic Lupus Erythematosus Pathogenesis: Partial Functional Complementation between Sle1 and Sle3/5 Demonstrates Requirement for Intracellular Coexpression for Full Phenotypic Expression of Lupus J. Immunol., July 15, 2005; 175(2): 1337 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yi, S. Chiu, D. B. Allison, J. S. Fisler, and C. H. Warden Epistatic interaction between two nonstructural loci on chromosomes 7 and 3 influences hepatic lipase activity in BSB mice J. Lipid Res., November 1, 2004; 45(11): 2063 - 2070. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |