|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CUTTING EDGE |


Departments of
*
Medicine and
Pharmacology, University of California, San Diego, La Jolla, CA 92093; and
Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21231
| Abstract |
|---|
|
|
|---|
, GM-CSF and up-regulation of B7RP-1, but low levels of Th1-associated cytokines (IL-12, IFN
, IL-18, IL-27). Accordingly, TLR2 ligands aggravated experimental asthma. These data indicate that the type of TLR stimulation during the initial phase of immune activation determines the polarization of the adaptive immune response and may play a role in the initiation of Th2-mediated immune disorders, such as asthma. | Introduction |
|---|
|
|
|---|
B and AP-1 (1, 2). This ultimately results in up-regulation of costimulatory molecules, secretion of cytokines, and enhanced uptake and presentation of Ag. Both TLR-dependent activation of APC and processing and presentation of Ag are necessary for the induction of adaptive T and B cell responses. Polarization toward a Th1 or Th2 phenotype is crucial for the defense against pathogens, but can also be associated with the induction of autoimmune disease (Th1) or asthma (Th2). Although it is well known that all TLR stimuli lead to activation of APCs, their particular influence on the subsequent induction of adaptive immunity in vivo has only been partially delineated. In this study, we indicate that TLR2 and TLR9 ligands elicit two disparate adaptive immune responses. | Materials and Methods |
|---|
|
|
|---|
Mice. C57BL/6 (The Jackson Laboratory, Bar Harbor, ME) and 129/SvEv (B&K Universal, East Yorkshire, U.K.) mice were 6- to 8-wk-old.
Reagents. ISS-ODN (1668: TCCATGACGTTCCTGATGCT) was synthesized by TIB MOLBIOL (Adelphia, NJ). OVA was purchased from Worthington (Lakewood, NJ) and the synthetic lipopeptide Pam3Cys was obtained from EMC Microcollections (Tübingen, Germany).
Tissue culture. Cells were cultured in RPMI 1640 (Cellgro; Mediatech, Herndon, VA) supplemented with 10% FCS (Life Technologies, Gaithersburg, MD), 2 mM L-glutamine (Cellgro), and 100U/ml penicillin-100 µg/ml streptomycin (Pen/Strep; Cellgro). Mouse bone marrow-derived dendritic cells (BMDCs) were cultured as previously described (3).
Immunization protocols
C57BL/6 mice were immunized with 50 µg of OVA alone or in combination with ISS-ODN (50 µg) or Pam3Cys (5500 µg) s.c. on days 0 and 14. On day 39, mice received an i.v. boost of 20 µg of OVA. At day 42, mice were sacrificed and total splenocytes were restimulated for secondary CTL and cytokine assays as described (4, 5). Proliferation of splenocytes was determined by [3H]thymidine uptake.
Experimental asthma
129/SvEv were immunized s.c. with 50 µg of OVA alone or in combination with ISS-ODN (50 µg) or Pam3Cys (50 µg) on days 0 and 7. Mice were intranasally challenged with 5 µg of OVA 7 days and 1 day before sacrifice. At day 21, the mice were tested for airway responsiveness to methacholine (324 mg/ml; Sigma-Aldrich, St. Louis, MO) and a bronchoalveolar lavage for the differential lung cell count was performed as previously described (6, 7). Mediastinal lymph nodes (LN) were digested with DNase I/collagenase VII (Boehringer Mannheim/Roche, Indianapolis, IN/Sigma-Aldrich) and restimulated with OVA for T cell cytokine analysis and used for FACS stains.
ELISA
OVA-specific IgG2a, IgG1, and IgE levels were measured from serum samples collected by retro-orbital eye bleeds (8). IFN-
, IL-5 (BD PharMingen, San Diego, CA), and IL-13 (RD Biosystems, Minneapolis, MN) were determined from supernatants of splenocytes that were restimulated with OVA in vitro (5). The levels of IL-12p40, IL-12p70, IL-10, and IL-6 (BD PharMingen) and IL-13 (RD Biosystems) were determined by ELISA.
Bioassay (type I IFN)
Type I IFN levels in supernatants from BMDC 16 h after stimulation were measured using an antiviral protection assay as described (9).
Flow cytometry
BMDC and mediastinal LN were stained with Abs purchased from eBioscience (San Diego, CA). Surface marker expression was analyzed on a FACSCalibur flow cytometer using CellQuest (BD Biosciences, Franklin Lakes, NJ) and FlowJo software (Tree Star, San Carlos, CA).
Real-time PCR
Quantitative real-time PCR was performed using the ABI Prism 7700 (Applied Biosystems, Foster City, CA). Primers were generated using the Primer3 software (Ref. 10 ; www-genome.wi.mit.edu/genome_software/other/primer3.html).
| Results |
|---|
|
|
|---|
To determine the role of particular TLRs in the generation of adaptive immune responses, mice were immunized with different TLR ligands in combination with OVA as a model Ag. Production of Ig subclasses (IgG2a, IgG1, and IgE), secretion of cytokines from in vitro-restimulated splenocytes, CTL response, and the effect on a murine experimental model of asthma were analyzed. Because our preliminary results indicated that the TLR2 ligand (Pam3Cys) and TLR9 ligand (ISS-ODN) lead to the most distinctive immune responses, we concentrated on these two ligands in our current investigations. As shown in Fig. 1, AC, ISS-ODN and Pam3Cys induced different Ab profiles. Immunization with ISS-ODN/OVA resulted in an Ag-specific IgG2a response, whereas immunization with Pam3Cys/OVA resulted in a pronounced IgG1 response and induction of IgE (Fig. 1C). While ISS-ODN primed CD4 T cells to produce IFN-
, Pam3Cys induced IL-13 production (Fig. 1, DE). Restimulation with medium alone did not induce any production of IFN-
or IL-13. The IgG isotype bias and the production of IgE and IL-13 induced by Pam3Cys/OVA were abrogated in TLR2-deficient mice, proving that TLR2 is a critical receptor for Pam3Cys (data not shown). Immunization with peptidoglycan (100 µg) as an adjuvant in combination with OVA was less potent than immunizations with Pam3Cys/OVA in regard to cytokine production and induction of Ab response, but also showed a preferential induction of IgG1 (26,547 ± 14,455 U/ml for peptidoglycan/OVA vs 299,082 ± 73,142 U/ml for Pam3Cys/OVA, 3 wk after immunization) over IgG2a (not detectable for peptidoglycan/OVA vs 1473 ± 925 U/ml for Pam3Cys/OVA, 3 wk after immunization).
|
Immunization with ISS-ODN/OVA and Pam3Cys/OVA induced a similar proliferative response in OVA-restimulated splenocyte cultures (Fig. 1G).
To test whether the Th1 (by ISS-ODN) and Th2 (by Pam3Cys) polarization observed above alters the propensity of the immunized animals to develop experimental asthma, Pam3Cys/OVA- or ISS-ODN/OVA-immunized mice were rechallenged with OVA intranasally at two occasions and airway hyper-reactivity (AHR), recruitment of eosinophils to the lung, and cytokine release of in vitro-restimulated bronchial LN cells were evaluated. Priming with ISS-ODN/OVA improved AHR, decreased the number of eosinophils in the lung and induced IFN-
, whereas priming with Pam3Cys/OVA aggravated the AHR, increased the number of eosinophils and led to the production of Th2 cytokines (Fig. 1, HJ).
Taken together, these data show that both ISS-ODN and Pam3Cys induce significant Ag-dependent immune responses. However, ISS-ODN polarizes the immune response toward a Th1 phenotype, whereas Pam3Cys leads to Th2-specific cytokine and Ig production and only a modest CTL response. The data further suggests that the opposing Th1/Th2 polarization induced by ISS-ODN and Pam3Cys can have an effect on the development of Th2-associated diseases such as experimental asthma.
TLR2 ligands differentially induce Th2-associated cytokines and B7RP-1
Costimulatory molecules and the cytokine production by DC play a crucial role in the differentiation of naive CD4 T cells. To explore whether these factors may explain the differential Th polarization induced by ISS-ODN and Pam3Cys, BMDC were stimulated with ISS-ODN or Pam3Cys and the expression of costimulatory molecules and the production of cytokines were determined. As shown in Fig. 2A, both ISS-ODN and Pam3Cys induced up-regulation of the costimulatory molecules CD40, B7-1 and B7-2, whereas only Pam3Cys led to an up-regulation of B7RP-1. The up-regulation of B7RP-1 was even more pronounced in mature DC from mediastinal LN after immunization with OVA and Pam3Cys (Fig. 2B), whereas ISS-ODN showed less effect.
|

, IL-12 p40, IL-12 p70, IL-6, IL-10, and IL-13 (Fig. 2C), and a panel of mRNAs known to be involved in Th1/Th2 polarization (Fig. 2D) by BMDC. There was a clear difference in the pattern of cytokines induced. Whereas ISS-ODN induced primarily cytokines associated with a Th1 phenotype like IL-12, IL-18, IL-27, and IFN
, Pam3Cys preferentially induced Th2-associated cytokines like IL-13, GM-CSF, and IL-1
. Other genes like TNF-
and I
B
were comparably induced. A similar pattern of cytokine production with Pam3Cys inducing Th2-associated cytokines was observed in primary CD11c+ DC isolated from the spleen. Again, the cytokine response and gene induction by Pam3Cys in BMDC was dependent on TLR2 (data not shown). | Discussion |
|---|
|
|
|---|
or IgG2a production. Whether the differences in concentration dependence between LPS and Pam3Cys are due to different signaling pathways or whether different cell types contribute to the phenomenon observed needs to be investigated.
At the cellular level, stimulation of BMDCs with ISS-ODN or Pam3Cys showed distinct activation profiles. Up-regulation of costimulatory molecules like CD40, B7-1 and B7-2 was comparable, whereas up-regulation of B7RP-1, which was shown to support Th2 responses (14), seemed more pronounced after Pam3Cys stimulation in vitro and in vivo. IL-13, IL-1
, and GM-CSF, which support Th2 differentiation or allergy (15, 16, 17, 18), were preferentially induced by Pam3Cys. In contrast, Th1-associated cytokines like IL-12, IFN
, IL-18, and IL-27 (17, 19) were greatly diminished in comparison to stimulation with ISS-ODN. This effect was also seen with IFN-dependent genes (data not shown).
The signaling pathways of TLR2 and TLR9 share common molecules. It was shown that signaling through the adaptor molecule MyD88 plays an important role in the induction of Th1-associated immunity (20). ISS-ODN, a TLR ligand that is believed to be completely dependent on MyD88, was shown to induce a strong Th1 bias (21). In contrast, TLR2 uses at least one additional molecule called Toll-IL-1R domain-containing adapter protein (22, 23). Whether this or further signaling molecules might explain the diversity seen with those two TLR ligands remains to be elucidated.
In summary, we found that the immune response induced by TLR ligands can play an important role in the initiation or prevention of Th2-associated diseases. Immunization with Ag in the context of TLR2 ligands, in contrast to the protective effects of TLR9, can result in experimental asthma. There have been reports suggesting that bacterial infections can be associated with asthma. Interestingly, chlamydia and mycoplasma, bacteria that are strongly associated with the onset of asthma, as well as some viral infections and air pollution particles were shown to elicit some of their effects via TLR2-mediated mechanisms (24, 25, 26, 27). Our study demonstrates that the type of TLR stimulation is able to regulate the development ofTh1/Th2-polarized adaptive immune responses. Therefore, it seems reasonable to consider TLR2 and TLR2-dependent signaling pathways as possible inducers of the immune deviation that results in asthma in humans.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Eyal Raz, Department of Internal Medicine and The Sam and Rose Stein Institute for Research on Aging, University of California, San Diego, La Jolla, CA 92093-0663. E-mail address: eraz{at}ucsd.edu ![]()
3 Abbreviations used in this paper: TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; BMDC, bone marrow-derived dendritic cell; LN, lymph node; AHR, airway hyper-reactivity. ![]()
Received for publication June 23, 2003. Accepted for publication December 30, 2003.
| References |
|---|
|
|
|---|
Related articles in The JI:
This article has been cited by other articles:
![]() |
Q. Yu, R. Vazquez, E. V. Khojeini, C. Patel, R. Venkataramani, and D. F. Larson IL-18 induction of osteopontin mediates cardiac fibrosis and diastolic dysfunction in mice Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H76 - H85. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Phipps, C. E. Lam, G. E. Kaiko, S. Y. Foo, A. Collison, J. Mattes, J. Barry, S. Davidson, K. Oreo, L. Smith, et al. Toll/IL-1 Signaling Is Critical for House Dust Mite-specific Th1 and Th2 Responses Am. J. Respir. Crit. Care Med., May 15, 2009; 179(10): 883 - 893. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Finn and T. D. Bigby Innate Immunity and Asthma Proceedings of the ATS, May 1, 2009; 6(3): 260 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gaucher, R. Therrien, N. Kettaf, B. R. Angermann, G. Boucher, A. Filali-Mouhim, J. M. Moser, R. S. Mehta, D. R. Drake III, E. Castro, et al. Yellow fever vaccine induces integrated multilineage and polyfunctional immune responses J. Exp. Med., December 22, 2008; 205(13): 3119 - 3131. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Magalhaes, J. H. Fritz, L. Le Bourhis, G. Sellge, L. H. Travassos, T. Selvanantham, S. E. Girardin, J. L. Gommerman, and D. J. Philpott Nod2-Dependent Th2 Polarization of Antigen-Specific Immunity J. Immunol., December 1, 2008; 181(11): 7925 - 7935. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Dittrich, H.-C. Chen, L. Xu, P. Ranney, S. Connolly, T. O. Yarovinsky, and H. K. Bottomly A New Mechanism for Inhalational Priming: IL-4 Bypasses Innate Immune Signals J. Immunol., November 15, 2008; 181(10): 7307 - 7315. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kiyokawa, S. Akashi-Takamura, T. Shibata, F. Matsumoto, C. Nishitani, Y. Kuroki, Y. Seto, and K. Miyake A single base mutation in the PRAT4A gene reveals differential interaction of PRAT4A with Toll-like receptors Int. Immunol., November 1, 2008; 20(11): 1407 - 1415. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Hudson, G. P. Christophi, R. C. Gruber, J. R. Wilmore, D. A. Lawrence, and P. T. Massa Induction of IL-33 expression and activity in central nervous system glia J. Leukoc. Biol., September 1, 2008; 84(3): 631 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Page, K. M. Lierl, V. S. Hughes, P. Zhou, J. R. Ledford, and M. Wills-Karp TLR2-Mediated Activation of Neutrophils in Response to German Cockroach Frass J. Immunol., May 1, 2008; 180(9): 6317 - 6324. [Abstract] [Full Text] [PDF] |
||||
![]() |
B J Hales, L J Pearce, M M H Kusel, P G Holt, P D Sly, and W R Thomas Differences in the antibody response to a mucosal bacterial antigen between allergic and non-allergic subjectsSmoke-free legislation reduces exposure in children Thorax, March 1, 2008; 63(3): 221 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Kaiko, S. Phipps, D. K. Hickey, C. E. Lam, P. M. Hansbro, P. S. Foster, and K. W. Beagley Chlamydia muridarum Infection Subverts Dendritic Cell Function to Promote Th2 Immunity and Airways Hyperreactivity J. Immunol., February 15, 2008; 180(4): 2225 - 2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang, Q. Chen, S. B. Su, P. Zhang, K. Kurosaka, R. R. Caspi, S. M. Michalek, H. F. Rosenberg, N. Zhang, and J. J. Oppenheim Eosinophil-derived neurotoxin acts as an alarmin to activate the TLR2-MyD88 signal pathway in dendritic cells and enhances Th2 immune responses J. Exp. Med., January 21, 2008; 205(1): 79 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fransen, C. J. Boog, J. P. van Putten, and P. van der Ley Agonists of Toll-Like Receptors 3, 4, 7, and 9 Are Candidates for Use as Adjuvants in an Outer Membrane Vaccine against Neisseria meningitidis Serogroup B Infect. Immun., December 1, 2007; 75(12): 5939 - 5946. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. J. Schroder and M. Arditi IEIIS Meeting minireview: The role of innate immunity in the pathogenesis of asthma: evidence for the involvement of Toll-like receptor signaling Innate Immunity, October 1, 2007; 13(5): 305 - 312. [Abstract] [PDF] |
||||
![]() |
H. Izadi, A. T. Motameni, T. C. Bates, E. R. Olivera, V. Villar-Suarez, I. Joshi, R. Garg, B. A. Osborne, R. J. Davis, M. Rincon, et al. c-Jun N-Terminal Kinase 1 Is Required for Toll-Like Receptor 1 Gene Expression in Macrophages Infect. Immun., October 1, 2007; 75(10): 5027 - 5034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bevelander, J. Mayette, L. A. Whittaker, S. A. Paveglio, C. C. Jones, J. Robbins, D. Hemenway, S. Akira, S. Uematsu, and M. E. Poynter Nitrogen Dioxide Promotes Allergic Sensitization to Inhaled Antigen J. Immunol., September 15, 2007; 179(6): 3680 - 3688. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Bandukwala, B. S. Clay, J. Tong, P. D. Mody, J. L. Cannon, R. A. Shilling, J. S. Verbeek, J. V. Weinstock, J. Solway, and A. I. Sperling Signaling through Fc{gamma}RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation J. Exp. Med., August 6, 2007; 204(8): 1875 - 1889. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Wong, P. F. Y. Cheung, W. K. Ip, and C. W. K. Lam Intracellular Signaling Mechanisms Regulating Toll-Like Receptor-Mediated Activation of Eosinophils Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 85 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fichtner-Feigl, I. J. Fuss, C. A. Young, T. Watanabe, E. K. Geissler, H.-J. Schlitt, A. Kitani, and W. Strober Induction of IL-13 Triggers TGF-beta1-Dependent Tissue Fibrosis in Chronic 2,4,6-Trinitrobenzene Sulfonic Acid Colitis J. Immunol., May 1, 2007; 178(9): 5859 - 5870. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hamm, A. Heit, M. Koffler, K. M. Huster, S. Akira, D. H. Busch, H. Wagner, and S. Bauer Immunostimulatory RNA is a potent inducer of antigen-specific cytotoxic and humoral immune response in vivo Int. Immunol., March 1, 2007; 19(3): 297 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Aliprantis, J. Wang, J. W. Fathman, R. Lemaire, D. M. Dorfman, R. Lafyatis, and L. H. Glimcher Transcription factor T-bet regulates skin sclerosis through its function in innate immunity and via IL-13 PNAS, February 20, 2007; 104(8): 2827 - 2830. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun and E. J. Pearce Suppression of Early IL-4 Production Underlies the Failure of CD4 T Cells Activated by TLR-Stimulated Dendritic Cells to Differentiate into Th2 Cells J. Immunol., February 1, 2007; 178(3): 1635 - 1644. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lang, M. Hammer, and J. Mages DUSP Meet Immunology: Dual Specificity MAPK Phosphatases in Control of the Inflammatory Response J. Immunol., December 1, 2006; 177(11): 7497 - 7504. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fujimoto, C.-R. Yu, G. Shi, B. P. Vistica, E. F. Wawrousek, D. M. Klinman, C.-C. Chan, C. E. Egwuagu, and I. Gery Pertussis Toxin Is Superior to TLR Ligands in Enhancing Pathogenic Autoimmunity, Targeted at a Neo-Self Antigen, by Triggering Robust Expansion of Th1 Cells and Their Cytokine Production J. Immunol., November 15, 2006; 177(10): 6896 - 6903. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hasebe, N. D. Pennock, H.-H. Mu, F. V. Chan, M. L. Taylor, and B. C. Cole A Microbial TLR2 Agonist Imparts Macrophage-Activating Ability to Apolipoprotein A-1 J. Immunol., October 1, 2006; 177(7): 4826 - 4832. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Brown, S. H. Sacks, and M. G. Robson Toll-Like Receptor 2 Agonists Exacerbate Accelerated Nephrotoxic Nephritis J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1931 - 1939. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Denning, B. R. O'Driscoll, C. M. Hogaboam, P. Bowyer, and R. M. Niven The link between fungi and severe asthma: a summary of the evidence. Eur. Respir. J., March 1, 2006; 27(3): 615 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Chang, J. F. Huggett, K. Dheda, L. U. Kim, A. Zumla, and G. A. W. Rook Myobacterium tuberculosis Induces Selective Up-Regulation of TLRs in the Mononuclear Leukocytes of Patients with Active Pulmonary Tuberculosis. J. Immunol., March 1, 2006; 176(5): 3010 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Querec, S. Bennouna, S. Alkan, Y. Laouar, K. Gorden, R. Flavell, S. Akira, R. Ahmed, and B. Pulendran Yellow fever vaccine YF-17D activates multiple dendritic cell subsets via TLR2, 7, 8, and 9 to stimulate polyvalent immunity J. Exp. Med., February 21, 2006; 203(2): 413 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qiao, M. V. Andrade, F. A. Lisboa, K. Morgan, and M. A. Beaven Fc{epsilon}R1 and toll-like receptors mediate synergistic signals to markedly augment production of inflammatory cytokines in murine mast cells Blood, January 15, 2006; 107(2): 610 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yasutomi, Y. Ohshima, N. Omata, A. Yamada, H. Iwasaki, Y. Urasaki, and M. Mayumi Erythromycin Differentially Inhibits Lipopolysaccharide- or Poly(I:C)-Induced but Not Peptidoglycan-Induced Activation of Human Monocyte-Derived Dendritic Cells J. Immunol., December 15, 2005; 175(12): 8069 - 8076. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tada, S. Aiba, K.-I. Shibata, T. Ohteki, and H. Takada Synergistic Effect of Nod1 and Nod2 Agonists with Toll-Like Receptor Agonists on Human Dendritic Cells To Generate Interleukin-12 and T Helper Type 1 Cells Infect. Immun., December 1, 2005; 73(12): 7967 - 7976. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Y Liew, M Patel, and D Xu Toll-like receptor 2 signalling and inflammation Ann Rheum Dis, November 1, 2005; 64(suppl_4): iv104 - iv105. [Full Text] [PDF] |
||||
![]() |
C. S. Jack, N. Arbour, J. Manusow, V. Montgrain, M. Blain, E. McCrea, A. Shapiro, and J. P. Antel TLR Signaling Tailors Innate Immune Responses in Human Microglia and Astrocytes J. Immunol., October 1, 2005; 175(7): 4320 - 4330. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9 J. Immunol., September 15, 2005; 175(6): 3964 - 3970. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Patel, D. Xu, P. Kewin, B. Choo-Kang, C. McSharry, N. C. Thomson, and F. Y. Liew TLR2 Agonist Ameliorates Established Allergic Airway Inflammation by Promoting Th1 Response and Not via Regulatory T Cells J. Immunol., June 15, 2005; 174(12): 7558 - 7563. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Benjamim, S. K. Lundy, N. W. Lukacs, C. M. Hogaboam, and S. L. Kunkel Reversal of long-term sepsis-induced immunosuppression by dendritic cells Blood, May 1, 2005; 105(9): 3588 - 3595. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zanin-Zhorov, R. Bruck, G. Tal, S. Oren, H. Aeed, R. Hershkoviz, I. R. Cohen, and O. Lider Heat Shock Protein 60 Inhibits Th1-Mediated Hepatitis Model via Innate Regulation of Th1/Th2 Transcription Factors and Cytokines J. Immunol., March 15, 2005; 174(6): 3227 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Velasco, M. Campo, O. J. Manrique, A. Bellou, H. He, R. S. S. Arestides, B. Schaub, D. L. Perkins, and P. W. Finn Toll-Like Receptor 4 or 2 Agonists Decrease Allergic Inflammation Am. J. Respir. Cell Mol. Biol., March 1, 2005; 32(3): 218 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vakharia and J. P. Hinson Lipopolysaccharide Directly Stimulates Cortisol Secretion by Human Adrenal Cells by a Cyclooxygenase-Dependent Mechanism Endocrinology, March 1, 2005; 146(3): 1398 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pulendran Variegation of the Immune Response with Dendritic Cells and Pathogen Recognition Receptors J. Immunol., March 1, 2005; 174(5): 2457 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development J. Immunol., January 15, 2005; 174(2): 742 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Q. Khan, Q. Chen, Z.-Q. Wu, J. C. Paton, and C. M. Snapper Both Innate Immunity and Type 1 Humoral Immunity to Streptococcus pneumoniae Are Mediated by MyD88 but Differ in Their Relative Levels of Dependence on Toll-Like Receptor 2 Infect. Immun., January 1, 2005; 73(1): 298 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Re and J. L. Strominger IL-10 Released by Concomitant TLR2 Stimulation Blocks the Induction of a Subset of Th1 Cytokines That Are Specifically Induced by TLR4 or TLR3 in Human Dendritic Cells J. Immunol., December 15, 2004; 173(12): 7548 - 7555. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Matsushima, N. Yamada, H. Matsue, and S. Shimada TLR3-, TLR7-, and TLR9-Mediated Production of Proinflammatory Cytokines and Chemokines from Murine Connective Tissue Type Skin-Derived Mast Cells but Not from Bone Marrow-Derived Mast Cells J. Immunol., July 1, 2004; 173(1): 531 - 541. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |