The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Redecke, V.
Right arrow Articles by Raz, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Redecke, V.
Right arrow Articles by Raz, E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Asthma
Hazardous Substances DB
*CYSTEINE
The Journal of Immunology, 2004, 172: 2739-2743.
Copyright © 2004 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: Activation of Toll-Like Receptor 2 Induces a Th2 Immune Response and Promotes Experimental Asthma1

Vanessa Redecke*, Hans Häcker{dagger}, Sandip K. Datta*, Agnes Fermin*, Paula M. Pitha{ddagger}, David H. Broide* and Eyal Raz2,*

Departments of * Medicine and {dagger} Pharmacology, University of California, San Diego, La Jolla, CA 92093; and {ddagger} Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21231


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recognition of microbial components by APCs and their activation through Toll-like receptors (TLR) leads to the induction of adaptive immune responses. In this study, we show that activation of TLR2 by its synthetic ligand Pam3Cys, in contrast to activation of TLR9 by immunostimulatory DNA (ISS-ODN), induces a prominent Th2-biased immune response. Activation of APCs by Pam3Cys resulted in the induction of Th2-associated effector molecules like IL-13, and IL-1{beta}, GM-CSF and up-regulation of B7RP-1, but low levels of Th1-associated cytokines (IL-12, IFN{alpha}, IL-18, IL-27). Accordingly, TLR2 ligands aggravated experimental asthma. These data indicate that the type of TLR stimulation during the initial phase of immune activation determines the polarization of the adaptive immune response and may play a role in the initiation of Th2-mediated immune disorders, such as asthma.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Efficient immune responses depend on the interaction between the innate and adaptive immune system. Immune responses against invading pathogens are initiated by Toll-like receptors (TLR)3 that recognize distinct structurally conserved components of pathogens. Probably with the exception of TLR3, the receptor for dsRNA, cell activation by all TLR family members is largely dependent on the adaptor molecule myeloid differentiation factor 88 (MyD88). Stimulation of the TLR leads to recruitment of MyD88, engagement of IL-1R-associated kinase and TNFR-associated factor 6 and activation of transcription factors such as NF-{kappa}B and AP-1 (1, 2). This ultimately results in up-regulation of costimulatory molecules, secretion of cytokines, and enhanced uptake and presentation of Ag. Both TLR-dependent activation of APC and processing and presentation of Ag are necessary for the induction of adaptive T and B cell responses. Polarization toward a Th1 or Th2 phenotype is crucial for the defense against pathogens, but can also be associated with the induction of autoimmune disease (Th1) or asthma (Th2). Although it is well known that all TLR stimuli lead to activation of APCs, their particular influence on the subsequent induction of adaptive immunity in vivo has only been partially delineated. In this study, we indicate that TLR2 and TLR9 ligands elicit two disparate adaptive immune responses.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Mice. C57BL/6 (The Jackson Laboratory, Bar Harbor, ME) and 129/SvEv (B&K Universal, East Yorkshire, U.K.) mice were 6- to 8-wk-old.

Reagents. ISS-ODN (1668: TCCATGACGTTCCTGATGCT) was synthesized by TIB MOLBIOL (Adelphia, NJ). OVA was purchased from Worthington (Lakewood, NJ) and the synthetic lipopeptide Pam3Cys was obtained from EMC Microcollections (Tübingen, Germany).

Tissue culture. Cells were cultured in RPMI 1640 (Cellgro; Mediatech, Herndon, VA) supplemented with 10% FCS (Life Technologies, Gaithersburg, MD), 2 mM L-glutamine (Cellgro), and 100U/ml penicillin-100 µg/ml streptomycin (Pen/Strep; Cellgro). Mouse bone marrow-derived dendritic cells (BMDCs) were cultured as previously described (3).

Immunization protocols

C57BL/6 mice were immunized with 50 µg of OVA alone or in combination with ISS-ODN (50 µg) or Pam3Cys (5–500 µg) s.c. on days 0 and 14. On day 39, mice received an i.v. boost of 20 µg of OVA. At day 42, mice were sacrificed and total splenocytes were restimulated for secondary CTL and cytokine assays as described (4, 5). Proliferation of splenocytes was determined by [3H]thymidine uptake.

Experimental asthma

129/SvEv were immunized s.c. with 50 µg of OVA alone or in combination with ISS-ODN (50 µg) or Pam3Cys (50 µg) on days 0 and 7. Mice were intranasally challenged with 5 µg of OVA 7 days and 1 day before sacrifice. At day 21, the mice were tested for airway responsiveness to methacholine (3–24 mg/ml; Sigma-Aldrich, St. Louis, MO) and a bronchoalveolar lavage for the differential lung cell count was performed as previously described (6, 7). Mediastinal lymph nodes (LN) were digested with DNase I/collagenase VII (Boehringer Mannheim/Roche, Indianapolis, IN/Sigma-Aldrich) and restimulated with OVA for T cell cytokine analysis and used for FACS stains.

ELISA

OVA-specific IgG2a, IgG1, and IgE levels were measured from serum samples collected by retro-orbital eye bleeds (8). IFN-{gamma}, IL-5 (BD PharMingen, San Diego, CA), and IL-13 (RD Biosystems, Minneapolis, MN) were determined from supernatants of splenocytes that were restimulated with OVA in vitro (5). The levels of IL-12p40, IL-12p70, IL-10, and IL-6 (BD PharMingen) and IL-13 (RD Biosystems) were determined by ELISA.

Bioassay (type I IFN)

Type I IFN levels in supernatants from BMDC 16 h after stimulation were measured using an antiviral protection assay as described (9).

Flow cytometry

BMDC and mediastinal LN were stained with Abs purchased from eBioscience (San Diego, CA). Surface marker expression was analyzed on a FACSCalibur flow cytometer using CellQuest (BD Biosciences, Franklin Lakes, NJ) and FlowJo software (Tree Star, San Carlos, CA).

Real-time PCR

Quantitative real-time PCR was performed using the ABI Prism 7700 (Applied Biosystems, Foster City, CA). Primers were generated using the Primer3 software (Ref. 10 ; www-genome.wi.mit.edu/genome_software/other/primer3.html).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TLR2 ligands bias the adaptive immune response toward a Th2 phenotype and can lead to aggravation of asthma

To determine the role of particular TLRs in the generation of adaptive immune responses, mice were immunized with different TLR ligands in combination with OVA as a model Ag. Production of Ig subclasses (IgG2a, IgG1, and IgE), secretion of cytokines from in vitro-restimulated splenocytes, CTL response, and the effect on a murine experimental model of asthma were analyzed. Because our preliminary results indicated that the TLR2 ligand (Pam3Cys) and TLR9 ligand (ISS-ODN) lead to the most distinctive immune responses, we concentrated on these two ligands in our current investigations. As shown in Fig. 1, A–C, ISS-ODN and Pam3Cys induced different Ab profiles. Immunization with ISS-ODN/OVA resulted in an Ag-specific IgG2a response, whereas immunization with Pam3Cys/OVA resulted in a pronounced IgG1 response and induction of IgE (Fig. 1C). While ISS-ODN primed CD4 T cells to produce IFN-{gamma}, Pam3Cys induced IL-13 production (Fig. 1, D–E). Restimulation with medium alone did not induce any production of IFN-{gamma} or IL-13. The IgG isotype bias and the production of IgE and IL-13 induced by Pam3Cys/OVA were abrogated in TLR2-deficient mice, proving that TLR2 is a critical receptor for Pam3Cys (data not shown). Immunization with peptidoglycan (100 µg) as an adjuvant in combination with OVA was less potent than immunizations with Pam3Cys/OVA in regard to cytokine production and induction of Ab response, but also showed a preferential induction of IgG1 (26,547 ± 14,455 U/ml for peptidoglycan/OVA vs 299,082 ± 73,142 U/ml for Pam3Cys/OVA, 3 wk after immunization) over IgG2a (not detectable for peptidoglycan/OVA vs 1473 ± 925 U/ml for Pam3Cys/OVA, 3 wk after immunization).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. Differential immune responses induced by ISS-ODN- and Pam3Cys-based immunizations. A–G, Mice were immunized s.c. with OVA (50 µg) either alone or in combination with ISS-ODN (50 µg) or Pam3Cys (500, 50, or 5 µg) at days 0 and 14 and rechallenged i.v. with 20 µg of OVA 3 days before sacrifice. A–B, Ab isotypes (IgG1, IgG2a) were determined by ELISA from serum samples taken before immunization and at weeks 2, 4, and 6. C, IgE was determined by ELISA from serum samples at week 4. D–F, Total splenocytes were analyzed for the secondary CTL activity and OVA-specific cytokine secretion. G, Proliferative response of OVA-restimulated splenocytes was determined by [3H]thymidine uptake. H–J, Mice were immunized s.c. with OVA (50 µg) either alone or in combination with ISS-ODN (50 µg) or Pam3Cys (50 µg) twice and rechallenged intranasally with 5 µg of OVA 7 days and 1 day before testing. H, Airway responsiveness to aerosolized methacholine was tested. I, Percentage of macrophages (macro.), lymphocytes (lympho.), neutrophils (neutro.), and eosinophils (eos.) from the BAL was determined. J, OVA-specific cytokine secretion of mediastinal LN cells was measured. Data are shown as mean ± SEM, n = 5 per group (n = 8 per group for the AHR and eosinophil count), ISS = ISS-ODN, Pam = Pam3Cys, n.d. = not detectable.

 
Both stimuli, ISS and Pam3Cys, led to induction of CTL activity (Fig. 1F); however, the induction of CTL activity by ISS-ODN was significantly more prominent than that induced by Pam3Cys. Titrating the amount of Pam3Cys over three orders of magnitude did not significantly change this low CTL activity, nor did it change the Th2 bias in regard to cytokine and Ab production.

Immunization with ISS-ODN/OVA and Pam3Cys/OVA induced a similar proliferative response in OVA-restimulated splenocyte cultures (Fig. 1G).

To test whether the Th1 (by ISS-ODN) and Th2 (by Pam3Cys) polarization observed above alters the propensity of the immunized animals to develop experimental asthma, Pam3Cys/OVA- or ISS-ODN/OVA-immunized mice were rechallenged with OVA intranasally at two occasions and airway hyper-reactivity (AHR), recruitment of eosinophils to the lung, and cytokine release of in vitro-restimulated bronchial LN cells were evaluated. Priming with ISS-ODN/OVA improved AHR, decreased the number of eosinophils in the lung and induced IFN-{gamma}, whereas priming with Pam3Cys/OVA aggravated the AHR, increased the number of eosinophils and led to the production of Th2 cytokines (Fig. 1, H–J).

Taken together, these data show that both ISS-ODN and Pam3Cys induce significant Ag-dependent immune responses. However, ISS-ODN polarizes the immune response toward a Th1 phenotype, whereas Pam3Cys leads to Th2-specific cytokine and Ig production and only a modest CTL response. The data further suggests that the opposing Th1/Th2 polarization induced by ISS-ODN and Pam3Cys can have an effect on the development of Th2-associated diseases such as experimental asthma.

TLR2 ligands differentially induce Th2-associated cytokines and B7RP-1

Costimulatory molecules and the cytokine production by DC play a crucial role in the differentiation of naive CD4 T cells. To explore whether these factors may explain the differential Th polarization induced by ISS-ODN and Pam3Cys, BMDC were stimulated with ISS-ODN or Pam3Cys and the expression of costimulatory molecules and the production of cytokines were determined. As shown in Fig. 2A, both ISS-ODN and Pam3Cys induced up-regulation of the costimulatory molecules CD40, B7-1 and B7-2, whereas only Pam3Cys led to an up-regulation of B7RP-1. The up-regulation of B7RP-1 was even more pronounced in mature DC from mediastinal LN after immunization with OVA and Pam3Cys (Fig. 2B), whereas ISS-ODN showed less effect.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. Activation of BMDC by ISS-ODN and Pam3Cys. A, Expression of costimulatory molecules in vitro. BMDC were cultured in the absence or presence of ISS-ODN (1 µM) or Pam3Cys (5 µg/ml) for 16 h. Surface expression of CD40, B7-1, B7-2, and B7RP-1 were measured by flow cytometry. Data shown are from one representative experiment of six experiments and are gated on the live CD11c+ population. Gray lines: isotype control, dashed lines: unstimulated control, solid lines: ISS-ODN or Pam3Cys (Pam) stimulated cells. B, Expression of B7RP-1 on DC from mediastinal LN cells in vivo. Mice were immunized as described in Fig. 1, G–H. Mediastinal LN were harvested and surface expression of B7RP-1 determined by flow cytometry. Data shown are pooled cell preparations from three mice per group and are gated and the live CD11c+/MHC class II high population. C, Concentration of IL-12p40, IL-12-p70, IL-13, IL-10, and IL-6 were measured by ELISA from the culture supernatant of BMDC after stimulation with ISS-ODN (1 µM) or Pam3Cys (5 µg/ml) for 16 h. IFN-{alpha} was determined by bioassay. Data from one representative experiment of four experiments is shown. D, Expression of TNF-{alpha}, I{kappa}B{alpha}, IL-12p35, IL-6, IFN{beta}, IL-18, IL-12p40, IL-27p28, IL-1{beta}, IL-13, GMCSF, and IL-10 mRNA were determined by quantitative real-time PCR. BMDC were cultured in the absence (control) or presence of ISS-ODN (1 µM) and Pam3Cys (5 µg/ml) for 6 h. Data from one representative experiment of five experiments normalized to the expression of CPH are shown and expressed as fold increase over control. ISS = ISS-ODN, Pam = Pam3Cys.

 
We next analyzed production of IFN{alpha}{beta}, IL-12 p40, IL-12 p70, IL-6, IL-10, and IL-13 (Fig. 2C), and a panel of mRNAs known to be involved in Th1/Th2 polarization (Fig. 2D) by BMDC. There was a clear difference in the pattern of cytokines induced. Whereas ISS-ODN induced primarily cytokines associated with a Th1 phenotype like IL-12, IL-18, IL-27, and IFN{alpha}{beta}, Pam3Cys preferentially induced Th2-associated cytokines like IL-13, GM-CSF, and IL-1{beta}. Other genes like TNF-{alpha} and I{kappa}B{alpha} were comparably induced. A similar pattern of cytokine production with Pam3Cys inducing Th2-associated cytokines was observed in primary CD11c+ DC isolated from the spleen. Again, the cytokine response and gene induction by Pam3Cys in BMDC was dependent on TLR2 (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we analyzed the effect of specific TLR stimuli on Th polarization and experimental asthma. Preliminary experiments indicated that ISS-ODN (TLR9) and Pam3Cys (TLR2) induced the most contrasting immune responses. When used as an adjuvant, Pam3Cys induced a Th2 polarization as reflected in the cytokine profile and the production of specific IgG subclasses and IgE, whereas ISS-ODN induced a Th1 polarization. As expected, the effector functions induced by Pam3Cys were dependent on TLR2. Similar Th2 biasing effects were seen after immunization with peptidoglycan, which also activates cells via TLR2. Consistent with our data a recent study showed that different TLR ligands induce distinct Th cell responses in human DC with Pam3Cys inducing a Th2 polarization (11). LPS from Porphyromonas gingivalis, which in contrast to LPS from other species activates cells via TLR2, has also been described to induce T cell cytokines associated with a Th2 phenotype (12). In a different study, it was shown that the Th1/Th2 polarizing effect of LPS from Escherichia coli, which triggers cells via TLR4, was concentration-dependent (13). At low concentrations LPS induced a Th2 bias, whereas at higher concentrations a Th1 phenotype was reported. In contrast, Pam3Cys-induced Th2 polarization appeared not to be concentration dependent. Even a 10-fold higher amount of Pam3Cys than required for maximum induction of IL-13 and IgG1 production did not induce Th1-specific parameters like IFN-{gamma} or IgG2a production. Whether the differences in concentration dependence between LPS and Pam3Cys are due to different signaling pathways or whether different cell types contribute to the phenomenon observed needs to be investigated.

At the cellular level, stimulation of BMDCs with ISS-ODN or Pam3Cys showed distinct activation profiles. Up-regulation of costimulatory molecules like CD40, B7-1 and B7-2 was comparable, whereas up-regulation of B7RP-1, which was shown to support Th2 responses (14), seemed more pronounced after Pam3Cys stimulation in vitro and in vivo. IL-13, IL-1{beta}, and GM-CSF, which support Th2 differentiation or allergy (15, 16, 17, 18), were preferentially induced by Pam3Cys. In contrast, Th1-associated cytokines like IL-12, IFN{beta}, IL-18, and IL-27 (17, 19) were greatly diminished in comparison to stimulation with ISS-ODN. This effect was also seen with IFN-dependent genes (data not shown).

The signaling pathways of TLR2 and TLR9 share common molecules. It was shown that signaling through the adaptor molecule MyD88 plays an important role in the induction of Th1-associated immunity (20). ISS-ODN, a TLR ligand that is believed to be completely dependent on MyD88, was shown to induce a strong Th1 bias (21). In contrast, TLR2 uses at least one additional molecule called Toll-IL-1R domain-containing adapter protein (22, 23). Whether this or further signaling molecules might explain the diversity seen with those two TLR ligands remains to be elucidated.

In summary, we found that the immune response induced by TLR ligands can play an important role in the initiation or prevention of Th2-associated diseases. Immunization with Ag in the context of TLR2 ligands, in contrast to the protective effects of TLR9, can result in experimental asthma. There have been reports suggesting that bacterial infections can be associated with asthma. Interestingly, chlamydia and mycoplasma, bacteria that are strongly associated with the onset of asthma, as well as some viral infections and air pollution particles were shown to elicit some of their effects via TLR2-mediated mechanisms (24, 25, 26, 27). Our study demonstrates that the type of TLR stimulation is able to regulate the development ofTh1/Th2-polarized adaptive immune responses. Therefore, it seems reasonable to consider TLR2 and TLR2-dependent signaling pathways as possible inducers of the immune deviation that results in asthma in humans.


    Acknowledgments
 
We thank Dr. Shizuo Akira for providing the TLR2-/- mice, M. Corr and P. Charos for their help in the care of the mice, and T. Hayashi, C. Rosetto, and C. Tran for technical assistance.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant AI 40682, Dynavax (to E.R.), Deutsche Forschungsgemeinschaft Grants RE1586/1-1 (to V.R.) and HA 3217/1-1 (to H.H.), and National Institutes of Health Grant AI 052406 (to S.K.D.). Back

2 Address correspondence and reprint requests to Dr. Eyal Raz, Department of Internal Medicine and The Sam and Rose Stein Institute for Research on Aging, University of California, San Diego, La Jolla, CA 92093-0663. E-mail address: eraz{at}ucsd.edu Back

3 Abbreviations used in this paper: TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; BMDC, bone marrow-derived dendritic cell; LN, lymph node; AHR, airway hyper-reactivity. Back

Received for publication June 23, 2003. Accepted for publication December 30, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Medzhitov, R.. 2001. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1:135.[Medline]
  2. Takeda, K., S. Akira. 2003. Toll receptors and pathogen resistance. Cell. Microbiol. 5:143.[Medline]
  3. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223:77.[Medline]
  4. Cho, H. J., K. Takabayashi, P. M. Cheng, M. D. Nguyen, M. Corr, S. Tuck, E. Raz. 2000. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism. Nat. Biotechnol. 18:509.[Medline]
  5. Takabayashi, K., L. Libet, D. Chisholm, J. Zubeldia, A. A. Horner. 2003. Intranasal immunotherapy is more effective than intradermal immunotherapy for the induction of airway allergen tolerance in Th2-sensitized mice. J. Immunol. 170:3898.[Abstract/Free Full Text]
  6. Broide, D., J. Schwarze, H. Tighe, T. Gifford, M. D. Nguyen, S. Malek, J. Van Uden, E. Martin-Orozco, E. W. Gelfand, E. Raz. 1998. Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway hyperresponsiveness in mice. J. Immunol. 161:7054.[Abstract/Free Full Text]
  7. Hamelmann, E., J. Schwarze, K. Takeda, A. Oshiba, G. L. Larsen, C. G. Irvin, E. W. Gelfand. 1997. Noninvasive measurement of airway responsiveness in allergic mice using barometric plethysmography. Am. J. Respir. Crit. Care Med. 156:766.[Abstract/Free Full Text]
  8. Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849.[Medline]
  9. Cheung, S. C., S. K. Chattopadhyay, J. W. Hartley, H. C. Morse, 3rd, P. M. Pitha. 1991. Aberrant expression of cytokine genes in peritoneal macrophages from mice infected with LP-BM5 MuLV, a murine model of AIDS. J. Immunol. 146:121.[Abstract]
  10. Rozen, S., H. J. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. S. Misener, 3rd, and S. Krawetz, 3rd, eds. Bioinformatics Methods and Protocols: Methods in Molecular Biology 365. Humana Press, Totowa.
  11. Agrawal, S., A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, B. Pulendran. 2003. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos. J. Immunol. 171:4984.[Abstract/Free Full Text]
  12. Pulendran, B., P. Kumar, C. W. Cutler, M. Mohamadzadeh, T. Van Dyke, J. Banchereau. 2001. Lipopolysaccharides from distinct pathogens induce different classes of immune responses in vivo. J. Immunol. 167:5067.[Abstract/Free Full Text]
  13. Eisenbarth, S. C., D. A. Piggott, J. W. Huleatt, I. Visintin, C. A. Herrick, K. Bottomly. 2002. Lipopolysaccharide-enhanced, Toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med. 196:1645.[Abstract/Free Full Text]
  14. Umetsu, D. T., J. J. McIntire, O. Akbari, C. Macaubas, R. H. DeKruyff. 2002. Asthma: an epidemic of dysregulated immunity. Nat. Immunol. 3:715.[Medline]
  15. Ritz, S. A., M. R. Stampfli, D. E. Davies, S. T. Holgate, M. Jordana. 2002. On the generation of allergic airway diseases: from GM-CSF to Kyoto. Trends Immunol. 23:396.[Medline]
  16. Rosenwasser, L. J.. 1998. Biologic activities of IL-1 and its role in human disease. J. Allergy Clin. Immunol. 102:344.[Medline]
  17. Wynn, T. A.. 2003. IL-13 effector functions. Annu. Rev. Immunol. 21:425.[Medline]
  18. Herrick, C. A., K. Bottomly. 2003. To respond or not to respond: T cells in allergic asthma. Nat. Rev. Immunol. 3:405.[Medline]
  19. Murphy, K. M., S. L. Reiner. 2002. The lineage decisions of helper T cells. Nat. Rev. Immunol. 2:933.[Medline]
  20. Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira, R. Medzhitov. 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2:947.[Medline]
  21. Krieg, A. M.. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709.[Medline]
  22. Horng, T., G. M. Barton, R. A. Flavell, R. Medzhitov. 2002. The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors. Nature 420:329.[Medline]
  23. Yamamoto, M., S. Sato, H. Hemmi, H. Sanjo, S. Uematsu, T. Kaisho, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, et al 2002. Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature 420:324.[Medline]
  24. Prebeck, S., C. Kirschning, S. Durr, C. da Costa, B. Donath, K. Brand, V. Redecke, H. Wagner, T. Miethke. 2001. Predominant role of Toll-like receptor 2 versus 4 in Chlamydia pneumoniae-induced activation of dendritic cells. J. Immunol. 167:3316.[Abstract/Free Full Text]
  25. Lien, E., T. J. Sellati, A. Yoshimura, T. H. Flo, G. Rawadi, R. W. Finberg, J. D. Carroll, T. Espevik, R. R. Ingalls, J. D. Radolf, D. T. Golenbock. 1999. Toll-like receptor 2 functions as a pattern recognition receptor for diverse bacterial products. J. Biol. Chem. 274:33419.[Abstract/Free Full Text]
  26. Becker, S., M. J. Fenton, J. M. Soukup. 2002. Involvement of microbial components and Toll-like receptors 2 and 4 in cytokine responses to air pollution particles. Am. J. Respir. Cell. Mol. Biol. 27:611.[Abstract/Free Full Text]
  27. Bieback, K., E. Lien, I. M. Klagge, E. Avota, J. Schneider-Schaulies, W. P. Duprex, H. Wagner, C. J. Kirschning, V. Ter Meulen, S. Schneider-Schaulies. 2002. Hemagglutinin protein of wild-type measles virus activates Toll-like receptor 2 signaling. J. Virol. 76:8729.[Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 172: 2725-2726. [Full Text]  



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Q. Yu, R. Vazquez, E. V. Khojeini, C. Patel, R. Venkataramani, and D. F. Larson
IL-18 induction of osteopontin mediates cardiac fibrosis and diastolic dysfunction in mice
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H76 - H85.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Phipps, C. E. Lam, G. E. Kaiko, S. Y. Foo, A. Collison, J. Mattes, J. Barry, S. Davidson, K. Oreo, L. Smith, et al.
Toll/IL-1 Signaling Is Critical for House Dust Mite-specific Th1 and Th2 Responses
Am. J. Respir. Crit. Care Med., May 15, 2009; 179(10): 883 - 893.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
P. W. Finn and T. D. Bigby
Innate Immunity and Asthma
Proceedings of the ATS, May 1, 2009; 6(3): 260 - 265.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Gaucher, R. Therrien, N. Kettaf, B. R. Angermann, G. Boucher, A. Filali-Mouhim, J. M. Moser, R. S. Mehta, D. R. Drake III, E. Castro, et al.
Yellow fever vaccine induces integrated multilineage and polyfunctional immune responses
J. Exp. Med., December 22, 2008; 205(13): 3119 - 3131.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. G. Magalhaes, J. H. Fritz, L. Le Bourhis, G. Sellge, L. H. Travassos, T. Selvanantham, S. E. Girardin, J. L. Gommerman, and D. J. Philpott
Nod2-Dependent Th2 Polarization of Antigen-Specific Immunity
J. Immunol., December 1, 2008; 181(11): 7925 - 7935.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Dittrich, H.-C. Chen, L. Xu, P. Ranney, S. Connolly, T. O. Yarovinsky, and H. K. Bottomly
A New Mechanism for Inhalational Priming: IL-4 Bypasses Innate Immune Signals
J. Immunol., November 15, 2008; 181(10): 7307 - 7315.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Kiyokawa, S. Akashi-Takamura, T. Shibata, F. Matsumoto, C. Nishitani, Y. Kuroki, Y. Seto, and K. Miyake
A single base mutation in the PRAT4A gene reveals differential interaction of PRAT4A with Toll-like receptors
Int. Immunol., November 1, 2008; 20(11): 1407 - 1415.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. A. Hudson, G. P. Christophi, R. C. Gruber, J. R. Wilmore, D. A. Lawrence, and P. T. Massa
Induction of IL-33 expression and activity in central nervous system glia
J. Leukoc. Biol., September 1, 2008; 84(3): 631 - 643.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Page, K. M. Lierl, V. S. Hughes, P. Zhou, J. R. Ledford, and M. Wills-Karp
TLR2-Mediated Activation of Neutrophils in Response to German Cockroach Frass
J. Immunol., May 1, 2008; 180(9): 6317 - 6324.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
B J Hales, L J Pearce, M M H Kusel, P G Holt, P D Sly, and W R Thomas
Differences in the antibody response to a mucosal bacterial antigen between allergic and non-allergic subjectsSmoke-free legislation reduces exposure in children
Thorax, March 1, 2008; 63(3): 221 - 227.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. E. Kaiko, S. Phipps, D. K. Hickey, C. E. Lam, P. M. Hansbro, P. S. Foster, and K. W. Beagley
Chlamydia muridarum Infection Subverts Dendritic Cell Function to Promote Th2 Immunity and Airways Hyperreactivity
J. Immunol., February 15, 2008; 180(4): 2225 - 2232.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Yang, Q. Chen, S. B. Su, P. Zhang, K. Kurosaka, R. R. Caspi, S. M. Michalek, H. F. Rosenberg, N. Zhang, and J. J. Oppenheim
Eosinophil-derived neurotoxin acts as an alarmin to activate the TLR2-MyD88 signal pathway in dendritic cells and enhances Th2 immune responses
J. Exp. Med., January 21, 2008; 205(1): 79 - 90.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. Fransen, C. J. Boog, J. P. van Putten, and P. van der Ley
Agonists of Toll-Like Receptors 3, 4, 7, and 9 Are Candidates for Use as Adjuvants in an Outer Membrane Vaccine against Neisseria meningitidis Serogroup B
Infect. Immun., December 1, 2007; 75(12): 5939 - 5946.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen
IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages
J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
N. W. J. Schroder and M. Arditi
IEIIS Meeting minireview: The role of innate immunity in the pathogenesis of asthma: evidence for the involvement of Toll-like receptor signaling
Innate Immunity, October 1, 2007; 13(5): 305 - 312.
[Abstract] [PDF]


Home page
Infect. Immun.Home page
H. Izadi, A. T. Motameni, T. C. Bates, E. R. Olivera, V. Villar-Suarez, I. Joshi, R. Garg, B. A. Osborne, R. J. Davis, M. Rincon, et al.
c-Jun N-Terminal Kinase 1 Is Required for Toll-Like Receptor 1 Gene Expression in Macrophages
Infect. Immun., October 1, 2007; 75(10): 5027 - 5034.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Bevelander, J. Mayette, L. A. Whittaker, S. A. Paveglio, C. C. Jones, J. Robbins, D. Hemenway, S. Akira, S. Uematsu, and M. E. Poynter
Nitrogen Dioxide Promotes Allergic Sensitization to Inhaled Antigen
J. Immunol., September 15, 2007; 179(6): 3680 - 3688.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. S. Bandukwala, B. S. Clay, J. Tong, P. D. Mody, J. L. Cannon, R. A. Shilling, J. S. Verbeek, J. V. Weinstock, J. Solway, and A. I. Sperling
Signaling through Fc{gamma}RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation
J. Exp. Med., August 6, 2007; 204(8): 1875 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. K. Wong, P. F. Y. Cheung, W. K. Ip, and C. W. K. Lam
Intracellular Signaling Mechanisms Regulating Toll-Like Receptor-Mediated Activation of Eosinophils
Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 85 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Fichtner-Feigl, I. J. Fuss, C. A. Young, T. Watanabe, E. K. Geissler, H.-J. Schlitt, A. Kitani, and W. Strober
Induction of IL-13 Triggers TGF-beta1-Dependent Tissue Fibrosis in Chronic 2,4,6-Trinitrobenzene Sulfonic Acid Colitis
J. Immunol., May 1, 2007; 178(9): 5859 - 5870.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Hamm, A. Heit, M. Koffler, K. M. Huster, S. Akira, D. H. Busch, H. Wagner, and S. Bauer
Immunostimulatory RNA is a potent inducer of antigen-specific cytotoxic and humoral immune response in vivo
Int. Immunol., March 1, 2007; 19(3): 297 - 304.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. O. Aliprantis, J. Wang, J. W. Fathman, R. Lemaire, D. M. Dorfman, R. Lafyatis, and L. H. Glimcher
Transcription factor T-bet regulates skin sclerosis through its function in innate immunity and via IL-13
PNAS, February 20, 2007; 104(8): 2827 - 2830.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sun and E. J. Pearce
Suppression of Early IL-4 Production Underlies the Failure of CD4 T Cells Activated by TLR-Stimulated Dendritic Cells to Differentiate into Th2 Cells
J. Immunol., February 1, 2007; 178(3): 1635 - 1644.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Lang, M. Hammer, and J. Mages
DUSP Meet Immunology: Dual Specificity MAPK Phosphatases in Control of the Inflammatory Response
J. Immunol., December 1, 2006; 177(11): 7497 - 7504.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Fujimoto, C.-R. Yu, G. Shi, B. P. Vistica, E. F. Wawrousek, D. M. Klinman, C.-C. Chan, C. E. Egwuagu, and I. Gery
Pertussis Toxin Is Superior to TLR Ligands in Enhancing Pathogenic Autoimmunity, Targeted at a Neo-Self Antigen, by Triggering Robust Expansion of Th1 Cells and Their Cytokine Production
J. Immunol., November 15, 2006; 177(10): 6896 - 6903.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Hasebe, N. D. Pennock, H.-H. Mu, F. V. Chan, M. L. Taylor, and B. C. Cole
A Microbial TLR2 Agonist Imparts Macrophage-Activating Ability to Apolipoprotein A-1
J. Immunol., October 1, 2006; 177(7): 4826 - 4832.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. J. Brown, S. H. Sacks, and M. G. Robson
Toll-Like Receptor 2 Agonists Exacerbate Accelerated Nephrotoxic Nephritis
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1931 - 1939.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
D. W. Denning, B. R. O'Driscoll, C. M. Hogaboam, P. Bowyer, and R. M. Niven
The link between fungi and severe asthma: a summary of the evidence.
Eur. Respir. J., March 1, 2006; 27(3): 615 - 626.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-S. Chang, J. F. Huggett, K. Dheda, L. U. Kim, A. Zumla, and G. A. W. Rook
Myobacterium tuberculosis Induces Selective Up-Regulation of TLRs in the Mononuclear Leukocytes of Patients with Active Pulmonary Tuberculosis.
J. Immunol., March 1, 2006; 176(5): 3010 - 3018.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Querec, S. Bennouna, S. Alkan, Y. Laouar, K. Gorden, R. Flavell, S. Akira, R. Ahmed, and B. Pulendran
Yellow fever vaccine YF-17D activates multiple dendritic cell subsets via TLR2, 7, 8, and 9 to stimulate polyvalent immunity
J. Exp. Med., February 21, 2006; 203(2): 413 - 424.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Qiao, M. V. Andrade, F. A. Lisboa, K. Morgan, and M. A. Beaven
Fc{epsilon}R1 and toll-like receptors mediate synergistic signals to markedly augment production of inflammatory cytokines in murine mast cells
Blood, January 15, 2006; 107(2): 610 - 618.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Yasutomi, Y. Ohshima, N. Omata, A. Yamada, H. Iwasaki, Y. Urasaki, and M. Mayumi
Erythromycin Differentially Inhibits Lipopolysaccharide- or Poly(I:C)-Induced but Not Peptidoglycan-Induced Activation of Human Monocyte-Derived Dendritic Cells
J. Immunol., December 15, 2005; 175(12): 8069 - 8076.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro
T-helper cell type-2 regulation in allergic disease
Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Tada, S. Aiba, K.-I. Shibata, T. Ohteki, and H. Takada
Synergistic Effect of Nod1 and Nod2 Agonists with Toll-Like Receptor Agonists on Human Dendritic Cells To Generate Interleukin-12 and T Helper Type 1 Cells
Infect. Immun., December 1, 2005; 73(12): 7967 - 7976.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
F Y Liew, M Patel, and D Xu
Toll-like receptor 2 signalling and inflammation
Ann Rheum Dis, November 1, 2005; 64(suppl_4): iv104 - iv105.
[Full Text] [PDF]


Home page
J. Immunol.Home page
C. S. Jack, N. Arbour, J. Manusow, V. Montgrain, M. Blain, E. McCrea, A. Shapiro, and J. P. Antel
TLR Signaling Tailors Innate Immune Responses in Human Microglia and Astrocytes
J. Immunol., October 1, 2005; 175(7): 4320 - 4330.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L.-Y. Huang, K. J. Ishii, S. Akira, J. Aliberti, and B. Golding
Th1-Like Cytokine Induction by Heat-Killed Brucella abortus Is Dependent on Triggering of TLR9
J. Immunol., September 15, 2005; 175(6): 3964 - 3970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Patel, D. Xu, P. Kewin, B. Choo-Kang, C. McSharry, N. C. Thomson, and F. Y. Liew
TLR2 Agonist Ameliorates Established Allergic Airway Inflammation by Promoting Th1 Response and Not via Regulatory T Cells
J. Immunol., June 15, 2005; 174(12): 7558 - 7563.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. F. Benjamim, S. K. Lundy, N. W. Lukacs, C. M. Hogaboam, and S. L. Kunkel
Reversal of long-term sepsis-induced immunosuppression by dendritic cells
Blood, May 1, 2005; 105(9): 3588 - 3595.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Zanin-Zhorov, R. Bruck, G. Tal, S. Oren, H. Aeed, R. Hershkoviz, I. R. Cohen, and O. Lider
Heat Shock Protein 60 Inhibits Th1-Mediated Hepatitis Model via Innate Regulation of Th1/Th2 Transcription Factors and Cytokines
J. Immunol., March 15, 2005; 174(6): 3227 - 3236.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. Velasco, M. Campo, O. J. Manrique, A. Bellou, H. He, R. S. S. Arestides, B. Schaub, D. L. Perkins, and P. W. Finn
Toll-Like Receptor 4 or 2 Agonists Decrease Allergic Inflammation
Am. J. Respir. Cell Mol. Biol., March 1, 2005; 32(3): 218 - 224.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Vakharia and J. P. Hinson
Lipopolysaccharide Directly Stimulates Cortisol Secretion by Human Adrenal Cells by a Cyclooxygenase-Dependent Mechanism
Endocrinology, March 1, 2005; 146(3): 1398 - 1402.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Pulendran
Variegation of the Immune Response with Dendritic Cells and Pathogen Recognition Receptors
J. Immunol., March 1, 2005; 174(5): 2457 - 2465.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Sun, M. Walsh, A. V. Villarino, L. Cervi, C. A. Hunter, Y. Choi, and E. J. Pearce
TLR Ligands Can Activate Dendritic Cells to Provide a MyD88-Dependent Negative Signal for Th2 Cell Development
J. Immunol., January 15, 2005; 174(2): 742 - 751.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Q. Khan, Q. Chen, Z.-Q. Wu, J. C. Paton, and C. M. Snapper
Both Innate Immunity and Type 1 Humoral Immunity to Streptococcus pneumoniae Are Mediated by MyD88 but Differ in Their Relative Levels of Dependence on Toll-Like Receptor 2
Infect. Immun., January 1, 2005; 73(1): 298 - 307.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Re and J. L. Strominger
IL-10 Released by Concomitant TLR2 Stimulation Blocks the Induction of a Subset of Th1 Cytokines That Are Specifically Induced by TLR4 or TLR3 in Human Dendritic Cells
J. Immunol., December 15, 2004; 173(12): 7548 - 7555.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Matsushima, N. Yamada, H. Matsue, and S. Shimada
TLR3-, TLR7-, and TLR9-Mediated Production of Proinflammatory Cytokines and Chemokines from Murine Connective Tissue Type Skin-Derived Mast Cells but Not from Bone Marrow-Derived Mast Cells
J. Immunol., July 1, 2004; 173(1): 531 - 541.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Redecke, V.
Right arrow Articles by Raz, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Redecke, V.
Right arrow Articles by Raz, E.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Asthma
Hazardous Substances DB
*CYSTEINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS