The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, R.
Right arrow Articles by Chougnet, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, R.
Right arrow Articles by Chougnet, C.
The Journal of Immunology, 2004, 172: 2678-2686.
Copyright © 2004 by The American Association of Immunologists

CD40 Ligand Dysregulation in HIV Infection: HIV Glycoprotein 120 Inhibits Signaling Cascades Upstream of CD40 Ligand Transcription1

Rui Zhang*, Carl J. Fichtenbaum{ddagger}, David A. Hildeman{dagger}, Jeffrey D. Lifson§ and Claire Chougnet2,*

Divisions of * Molecular Immunology and {dagger} Immunobiology, Cincinnati Children’s Hospital Research Foundation, Cincinnati, OH 45229, {ddagger} Infectious Disease Center, University of Cincinnati Medical Center, Cincinnati, OH 45267; and § AIDS Vaccine Program, Science Applications International Corporation-Frederick, National Cancer Institute, Frederick, MD 21702


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-12 production and up-regulation of CD40 ligand (CD40L) expression are impaired in the PBMC of HIV-infected donors, and exogenous CD40L rescues IL-12 production by such cells. In this study, we implicate dysregulation of CD40L expression in the IL-12 defect associated with HIV by demonstrating that induction of CD40L expression by anti-CD3/CD28 stimulation was directly correlated with the IL-12 productive capacity of PBMC. Further, we demonstrate marked decreases in the induction of CD40L protein and mRNA following anti-CD3/CD28 stimulation in HIV-infected donors compared with uninfected donors, with a tight association between these two levels. Inhibition of CD40L up-regulation was selective, as induction of CD69 or OX40 was not as severely affected. Increased instability of CD40L mRNA did not constitute a major mechanism in CD40L dysregulation, thus suggesting a potential defect in the signaling cascades upstream of transcription. The mechanisms by which HIV infection affects the induction of CD40L expression appear to involve HIV gp120-mediated engagement of CD4. Indeed, anti-CD4 mAb or inactivated HIV virions that harbor a conformationally intact gp120 significantly inhibited CD40L up-regulation at both the protein and mRNA levels. This inhibition was due to the native, virion-associated gp120, as coculture with soluble CD4 or heat treatment of inactivated HIV abolished their effect. These in vitro models mirror the CD40L defect seen in cells from HIV-infected donors and thus provide a suitable model to investigate HIV-induced CD40L dysregulation. Clear elucidation of mechanism(s) may well lead to the development of novel immunotherapeutic approaches to HIV infection.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human immunodeficiency virus infection is associated with a gradual loss of immune competence, leading to increased susceptibility to infections and cancers. Hallmarks of HIV-associated defects in cell-mediated immunity include: 1) aberrant or absent CD4+ T cell responses; 2) inefficient CD8+ T cell activity; and 3) dysregulation of APC function. Such defects are at the origin of poor control of the replication of HIV and other pathogens for which cell-mediated immunity is essential for clearance.

Among the APC functions that have been reported defective in HIV infection is a marked impairment of production of IL-12 by PBMC and macrophages from HIV-infected (HIV+) patients (1, 2, 3, 4, 5, 6, 7, 8, 9). This defect in IL-12 production does not reflect a global deficiency in secretion of proinflammatory cytokines by APC, as production of TNF-{alpha} and IL-1{beta} are not reduced (1, 2). IL-12 is a key link between innate and adaptive immunity (reviewed in Ref. 10). It is a potent inducer of IFN-{gamma} from T cells and NK cells, enhances NK cytotoxicity, as well as the generation of cytolytic CD8+ T lymphocytes. IL-12 is also comitogenic for T and NK cells and is necessary for in vivo delayed-type hypersensitivity reactions. Interestingly, all these functions are known to be dysfunctional in HIV+ patients. IL-12 has been shown to play a critical role in resistance in murine models of infection with a variety of intracellular microbes (including Mycobacteria, Cryptosporidia, Toxoplasma, and Histoplasma), which are all pathogens that cause disease of greater frequency and/or severity in HIV+ subjects than in HIV-uninfected (HIV-) individuals.

IL-12, which consists of two disulfide-linked subunits (p40 and p35) that form bioactive p70 heterodimers, is produced mainly by APC (monocytes/macrophages and dendritic cells). Production of IL-12 is induced by a variety of bacterial stimuli (signaling through Toll-like receptors) as well as by T cell-derived stimuli, especially CD40 ligand (CD40L)3 (10). One of the most potent inducers of IL-12 by human APC is Staphylococcus aureus Cowan (SAC). Although SAC can induce IL-12 production by purified APC, its IL-12-inducing activity is strongly enhanced by interactions with activated CD4+ T cells (11), and with CD40L in particular (12).

CD40L, a member of the TNF superfamily, undergoes tightly regulated, inducible expression on the surface of CD4+ T cells as a result of signals derived from TCR stimulation (13). CD40L expression appears to be largely controlled at the mRNA level (both transcriptionally and posttranscriptionally), although posttranslational regulation (by endocytosis or proteolytic cleavage) occurs as well (reviewed in Ref. 13). We and others have shown that the defective IL-12 production (and CD8+ T cell function) in HIV infection can be ameliorated in vitro by the addition of exogenous CD40L (9, 12, 14, 15, 16). Further, patients who have AIDS and patients who have the X-linked hyperIgM syndrome (due to a CD40L genetic mutation) suffer from a similar spectrum of opportunistic infections (17). Taken together, these data strongly suggest that defective CD40/CD40L interactions are mechanistically important to HIV-related abnormalities in cell-mediated immunity and to the IL-12 deficit in particular.

The capacity to up-regulate CD40L on purified CD4+ T cells becomes progressively impaired in HIV infection, in parallel with overall immunosuppression (9, 18). Underlying mechanisms of CD40L impairment likely involve interactions between the major HIV-1 surface glycoprotein, gp120, and the CD4 receptor on the surface of CD4+ T cells (in our study and in Ref. (19). HIV gp120 is present at high concentrations in tissues (20, 21), and circulates in the blood of HIV+ donors on the surface of virions (both infectious and noninfectious) and as a free protein (22). Thus, gp120-mediated alterations in CD40L expression provide a potential mechanism for defective T cell (and APC) HIV-infected and uninfected CD4+ T cells alike.

In the present study, we have further investigated molecular mechanisms underlying IL-12 impairment during HIV infection. First, we report for the first time the existence of a correlation between anti-CD3/CD28-induced CD40L expression and the production of IL-12 after SAC stimulation. Second, we show that pre-engagement of CD4, via anti-CD4 mAb or inactivated virions, is sufficient to inhibit CD40L up-regulation after TCR stimulation. Induction of CD40L is regulated at many levels (transcriptional, posttranscriptional, and posttranslational) (13). Importantly, the present study demonstrates that dysregulation of CD40L induction in HIV infection likely occurs at the level of transcription, possibly in the upstream signaling cascades leading to CD40L mRNA induction. Furthermore, our data clearly implicate major defect(s) in the early events following TCR engagement, following pre-engagement of CD4 as well as in activated T cells from HIV+ donors. Importantly, increased apoptosis does not appear to represent a major underlying mechanism of CD40L dysregulation in our experimental system. Taken together, our results suggest a causal relationship between exposure to native, virion-associated gp120 and impaired IL-12 production, which is consequent to the defective up-regulation of CD40L expression. This defect may be an important factor contributing to the cellular immune deficits observed in HIV infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

Heparinized blood samples were obtained from 26 HIV+ adult patients from the University of Cincinnati Infectious Diseases Center (Cincinnati, OH) and were processed within 4 h of collection. Patients had CD4 counts lower than 500 CD4/mm3 with detectable viral loads (>50 copies/ml, Ultrasensitive HIV RT-PCR 1.0; Roche Diagnostic Systems, Indianapolis, IN). They had no active opportunistic infections or cancer. Blood samples from 26 healthy adult HIV- donors were obtained by recruitment of healthy volunteers at the Cincinnati Children’s Research Foundation (Cincinnati, OH). In addition, buffy coats from healthy adult donors were obtained from the Hoxworth Blood Bank Center, Cincinnati, OH. All protocols were approved by the corresponding Institutional Review Boards.

Cell preparation

PBMC. PBMC were separated on lymphocyte separation medium (Ficoll-Hypaque; Amersham Biosciences, Piscataway, NJ) and resuspended at 107/ml in complete medium (RPMI 1640 containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, and 5 mM HEPES; all from Life Technologies, Gaithersburg, MD).

T cells. T cells were purified from PBMC by negative selection. After a first step of plastic adherence (45 min at 37°C), nonadherent cells were treated by a mixture of lytic Ab and complement, according to the manufacturer’s instructions (T-Qwick; One-Lambda, Los Angeles, CA). Purified T cells were >90% pure, as assessed by FACS.

CD4+ T cells. CD4+ T cells were further purified from T cells by magnetic negative selection, according to the manufacturer’s instructions (CD4 Negative Selection kit; Dynal Biotech, Lake Success, NY). Purified CD4+ T cells were >95% pure, as assessed by FACS.

Cell stimulation

Cytokine production. PBMC were stimulated with SAC (pansorbine; Calbiochem, La Jolla, CA) at a 0.01% final concentration at 37°C at 1.5 x 106/ml in duplicate in 96-well plates, in complete medium supplemented with 5% heat-decomplemented human AB+ serum (Gemini Bio-Products, Calabasa, CA). As a control, cells were also cultured without stimulation. The 24-h supernatants were harvested and kept frozen at -80°C before cytokine analysis. IL-12 p70 production was measured by ELISA, using R&D Systems kits (Minneapolis, MN) at a detection limit of 4 pg/ml. For statistical purpose, all values below the detection limit were assigned an arbitrary value of one-half the detection limit.

Expression of activation markers on T cells. A total of 5 x 105 T cells (or purified CD4+ T cells) were stimulated (or not stimulated, as a control) for different times with magnetic beads coated with anti-CD3 and anti-CD28 Ab (T cell Expander; Dynal Biotech) in duplicate in 96-well plates in complete medium supplemented with 2% human AB+ serum. Preliminary experiments had determined the optimal concentration to be 2.5 µl beads/106 T cells; this concentration was therefore used throughout the study. After incubation, cells were washed with FACS buffer (PBS, 10% FCS, 0.01% sodium azide), and incubated with human IgG (20 µg/ml, Sigma-Aldrich, St. Louis, MO) for 10 min at +4°C, to block Fc receptor. They were then stained for 3- or 4-color FACS analysis with labeled Ab that recognize CD4, CD40L (CD154), CD69, or OX40 (CD134), or with isotype-matched control Ab (all Ab from BD PharMingen, Mountain View, CA), for 30 min at +4°C. The cells were then washed twice before being fixed in FACS buffer containing 4% paraformaldehyde (30 min minimum at +4°C). Surface expression was analyzed using a FACSCalibur and the CellQuest software (BD Biosciences, San Jose, CA). A minimum of 15,000 cells (debris and dead cells gated out using forward-scatter analysis) was analyzed. Results are expressed as the percentage of cells expressing a given marker compared with the isotype staining or as the mean fluorescence intensity (MFI) of such markers.

CD40L mRNA expression. A total of 2 x 106 T cells (or CD4+ T cells) were stimulated (or not, as a control) with anti-CD3/CD28 beads in 48-well plates in complete medium supplemented with 2% human AB+ serum. In some experiments, CD4+ T cells were stimulated with the phorbol ester PMA (100 ng/ml; Calbiochem) or the Ca2+ ionophore ionomycin (10 µg/ml; Calbiochem). In some experiments, PBMC (2 x 106/condition) were stimulated with SAC (0.01% final concentration) or anti-CD3/CD28 beads. After incubation, cells were washed twice with PBS, resuspended in RNAlater (Qiagen, Santa Clarita, CA) and kept at -20°C before RNA extraction. Total RNA was extracted using RNAeasy mini kits, following manufacturer’s instruction (Qiagen). RNA was quantified by spectrophotometer absorbance and 0.5 µg of RNA was reverse-transcribed using superscript reverse transcriptase (Life Technologies) and random primers (Roche Molecular Systems, Pleasanton, CA), as described earlier (2). A one-fourth dilution of the RT product was amplified using real-time PCR, performed in a Light-Cycler (Roche) using a SYBR green PCR kit (Roche) and specific primers to amplify 100–200 bp fragments from the different genes analyzed. The sequences for synthesized primers are (listed 5' to 3'): CD40L (forward: CCACAGTTCCGCCAAACCT, reverse: GAAGACTCCCAGCGTCAGCT); CD4 (forward: AAGCATGGAGCATGGGACTG, reverse: TCCATCCTTGACTGGCTTGG). Melting curves and agarose gel electrophoresis established the purity of the amplified band. A threshold was set in the linear part of the amplification curve, and the number of cycles needed to reach it was calculated for each gene. Threshold cycle values for each gene were then normalized to CD4 using the equation 1.8(CD4-CD40L), where CD4 is the mean threshold cycle of duplicate CD4 runs and CD40L is the mean threshold cycle of duplicate runs of CD40L, as previously described (23). Fold increase of CD40L mRNA expression in stimulated vs unstimulated cultures was then calculated for each donor.

Pre-engagement of the CD4 receptor. CD4+ T cells from HIV- donors were incubated for 1 h at +4°C with Ab against the domain 1 of the CD4 molecule (clone QS4120), or against the domain 2 (clone M-T441), or with an isotype control Ab (mouse IgG1), with all Ab at 10 µg/ml (Ancell, Bayport, MN), or left untreated. After several washes, cells were stimulated with anti-CD3/CD28 beads for 24 or 48 h, for protein expression (measured by FACS), or for 2 h for mRNA expression (measured by quantitative RT-PCR), as previously described.

CD4+ T cells from HIV- donors were also stimulated with anti-CD3/CD28 beads in presence of either inactivated HIV-1MN or HIV-1ADA treated with aldrithiol-2 (AT-2) (24). As a control, cultures were treated with the corresponding microvesicles, prepared from uninfected cultures of the cell lines used to propagate the viruses, CEM x 174 and SEMT1, respectively. Graded concentrations of AT-2-treated HIV, expressed in quantity of HIV p24gag equivalent/106 cells (25), were added to the cultures. Microvesicles were added at a concentration that provides an equal amount of total protein as the equivalent AT-2-treated virus. In addition, a preparation of AT-2-inactivated HIVMN that was heat treated (60°C) to dissociate gp120 from the surface of the virus (26) was used to determine the involvement of gp120 in CD40L dysregulation. To further determine whether inactivated viruses act through gp120-mediated engagement of CD4, we analyzed whether soluble CD4, which encompasses the N-terminal 183 amino acid residues of CD4 (27), would block AT-2 activity. This reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health (soluble CD4-183 from Amersham Biosciences). Graded concentrations (0.1 to 10 µg/ml) of soluble CD4 were incubated with AT-2-treated viruses (or microvesicles or medium) for 30 min at +4°C, before adding the CD4+ T cells. Cells were then cultured as previously described. To determine the role of apoptosis in CD40L dysregulation, CD4+ T cells from HIV- donors were preincubated for 1 h at +37°C with the pan-caspase inhibitor BD-fmk (50 µM; Enzyme Systems Products, Livermore, CA) or with DMSO (1/500; Sigma-Aldrich), as a control, or left untreated. Cells were then stimulated with anti-CD3/CD28 beads for 48 h in presence (or absence) of AT-2-treated HIV-1MN. Induction of apoptosis was determined by costaining with propidium iodide and FACS analysis.

CD40L mRNA stability. T cells (or purified CD4+ T cells) from HIV- and HIV+ donors were cultured either with medium or anti-CD3/CD28 beads. In some experiments, CD4+ T cells from HIV- donors were first treated with the anti-domain 1 of CD4 or an isotype-matched control Ab (as previously mentioned) before being stimulated. After 2 h, mRNA was harvested from unstimulated cells. At the same time, anti-CD3/CD28 beads were removed by magnetic separation and the stimulated cells were divided in 4 aliquots. One was used to prepare mRNA (time 0); the three others were cultured in presence of actinomycin D (10 µg/ml; Sigma-Aldrich) for an additional 15, 30, or 60 min. CD40L mRNA was measured by RT-PCR in all samples and values normalized using the corresponding CD4 mRNA levels. The fraction of remaining CD40L after treatment was calculated considering the time 0 value as 1. Fit curves were used to estimate the mRNA half-life.

Statistical analysis

Expression of proteins or genes was compared between HIV+ and HIV- donors using the unpaired two-tail t test. Correlations were analyzed using ANOVA tests. The effect of treatment with anti-CD4 Ab or inactivated virus was analyzed using paired t test. Values of p < 0.05 were considered to be significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Impaired IL-12 production and deficient CD40L expression are correlated

The mechanisms underlying IL-12 impairment in HIV infection have not been completely elucidated. Due to the cellular context in which IL-12 impairment was described in HIV+ donors (whole PBMC, as opposed to isolated monocytes), deficient CD4+ T cell help, and deficient CD40-CD40L interactions in particular, represents a possible underlying mechanism (12). To address this question, we determined whether levels of IL-12 production and CD40L induction were correlated. Consistent with our previous results, a profound defect in the production of IL-12 p70 (Fig. 1A) was observed after stimulation with SAC (p < 0.005, unpaired t test, compared with HIV- donors). Importantly, SAC-induced IL-12 production was directly correlated with anti-CD3/CD28-induced CD40L expression (Fig. 1B). These results thus suggest blunted up-regulation of CD40L expression as a potential mechanism underlying IL-12 dysregulation in HIV infection.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Defective SAC-stimulated IL-12 production in HIV+ donors is correlated with defective CD40L expression. A, IL-12 production in HIV+ donors. Basal levels and SAC-induced IL-12 production by PBMC from 13 HIV+ and 15 HIV- donors were measured in 24-h supernatants by ELISA. Asterisks indicate a significant difference between HIV+ and HIV- donors (p < 0.005, unpaired t test). B, Correlation between CD40L expression and IL-12 production. T cells from the same HIV+ and HIV- donors were stimulated with anti-CD3/CD28 for 24 h. Cells were stained with labeled anti-CD4 and anti-CD40L Ab; CD40L surface expression on CD4+ T cells was analyzed by FACS. Results are expressed as the percentage of stimulated CD4+ T cells that express CD40L. Data from HIV+ donors (•) and from HIV- donors ({circ}) are shown. Asterisks indicate a significant correlation (p < 0.005, regression, combined data from HIV+ and HIV- donors).

 
CD40L expression is blunted in HIV+ donors

Blunted up-regulation of surface expression of CD40L has been shown in HIV+ donors (9, 18). Because expression of this marker is tightly regulated, with different levels of regulation (transcription, posttranscription, posttranslation), the first focus of our studies was to determine the level of dysregulation in HIV+ donors. The kinetics of CD40L protein and mRNA expression was first analyzed in HIV- donors, as the published data (arising from varying experimental systems) have not reached a consensus. Using a polyclonal T cell activation system that mimics peptide-laden APC-mediated T cell activation (beads coupled to mAb to CD3 and CD28), up-regulation of CD40L protein expression occurred from 6 to 48 h, with rapid down-regulation thereafter. CD40L mRNA expression peaked 2 h after stimulation (data not shown).

Based on these data, the kinetic expression of CD40L (protein and mRNA) by T cells from HIV+ donors was compared with that of cells from HIV- donors. HIV+ donors who had already reached the chronic phase of infection were enrolled. This population was chosen as published data suggest that they are more likely to exhibit dysregulation of CD40L (9, 18). Data obtained from 13 HIV+ donors (compared with 15 HIV- individuals) confirmed that CD40L protein expression on activated CD4+ T cells was impaired in HIV+ donors at 24 and 48 h (Fig. 2, A and B). Up-regulation of CD40L expression occurs as a shift of the overall population, not as a marker expressed in a discrete subpopulation. In the case of HIV+ donors, this shift was dramatically reduced (Fig. 2A shows an example of CD40L expression in representative HIV+ and HIV- donors). Importantly, induction of CD40L mRNA expression was decreased at all time points (Fig. 2C), with a >3-fold decrease at 2 h, when expression peaks. Furthermore, protein expression at 24 h (Fig. 2D) and at 48 h (data not shown) was highly correlated with the magnitude of induction of mRNA expression, in both HIV+ and HIV- donors. Thus, the primary site of dysregulation of CD40L expression in HIV appears to be either at the mRNA level (transcription or posttranscription) or upstream, in the signaling cascades leading to CD40L mRNA induction.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2. CD40L expression is down-regulated in HIV+ patients. T cells from 13 HIV+ donors and 15 HIV- matched donors were either analyzed before culture (No cult) or cultured without stimulation (Uns) or in presence of anti-CD3/CD28 beads (Stim). A, Surface expression of CD40L in a representative HIV+ and HIV- donor. CD40L expression was analyzed 24 h postculture on gated CD4+ T cells. Percentages of CD4+ that are CD40L+ are indicated for each donor. B, Mean surface expression of CD40L. Results are expressed as the mean percentage ± SE of CD4+ T cells that are CD40L+. Asterisks indicate a significant difference between HIV+ (closed histograms) and HIV- (open histograms) donors by the unpaired t test (*, p < 0.05; **, p < 0.005; ***, p < 0.0005). Data include cells from all donors, except for the "No culture" data, which include cells from 7 of 13 HIV+ and 13 of 15 HIV- donors. C, Mean CD40L mRNA expression. Results are expressed as the mean fold increase ± SE between mRNA values of stimulated and unstimulated cells (after normalization of each CD40L mRNA value with the corresponding CD4 mRNA level). Data include cells from all donors, except for the "No culture" data, which include cells from 7 of 13 HIV+ and 13 of 15 HIV- donors, and the overnight data, which include cells from 9 HIV+ and 14 HIV- donors. D, Correlation between protein and mRNA expression. Linear regression of anti-CD3/CD28-induced CD40L protein (24 h) and mRNA expression (2 h) is represented. The plain line corresponds to data from HIV+ (•) donors and the dotted line to data from HIV- ({circ}) donors. Asterisks indicate a significant correlation (p < 0.05).

 
Both mRNA and protein expression were decreased at all time points, ruling out a delayed kinetics. Interestingly, CD40L protein expression was increased on CD4+ T cells analyzed before any in vitro culture (Fig. 2B). There was also a trend toward increases in mRNA expression in uncultured cells (0.97 ± 0.53 vs 0.63 ± 0.17 arbitrary units, for HIV+ and HIV- donors, respectively), but this difference did not reach statistical significance.

Expression of other T cell activation markers, CD69, an early activation marker, and OX40 (CD134), another member of the TNF superfamily (28), was also analyzed. Up-regulation of these two markers on stimulated CD4+ cells from HIV+ donors was also decreased at 24 and 48 h (Table I). However, the reduction was less pronounced than what was observed for CD40L expression: both CD69 and OX40 expression was reduced by ~25%, compared with >50% for CD40L expression (Fig. 2). Again, the deficit did not appear to be due to delayed kinetics, as percentages of expressing cells were decreased at both 24 and 48 h. To document the selectivity of CD40L impairment, coexpression of CD69 and CD40L was determined on stimulated CD4+ T cells from HIV+ and HIV- donors. Cells that coexpress CD69 and CD40L were significantly decreased in HIV+ donors compared with HIV- donors, at both 24 h (mean percentage of 9.8 ± 1.8% vs 22.3 ± 2.5% for HIV+ vs HIV- donors, respectively; p = 0.0008 by unpaired t test) and 48 h (15.0 ± 3.2% vs 34.1 ± 4.4%; p = 0.003).


View this table:
[in this window]
[in a new window]
 
Table I. CD69 and OX40 expression on CD4+ T cells from HIV+ and HIV- donorsa

 
Role of gp120-mediated CD4 engagement as mechanism of CD40L dysregulation

To gain further insights into CD40L dysregulation in HIV, we modeled in vitro the engagement of CD4 with gp120, before activation. Two models were used (anti-CD4 Ab, inactivated HIV virions), followed by stimulation with anti-CD3/CD28 beads.

CD4+ T cells from HIV- donors were treated with an anti-CD4 Ab that binds to the same domain 1 of the CD4 molecule as gp120 (29). This Ab is also capable of blocking HIV infection. As controls, another anti-CD4 mAb, which binds elsewhere (domain 2) and fails to block HIV infection, and an unrelated Ab of the same isotype, were used. As shown in Fig. 3A, the domain 1 mAb uniquely inhibited the expression of CD40L. This inhibition was specific, as induction of CD69 was not altered. Furthermore, treatment with domain 1 Ab decreased activation-induced CD40L mRNA expression (Fig. 3B).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Up-regulation of CD40L, but not of CD69, expression is inhibited after exposure to an Ab to the domain 1 of the CD4 molecule. CD4+ T cells from HIV- donors were preincubated with 1) Ab against the domain 1 of the CD4 molecule, 2) Ab against the domain 2, 3) isotype control (all Ab at 10 µg/ml), or 4) left untreated. Cells were then stimulated with anti-CD3/CD28 for 48 h, for protein expression (by FACS) or for 2 h for mRNA expression (by quantitative RT-PCR). A, Effect on protein expression of CD40L and CD69. Results are expressed as the mean percentage of inhibition of MFI of treated vs untreated cells (six donors). CD40L MFI at 48 h was 29.1 ± 4.1, 19.2 ± 3.9, 27.7 ± 4.8, and 28.5 ± 5, for conditions 1), 2), 3), and 4), respectively. CD69 MFI at 48 h was 152 ± 16, 155 ± 15, 146 ± 18, and 153 ± 14, for conditions 1), 2), 3), and 4), respectively. B, Effect on CD40L mRNA expression. Results are expressed as the mean percentage of inhibition of the fold increase between stimulated and unstimulated (five donors). Asterisk indicates a significant difference between the anti-domain 1 and anti-domain 2 Ab. #, A significant difference between the anti-domain 1 and the isotype control (paired t test, p < 0.05).

 
To expand our analysis of the effects of CD4 pre-engagement on CD40L expression, AT-2-inactivated HIV was used. AT-2 inactivates the infectivity of retroviruses by preferential covalent modification of the free sulfhydryls of the cysteines of virion internal proteins, most notably the nucleocapsid proteins. However, AT-2 treatment preserves the structural and functional integrity of the envelope glycoproteins on the surface of virions because the cysteines in these proteins are in disulfide-linked form. As a result, AT-2-inactivated virions are noninfectious, but interact authentically with cell surface receptors, making them a useful reagent to distinguish between processes that are triggered by receptor engagement and those that require productive infection (25, 30). As shown in Fig. 4A, CD4+ lymphocytes from HIV- donors cultured with AT-2-treated HIVMN (but not with control microvesicles) exhibited a dose-dependent reduction of their capacity to up-regulate CD40L after stimulation. As seen with the anti-CD4 domain 1 Ab, AT-2-inactivated virus specifically inhibited the up-regulation of CD40L expression, as CD69 expression was not altered (Fig. 4A). Of note, this phenomenon occurs with both CCR5- and CXCR4-using strains of HIV. Indeed, HIVADA (a CCR5-using strain), induced a level of inhibition of CD40L expression similar to that induced by HIVMN, a CXCR4-using strain (Table II).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. HIV inhibits up-regulation of CD40L expression through a gp120-dependent mechanism. CD4+ T cells from HIV- donors were stimulated with anti-CD3/CD28 for 48 h in presence of AT-2-treated viruses and their microvesicle controls, or left untreated. Effect on CD40L expression is expressed as the mean percentage of inhibition of the CD40L MFI of treated vs untreated cells. Asterisks indicate a significant difference between HIV- and microvesicle-treated cells (*, p < 0.05; **, p < 0.005 by paired t test). A, AT-2-inactivated HIV inhibits up-regulation of CD40L expression, but not of CD69 expression. AT-2-inactivated HIVMN ({blacksquare}); control microvesicles ({diamond}). Cells from seven donors were analyzed. B, Soluble CD4 reverses the HIV-mediated inhibition of CD40L expression. CD4+ T cells (four donors) were treated with AT-2-treated HIVMN (2 µg/ml HIV p24/106 cells) in presence or absence of graded concentrations of soluble CD4. Mean CD40L MFI was 24.1 ± 2.4, 6.6 ± 0.5, 9.1 ± 0.5, 20.6 ± 1.4, and 26.1 ± 2.0 for cells untreated or treated with AT-2 HIV alone or combined with soluble CD4 at 0.1, 1, 10 µg/ml, respectively. C, Heat treatment of AT-2-inactivated virus abolishes its inhibitory effect. CD4+ T cells (three donors) were stimulated in presence of 1) AT-2-inactivated, heat-treated HIVMN, 2) AT-2-inactivated HIVMN (both at 2 µg/ml p24/106 cells), 3) CEM x 174 microvesicles, or 4) left untreated. Mean CD40L MFI was 20.0 ± 1.1, 11.2 ± 0.5, 20.6 ± 0.9, and 23.6 ± 2.2, for conditions 1), 2), 3), and 4), respectively.

 

View this table:
[in this window]
[in a new window]
 
Table II. CXCR4- and CCR5-using AT-2-inactivated virus similarly inhibits CD40L expressiona

 
To ascertain the role of gp120-mediated engagement of CD4 in the inhibition of CD40L up-regulation, we used two approaches including 1) blockade of such interactions with soluble CD4, and 2) use of a AT-2-inactivated, heat-treated virus. Addition of soluble CD4 at concentrations able to block HIV infection by most laboratory strains (1 and 10 µg/ml) (27) almost completely abolished the inhibitory effect of AT-2-treated HIV on CD40L expression (Fig. 4B). In contrast, a lower concentration (0.1 µg/ml), which does not protect against in vitro HIV infection, did not reverse the AT-2-treated HIV-mediated inhibitory effect. Soluble CD4 did not affect CD40L expression when used alone or in conjunction with microvesicles (data not shown). To further ascertain the role of gp120, we use HIVMN viruses that have been either AT-2-treated only or AT-2- and heat-treated. Heat treatment, which promotes dissociation of gp120 from the virions, completely abolished HIV-induced inhibition of CD40L up-regulation (Fig. 4C). As expected, CD69 expression was not affected by any of these viruses (data not shown). These data strongly suggest that interactions between native, virion-associated gp120 and CD4 are sufficient to induce CD40L dysregulation. These in vitro models of CD4 engagement therefore closely mirror ex vivo defects.

One potential confounding factor in the interpretation of these data may be increased apoptosis induced by CD4 pre-engagement, as previously shown by several laboratories (31, 32, 33, 34, 35), something that could nonspecifically interfere with the capacity to up-regulate CD40L. To address this issue, induction of apoptosis was determined in CD4+ T cells from five HIV- donors that were stimulated with anti-CD3/CD28, in presence (or absence) of AT-2-treated HIVMN. After 48 h, only a modest increase in apoptosis was observed in the T cells exposed to AT-2-treated HIV (18.4 ± 2.4% in AT-2-treated cultures vs 13.1 ± 0.9% in untreated cultures, p = 0.06, paired t test). Moreover, HIV-mediated inhibition of CD40L induction was not significantly decreased by culturing the CD4+ T cells in the presence of the pan-caspase inhibitor BD-fmk (36). Indeed, mean percentages of CD40L inhibition were 46.3 ± 4.4%, 42.7 ± 3.9%, and 47.8 ± 4.1% in untreated, BD-fmk-treated, and DMSO-treated T cells, respectively (all p > 0.2, paired t test). These results suggest that apoptosis does not represent a major underlying mechanism of CD40L dysregulation in our experimental system.

Decreased CD40L mRNA expression is not due to decreased mRNA half-life

Several studies have reported that mRNA stability plays an important role in CD40L expression (37, 38, 39, 40). We thus investigated whether increased mRNA instability could underlie blunted CD40L up-regulation. Stability of CD40L mRNA was analyzed by adding the RNA synthesis inhibitor actinomycin D to activated T cells at the peak of mRNA accumulation (2 h), and following the kinetics of subsequent mRNA decay by real-time RT-PCR. The half-life of CD40L mRNA in HIV- donors was determined to be 20.9 ± 4.9 min (Fig. 5A). Importantly, the half-life of CD40L mRNA appeared increased in the cells from HIV+ donors (with clinical characteristics similar to the donors described in Fig. 2) compared with those from HIV- donors, with >50% of CD40L mRNA remaining after 60 min of actinomycin D treatment (Fig. 5B). In all HIV+ donors, CD40L mRNA decay was not linear, with a first phase of stability, followed by decline. mRNA half-life was also determined in cells from HIV- donors pretreated with either the anti-CD4 Ab (against the domain 1, as previously described) or an isotype control. No clear difference in mRNA stability was observed between anti-CD4 and isotype-treated cells (Fig. 5C). Taken together, these data suggest that increased mRNA instability is not likely to be the main mechanism of blunted CD40L expression in HIV infection.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 5. Decreased CD40L mRNA expression is not due to decreased mRNA half-life. A and B, T cells were cultured in presence of anti-CD3/CD28 beads for 2 h. C, CD4+ T cells from HIV- donors were pretreated with either anti-CD4 Ab, anti-domain 1 ({blacksquare}), or an isotype control Ab ({diamond}), both at 10 µg/ml. Stimulated cells were divided in 4 aliquots. One was used to prepare mRNA (time 0), the three others were further cultured in presence of actinomycin D (Act. D) at 10 µg/ml for the indicated times. CD40L mRNA was measured by RT-PCR and normalized using the corresponding CD4 mRNA levels, which were not affected by actinomycin D treatment (average of 98 ± 2%, 100 ± 2%, and 99 ± 2% of the levels measured in untreated cultures, after 15, 30, and 60 min of treatment for HIV+ and HIV- donors combined). The fraction of remaining CD40L after treatment is calculated considering the time 0 value as 1. A, Representative HIV- donor. The dotted line represents the fit curve for this particular donor (y = -0.731 logx + 1.473, r2 = 0.99). Fit curve was used to calculate the mRNA half-life by replacing y by 0.5. One representative example of four donors is shown. B, Representative HIV+ donor. Because of the obvious lack of linearity, no fit curve was calculated. One representative example of three donors is shown. C, Representative anti-CD4 and isotype-treated CD4+ T cells. Using the formulas of the fit curves, the mRNA half-life was calculated to be 28.3 and 28.7 min for anti-CD4- and isotype-treated cells, respectively. One representative example of three donors is shown.

 
CD40L expression is intact after PMA and ionomycin stimulation

The cooperative activity of several transcription factors is needed for optimal CD40L transcription. In particular, several transcription factor binding sites have been identified in the CD40L promoter, i.e., a CD28 responsive element (which binds elements of the NF-{kappa}B/Rel family and AP-1 complex (41)); a NF-{kappa}B binding site (42); and several NF-AT binding sites (43). In addition, a NF-{kappa}B binding site located in the 3' untranslated region regulates the promoter activity (44). Therefore, to begin to analyze the signaling steps potentially involved in CD40L dysregulation, we determined CD40L mRNA induction after stimulation with PMA or ionomycin, used separately. Those compounds were used as a first step of analysis because they both bypass the proximal steps of TCR-CD28 signaling and directly activate downstream steps involved in CD40L induction, i.e., both the Ras/AP-1 and the NF-{kappa}B pathway for PMA and the calcineurin/NF-AT pathway for ionomycin (45, 46, 47).

As shown in Fig. 6A, induction of CD40L mRNA by either PMA or ionomycin was not affected by pre-engagement of CD4 (mean inhibition of ~10% compared with isotype-treated T cells, p > 0.2, paired t test), whereas anti-CD3/CD28-induced CD40L was strongly affected, as expected (p < 0.005). Similarly, CD40L mRNA induced by PMA or ionomycin was not decreased in T cells from HIV+ donors compared with those of HIV- donors (Fig. 6B).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. PMA and ionomycin-induced CD40L expression is not altered by CD4 engagement (A) or in HIV+ (B) donors. A, CD4 engagement. CD4+ T cells from six HIV- donors were preincubated with anti-CD4 (anti-domain 1) or isotype control Ab, before stimulation for 2 h with PMA (100 ng/ml), ionomycin (10 µg/ml), or anti-CD3/CD28 beads. CD40L mRNA expression was determined as previously described. Results are expressed as the mean percentage of inhibition ± SE due to the anti-CD4 treatment. Asterisks indicate a significant difference between anti-CD4 and isotype-treated (p < 0.005, paired t test). B, T cells from HIV+ and HIV- donors. T cells from 10 HIV+ and eight HIV- donors were stimulated for 2 h with PMA (100 ng/ml), ionomycin (10 µg/ml), or anti-CD3/CD28 beads. Results are expressed as the mean fold increase ± SE in CD40L mRNA in stimulated vs unstimulated cells, calculated for each donor (after normalization with the corresponding CD4 mRNA level). Asterisks indicate a significant difference between HIV+ and HIV- donors (p < 0.005, unpaired t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Impaired IL-12 production in HIV infection has been demonstrated by studies performed in many laboratories, including ours. The mechanisms underlying this deficiency have not been thoroughly characterized however. A primary defect due to HIV infection has been described in macrophages infected in vitro with monocytotropic strains (1, 2, 48), with productive infection being necessary for such an impairment (1, 48). However, due to the low percentage of circulating monocytes/macrophages that are infected in HIV+ patients, such a mechanism could not explain the full extent of the deficiency seen in the PBMC of HIV+ patients. In the broader cellular context of PBMC, deficient CD4+ T cell help, and impaired CD40L-mediated signaling in particular, represents a potential underlying mechanism. Consistent with this hypothesis, we have previously shown that IL-12 production by PBMC from HIV+ donors was restored to normal values by the combination of IFN-{gamma} and recombinant CD40L (12). This previous study also showed that neutralization of CD40L signaling significantly decreased SAC-induced IL-12 production by PBMC from HIV- donors. Results from the present study tend to confirm this hypothesis, as a tight correlation was found between anti-CD3/CD28 induced CD40L expression and IL-12 production (Fig. 1). These data are in agreement with the concept that signaling through pattern-recognition receptors, such as Toll-like receptors, results in limited cytokine production unless it is followed by signals provided by activated T cells, which amplify APC activation (49, 50). Therefore, impaired CD40L may represent a key mechanism for impaired cytokine production by APC, together with an independent impairment in Toll-like receptor signaling. Of note, SAC also induces CD40L mRNA expression, albeit less efficiently than anti-CD3/CD28 stimulation and with a different kinetics (~60% of the levels induced by anti-CD3/CD28, maximum levels achieved at 6 h; data not shown).

A blunted capacity to up-regulate CD40L on CD4+ T cells has been described in chronically infected HIV+ patients (9, 18). The underlying mechanisms, and in particular, the level of dysregulation have not been defined however. Our data, showing that CD40L mRNA and protein levels are tightly correlated, suggest that such dysregulation occurs at the level of transcription, or upstream in the signaling cascades leading to CD40L mRNA induction. The expression of other activation markers, CD69 and OX40, was also decreased on T cells from HIV+ patients, but not as markedly as CD40L, suggesting that CD40L dysregulation could not be solely explained by a generalized lack of T cell response to stimuli. In contrast, basal expression of CD40L and OX40 were increased on unstimulated T cells. Such increases are consistent with a previous study (51) and with the widely reported immune activation occurring in individuals with ongoing HIV replication.

As for the mechanism(s) underlying CD40L dysregulation in HIV, Chirmule et al. (19) have suggested that interactions between HIV gp120 and the CD4 receptor may play a role. Several in vitro studies have indeed demonstrated that HIV gp120 can profoundly alter T cell function (19, 31, 32, 33, 52), reproducing defects seen in CD4+ T cells from HIV+ donors (53, 54, 55). Supporting a role for CD4 engagement in CD40L dysregulation, in vivo administration of a humanized anti-CD4 Ab to rheumatoid arthritis patients induces blunted CD40L expression (56). To further analyze the role of gp120, two in vitro models (anti-CD4 Ab and AT-2-inactivated virions) were used. Of note, only a very limited fraction (<0.1%) of all observable virions are demonstrably infectious (57, 58), therefore interactions with AT-2-inactivated virus may mimic the most frequent type of CD4 virus interaction that occur in vivo. Notably, a marked decrease in the ability to up-regulate CD40L (protein and mRNA) by stimulated CD4+ T cells was observed in those models. Three experiments strongly support a principal role for gp120 in this defect: the inhibitory effect of AT-2-inactivated virus was 1) blocked by soluble CD4; 2) abolished by heat treatment, which promotes dissociation of gp120 from virions; and 3) similar between CCR5-using and CXCR4-using strains. Furthermore, the intact conformation of gp120 appears crucial for providing inhibitory signals as no inhibition of CD40L up-regulation was observed using recombinant gp120 (data not shown), something that is consistent with previous data on the induction of apoptosis in CD4+ T cells (59). Interestingly, CD40L expression was more affected than CD69 expression in response to both anti-CD4 treatment and inactivated HIV, similar to what is observed with stimulated cells from HIV+ patients.

Two principal mechanisms may be involved in decreased levels of steady-state CD40L mRNA, i.e., increased instability of the mRNA transcripts or decreased mRNA transcription due to altered upstream signaling. The half-life of CD40L mRNA was not decreased in cells from HIV+ patients nor was it affected by anti-CD4 treatment, ruling out increased mRNA instability as a major mechanism underlying blunted CD40L expression. In contrast, the stability of CD40L mRNA appeared to be increased in activated T cells from HIV+ donors, something that was not reproduced in anti-CD4-treated T cells. This discrepancy between ex vivo results and in vitro model may reflect the differences occurring between a sustained chronic exposure to HIV particles (cells taken ex vivo from HIV+ donors) and an acute exposure (in vitro CD4 engagement).

An alternative mechanism underlying CD40L dysregulation could be the existence of defects in the signaling cascades upstream of CD40L promoter activation. The cooperative activity of several transcription factors (41, 42, 43, 44) is needed for optimal CD40L transcription. CD40L mRNA induction after stimulation with ionomycin or PMA was intact, strongly suggesting a major defect in the early events following TCR engagement. Such a hypothesis is in agreement with studies demonstrating defective p56lck–mediated signaling and inhibition of CD4 dimerization in T cells in which CD4 had been pre-engaged (60, 61, 62). Alternatively, the strength of the signals provided by these compounds may have overcome the signaling defects. Our data do not support the latter hypothesis, as maximum induction of CD40L mRNA followed anti-CD3/CD28, but not PMA or ionomycin stimulation (Fig. 6B).

CD40L expression was more affected than CD69 or OX40 expression, either following CD4 pre-engagement or in T cells from HIV+ patients. One potential mechanism is that both CD69 and OX40 are dependent on one principal signaling pathway in contrast to CD40L, which requires the optimal and coordinated activation of several signaling pathways. Indeed, CD69 expression mainly depends on activation of the Ras/mitogen-activated protein kinase pathway (63, 64, 65); OX40 induction largely follows c-fos and c-jun translocation (66). Interestingly, a similar selective defect is observed with partial agonists (67). Such agonists induce CD69 expression, albeit more transiently than full agonists, but do not induce proliferation or cytokine production by T cells, something that require coordinated activation of several signaling cascades.

In the present study, we demonstrate that CD40L dysregulation is a key mechanism in APC dysregulation in HIV infection. Defects in up-regulation of CD40L expression are expected to have disproportionate consequences, starting a vicious cycle, whereby defective APC fail to give optimal feedback signal to T cells, which in turn, fail to provide signals critical for APC survival. An acquired deficiency in CD40L would be predicted to impair control, not only of HIV, but also of the many pathogens controlled by cellular immunity. The mechanisms by which HIV infection affects CD40L expression appear to involve HIV gp120-mediated engagement of CD4. Clear elucidation of mechanism(s) may well lead to the development of novel immunotherapeutic approaches to HIV infection.


    Acknowledgments
 
We thank all the volunteers who gave generously of their time and blood samples. We thank the staff of the Infectious Diseases Center at the University of Cincinnati, in particular Linda Hinds for her instrumental role in the recruitment of HIV+ donors and Dr. Judith Feinberg for her expert help in the set up of the study. We also thank Julian Bess, Jr., for the production of the AT-2-inactivated virus preparations used in these studies and Drs. Christopher Karp and Gene M. Shearer for their critical reading of this manuscript.


    Footnotes
 
1 This work was partially supported by grants from the Trustee Board of the Cincinnati Children’s Hospital Medical Center (to C.C.) and the University of Cincinnati AIDS Clinical Trials Unit, National Institute of Allergy and Infectious Diseases, National Institutes of Health Grant AI-25897 (to C.F.). This work was also supported in part with Federal funds from the National Cancer Institute, National Institutes of Health, under contract NO1-CO-124000 (to J.L.). The flow cytometry core at Cincinnati Children’s Research Foundation is supported by the National Institutes of Health Grant 1 P30 AR47363. Back

2 Address correspondence and reprint requests to Dr. Claire Chougnet, Division of Molecular Immunology, Cincinnati Children’s Hospital Medical Center, 3333 Burnet Avenue, Mail Location Code 7021, Cincinnati, OH 45229-3039. E-mail address: Claire.Chougnet{at}cchmc.org Back

3 Abbreviations used in this paper: CD40L, CD40 ligand; AT-2, aldrithiol-2; MFI, mean fluorescence intensity; SAC, Staphylococcus aureus Cowan. Back

Received for publication July 2, 2003. Accepted for publication November 26, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chehimi, J., S. E. Starr, I. Frank, A. D’Andrea, X. Ma, R. R. MacGregor, J. Sennelier, G. Trinchieri. 1994. Impaired interleukin 12 production in human immunodeficiency virus-infected patients. J. Exp. Med. 179:1361.[Abstract/Free Full Text]
  2. Chougnet, C., T. A. Wynn, M. Clerici, A. L. Landay, H. A. Kessler, J. Rusnak, G. P. Melcher, A. Sher, G. M. Shearer. 1996. Molecular analysis of decreased IL-12 production in individuals infected with the human immunodeficiency virus. J. Infect. Dis. 174:46.[Medline]
  3. Chougnet, C. A., D. Margolis, A. L. Landay, H. A. Kessler, G. M. Shearer. 1996. Contribution of prostaglandin E2 to the interleukin-12 defect in HIV-infected patients [Letter]. AIDS 10:1043.[Medline]
  4. Harrison, T. S., S. M. Levitz. 1997. Priming with IFN-{gamma} restores deficient IL-12 production by peripheral blood mononuclear cells from HIV-seropositive donors. J. Immunol. 158:459.[Abstract]
  5. Chougnet, C., K. R. Fowke, B. U. Mueller, S. Smith, J. Zuckerman, S. Jankelevitch, S. M. Steinberg, N. Luban, P. A. Pizzo, G. M. Shearer. 1998. Protease inhibitor and triple-drug therapy: cellular immune parameters are not restored in pediatric AIDS patients after 6 months of therapy. AIDS 12:2397.[Medline]
  6. Chougnet, C., S. S. Cohen, T. Kawamura, A. L. Landay, H. A. Kessler, E. Thomas, A. Blauvelt, G. M. Shearer. 1999. Normal immune function of monocyte-derived dendritic cells from HIV-infected individuals: implications for immunotherapy. J. Immunol. 163:1666.[Abstract/Free Full Text]
  7. Marshall, J., J. Chehimi, G. Gri, J. Kostman, L. Montaner, G. Trinchieri. 1999. The interleukin-12-mediated pathway of immune events is dysfunctional in human immunodeficiency virus-infected individuals. Blood 94:1003.[Abstract/Free Full Text]
  8. Chougnet, C., S. Jankelevich, K. Fowke, D. Liewehr, S. M. Steinberg, B. U. Mueller, P. A. Pizzo, R. Yarchoan, G. Shearer. 2001. Long-term protease inhibitor-containing therapy results in limited improvement in T cell function but not restoration of interleukin-12 production in pediatric patients with AIDS. J. Infect. Dis. 184:201.[Medline]
  9. Subauste, C., M. Wessendarp, A. Smulian, P. Frame. 2001. Role of CD40 ligand signaling in defective type 1 cytokine response in human immunodeficiency virus infection. J. Infect. Dis. 183:1722.[Medline]
  10. Trinchieri, G.. 1994. Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84:4008.[Free Full Text]
  11. Zou, J., L. Morford, C. Chougnet, A. Dix, A. Brooks, N. Torres, J. Shuman, J. Coligan, W. Brooks, T. Roszman, G. Shearer. 1999. Human glioma-induced immunosuppression involves soluble factor(s) that alters monocyte cytokine profile and surface markers. J. Immunol. 162:4882.[Abstract/Free Full Text]
  12. Chougnet, C., E. Thomas, A. L. Landay, H. A. Kessler, S. Buchbinder, S. Scheer, G. M. Shearer. 1998. CD40 ligand and IFN-{gamma} synergistically restore IL-12 production in HIV-infected patients. Eur. J. Immunol. 28:646.[Medline]
  13. van Kooten, C., J. Banchereau. 2000. CD40-CD40 ligand. J. Leukocyte Biol. 67:2.[Abstract]
  14. Ostrowski, M. A., S. J. Justement, L. Ehler, S. B. Mizell, S. Lui, J. Mican, B. D. Walker, E. K. Thomas, R. Seder, A. S. Fauci. 2000. The role of CD4+ T cell help and CD40 ligand in the in vitro expansion of HIV-1-specific memory cytotoxic CD8+ T cell responses. J. Immunol. 165:6133.[Abstract/Free Full Text]
  15. Chougnet, C., A. Kovacs, R. Baker, B. U. Mueller, N. L. C. Luban, D. J. Liewehr, S. M. Steinberg, E. K. Thomas, G. M. Shearer. 2000. Influence of human immunodeficiency virus-infected maternal environment on development of infant interleukin-12 production. J. Infect. Dis. 181:1590.[Medline]
  16. Yu, Q., J. Gu, C. Kovacs, J. Freedman, E. Thomas, M. Ostrowski. 2003. Cooperation of TNF family members CD40 ligand, receptor activator of NF-{kappa}B ligand, and TNF-{alpha} in the activation of dendritic cells and the expansion of viral specific CD8+ T cell memory responses in HIV-1-infected and HIV-1-uninfected individuals. J. Immunol. 170:1797.[Abstract/Free Full Text]
  17. Levy, J., T. Espanol-Boren, C. Thomas, A. Fischer, P. Tovo, P. Bordigoni, I. Resnick, A. Fasth, M. Baer, L. Gomez, et al 1997. Clinical spectrum of X-linked hyper-IgM syndrome. J. Pediatr. 131:47.[Medline]
  18. Vanham, G., L. Penne, J. Devalck, L. Kestens, R. Colebunders, E. Bosmans, K. Thielemans, J. Ceuppens. 1999. Decreased CD40 ligand induction in CD4 T cells and dysregulated IL-12 production during HIV infection. Clin. Exp. Immunol. 117:335.[Medline]
  19. Chirmule, N., T. McCloskey, R. Hu, V. Kalyanaraman, S. Pahwa. 1995. HIV gp120 inhibits T cell activation by interfering with expression of costimulatory molecules CD40 ligand and CD80 (B7–1). J. Immunol. 155:917.[Abstract]
  20. Pantaleo, G., C. Graziosi, J. Demarest, L. Butini, M. Montroni, C. Fox, J. Orenstein, D. Kotler, A. Fauci. 1993. HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature 362:355.[Medline]
  21. Jones, M., J. Bell, A. Nath. 2000. Immunolocalization of HIV envelope gp120 in HIV encephalitis with dementia. AIDS 14:2709.[Medline]
  22. Oh, S.-K., W. W. Cruikshank, J. Raina, G. C. Blanchard, W. H. Adler, J. Walker, H. Kornfeld. 1992. Identification of HIV-1 envelope glycoprotein in the serum of AIDS and ARC patients. J. Acquired Immune Defic. Syndr. 5:251.
  23. Marshall, J., K. Fearon, C. Abbate, S. Subramanian, P. Yee, J. Gregorio, R. Coffman, G. Van Nest. 2003. Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions. J. Leukocyte Biol. 73:781.[Abstract/Free Full Text]
  24. Bess, J. J., R. Gorelick, W. Bosche, L. Henderson, L. Arthur. 1997. Microvesicles are a source of contaminating cellular proteins found in purified HIV-1 preparations. Virology 230:134.[Medline]
  25. Rossio, J., M. Esser, K. Suryanarayana, D. Schneider, J. J. Bess, G. Vasquez, T. Wiltrout, E. Chertova, M. Grimes, Q. Sattentau, et al 1998. Inactivation of human immunodeficiency virus type 1 infectivity with preservation of conformational and functional integrity of virion surface proteins. J. Virol. 72:7992.[Abstract/Free Full Text]
  26. Chertova, E., J. J. Bess, B. Crise, I. R. Sowder, T. Schaden, J. Hilburn, J. Hoxie, R. Benveniste, J. Lifson, L. Henderson, L. Arthur. 2002. Envelope glycoprotein incorporation, not shedding of surface envelope glycoprotein (gp120/SU), is the primary determinant of SU content of purified human immunodeficiency virus type 1 and simian immunodeficiency virus. J. Virol. 76:5315.[Abstract/Free Full Text]
  27. Garlick, R., R. Kirschner, F. Eckenrode, W. Tarpley, C. Tomich. 1990. Escherischia coli expression, purification, and biological activity of a truncated soluble CD4. AIDS Res. Hum. Retroviruses 6:465.[Medline]
  28. Lane, P.. 2000. Role of OX40 signals in coordinating CD4 T cell selection, migration and cytokine differentiation in T helper (Th)1 and Th2 cells. J. Exp. Med. 191:201.[Free Full Text]
  29. Arthos, J., K. Deen, M. Chaikin, J. Fornwald, G. Sathe, Q. Sattentau, P. Clapham, R. Weiss, J. McDougal, C. Pietropaolo, et al 1989. Identification of the residues in human CD4 critical for the binding of HIV. Cell 57:469.[Medline]
  30. Chertova, E., B. Crise, D. Morcock, J. J. Bess, L. Henderson, J. Lifson. 2003. Sites, mechanism of action and lack of reversibility of primate lentivirus inactivation by preferential covalent modification of virion internal proteins. Curr. Mol. Med. 3:265.[Medline]
  31. Banda, N. K., J. Bernier, D. K. Kurahara, R. Kurrle, N. Haigwood, R. P. Sekaly, T. H. Finkel. 1992. Crosslinking CD4 by human immunodeficiency virus gp120 primes T cells for activation-induced apoptosis. J. Exp. Med. 176:1099.[Abstract/Free Full Text]
  32. Hashimoto, F., N. Oyaizu, V. Kalyanaraman, S. Pahwa. 1997. Modulation of Bcl-2 protein by CD4 cross-linking: a possible mechanism for lymphocyte apoptosis in human immunodeficiency virus infection and for rescue of apoptosis by interleukin-2. Blood 90:745.[Abstract/Free Full Text]
  33. Algeciras, A., D. H. Dockrell, D. Lynch, C. V. Paya. 1998. CD4 regulates susceptibility to Fas ligand and tumor necrosis factor-mediated apoptosis. J. Exp. Med. 187:711.[Abstract/Free Full Text]
  34. Vlahakis, S., A. Algeciras-Schimnich, G. Bou, C. Heppelmann, A. Villasis-Keever, R. Collman, C. Paya. 2001. Chemokine-receptor activation by env determines the mechanism of death in HIV-infected and uninfected T lymphocytes. J. Clin. Invest. 107:207.[Medline]
  35. Tateyama, M., N. Oyaizu, T. McKloskey, S. Than, S. Pahwa. 2000. CD4 T lymphocytes are primed to express Fas ligand by CD4 cross-linking and to contribute to CD8 T-cell apoptosis via Fas/FasL death signaling pathway. Blood 96:195.[Abstract/Free Full Text]
  36. Hildeman, D., T. Mitchell, T. Teague, P. Henson, B. Day, J. Kappler, P. Marrack. 1999. Reactive oxygen species regulate activation-induced T cell apoptosis. Immunity 10:735.[Medline]
  37. Ford, G., B. Barnhart, S. Shone, L. Covey. 1999. regulation of CD154 (CD40 ligand) mRNA stability during T cell activation. J. Immunol. 162:4037.[Abstract/Free Full Text]
  38. Murakami, K., W. Ma, R. Fuleihan, J. S. Pober. 1999. Human endothelial cells augment early CD40 ligand expression in Activated CD4+ T cells through LFA-3-mediated stabilization of mRNA. J. Immunol. 163:2667.[Abstract/Free Full Text]
  39. Barnhart, B., P. Kosinski, Z. Wang, G. Ford, M. Kiledjian, L. Covey. 2000. Identification of a complex that binds to the CD154 3' untranslated region: implications for a role in message stability during T cell activation. J. Immunol. 165:4478.[Abstract/Free Full Text]
  40. Kosinski, P., J. Laughlin, K. Singh, L. Covey. 2003. A complex containing polypyrimidine tract-binding protein is involved in regulating the stability of CD40 ligand (CD154) mRNA. J. Immunol. 170:979.[Abstract/Free Full Text]
  41. Parra, E., T. Mustelin, M. Dohlsten, D. Mercola. 2001. Identification of a CD28 response element in the CD40 ligand promoter. J. Immunol. 166:2437.[Abstract/Free Full Text]
  42. Srahna, M., J. Remacle, K. Annamalai, S. Pype, D. Huylebroeck, M. Boogaerts, P. Vandenberghe. 2001. NF-{kappa}B is involved in the regulation of CD154 (CD40 ligand) expression in primary human T cells. Clin. Exp. Immunol. 125:229.[Medline]
  43. Schubert, L., G. King, R. Cron, D. Lewis, A. Aruffo, D. Hollenbaugh. 1995. The human gp39 promoter. J. Biol. Chem. 270:29624.[Abstract/Free Full Text]
  44. Schubert, L., R. Cron, A. Cleary, M. Brunner, A. Song, L. Lu, P. Jullien, A. Krensky, D. Lewis. 2002. A T cell-specific enhancer of the human CD40 ligand gene. J. Biol. Chem. 277:7386.[Abstract/Free Full Text]
  45. Macian, F., F. Garcia-Cozar, S.-H. Im, H. Horton, M. Byrne, A. Rao. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109:719.[Medline]
  46. Cho, W.. 2001. Membrane targeting by C1 and C2 domains. J. Biol. Chem. 276:32407.[Free Full Text]
  47. Kazanietz, M.. 2002. Novel "nonkinase" phorbol ester receptors: the C1 domain connection. Mol. Pharmacol. 61:759.[Abstract/Free Full Text]
  48. Chambers, K., K. Parato, J. Angel. 2002. Active cellular infection of myeloid cells is required for HIV-1-mediated suppression of interleukin-12 p40 expression. Cell. Immunol. 215:120.[Medline]
  49. Schulz, O., A. D. Edwards, M. Schito, J. Aliberti, S. Manickasingham, A. Sher, C. Reis e Sousa. 2000. CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal. Immunity 13:453.[Medline]
  50. Edwards, A., S. Manickasingham, R. Sporri, S. Diebold, O. Schulz, A. Sher, T. Kaisho, S. Akira, C. Reis E Sousa. 2002. Microbial recognition via Toll-like receptor-dependent and -independent pathways determines the cytokine response of murine dendritic cell subsets to CD40 triggering. J. Immunol. 169:3652.[Abstract/Free Full Text]
  51. Sousa, A., A. Chaves, M. Doroana, F. Antunes, R. Victorino. 1999. Early reduction of the over-expression of CD40L, OX40 and Fas on T cells in HIV-1 infection during triple anti-retroviral therapy: possible implications for lymphocyte traffic and functional recovery. Clin. Exp. Immunol. 116:307.[Medline]
  52. Oyaizu, N., N. Chirmule, V. Kalyanaraman, S. Pahwa. 1990. Human immunodeficiency virus type 1 envelope glycoprotein gp120 provides immune defects in CD4+ T lymphocytes by inhibiting interleukin 2 mRNA. Proc. Natl. Acad. Sci. USA 87:2379.[Abstract/Free Full Text]
  53. Clerici, M., N. I. Stocks, R. A. Zajac, R. N. Boswell, D. R. Lucey, C. S. Via, G. M. Shearer. 1989. Detection of three distinct patterns of T helper cell dysfunction in asymptomatic, human immunodeficiency virus-seropositive patients: independence of CD4+ cell numbers and clinical staging. J. Clin. Invest. 84:1892.
  54. Sarin, A., M. Clerici, S. P. Blatt, C. W. Hendrix, G. M. Shearer, P. A. Henkart. 1994. Inhibition of activation-induced programmed cell death and restoration of defective immune responses of HIV+ donors by cysteine protease inhibitors. J. Immunol. 153:862.[Abstract]
  55. Badley, A. D., D. H. Dockrell, A. Algeciras, S. Ziesmer, A. Landay, M. M. Lederman, E. Connick, H. Kessler, D. Kuritzkes, D. H. Lynch, et al 1998. In vivo analysis of Fas/FasL interactions in HIV-infected patients. J. Clin. Invest. 102:79.[Medline]
  56. Woods, M., R. Guy, H. Waldmann, M. Glennie, D. Alexander. 1998. A humanized therapeutic CD4 mAb inhibits TcR-induced IL-2, IL-4, and IL-10 secretion and expression of CD25, CD40L and CD69. Cell. Immunol. 185:101.[Medline]
  57. Piatak, M. J., M. Saag, L. Yang, S. Clark, J. Kappes, K. Luk, B. Hahn, G. Shaw, J. Lifson. 1993. High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR. Science 259:1749.
  58. Dimitrov, D., R. Willey, H. Sato, L. Chang, R. Blumenthal, M. Martin. 1993. Quantitation of human immunodeficiency virus type 1 infection kinetics. J. Virol. 67:2182.[Abstract/Free Full Text]
  59. Esser, M., J. J. Bess, K. Suryanarayana, E. Chertova, D. Marti, M. Carrington, L. Arthur, J. Lifson. 2001. Partial activation and induction of apoptosis in CD4+ and CD8+ T lymphocytes by conformationally authentic noninfectious human immunodeficiency virus type 1. J. Virol. 75:1152.[Abstract/Free Full Text]
  60. Goldman, F., J. Crabtree, C. Hollenback, G. Koretzky. 1997. Sequestration of p56lck by gp120, a model for TCR desensitization. J. Immunol. 158:2017.[Abstract]
  61. Marschner, S., T. Hunig, J. Cambier, T. Finkel. 2002. Ligation of human CD4 interferes with antigen-induced activation of primary T cells. Immunol. Lett. 82:131.[Medline]
  62. Gratton, S., M. Julius, R. Sekaly. 1998. lck-Independent inhibition of T cell antigen response by the HIV gp120. J. Immunol. 161:3551.[Abstract/Free Full Text]
  63. D’Ambrosio, D., D. Cantrell, L. Frati, A. Santoni, R. Testi. 1994. Involvement of p21ras activation in T cell CD69 expression. Eur. J. Immunol. 24:616.[Medline]
  64. Finco, T., T. Kadlecek, W. Zhang, L. Samelson, A. Weiss. 1998. LAT is required for TCR-mediated activation of PLC{gamma}1 and the Ras pathway. Immunity 9:617.[Medline]
  65. Yablonski, D., M. Kuhne, T. Kadlecek, A. Weiss. 1998. Uncoupling of nonreceptor tyrosine kinases from the PLC-1 in an SLP-76-deficient T cell. Science 281:413.[Abstract/Free Full Text]
  66. Matsumura, Y., T. Hori, S. Kawamata, A. Imura, T. Uchiyama. 1999. Intracellular signaling of gp34, the OX40 ligand: induction of c-jun and c-fos mRNA expression through gp34 upon binding of its receptor, OX40. J. Immunol. 163:3007.[Abstract/Free Full Text]
  67. Chau, L., J. Madrenas. 1999. Phospho-LAT-independent activation of the Ras-mitogen-activated protein kinase pathway: a differential recruitment model of TCR partial agonist signaling. J. Immunol. 163:1853.[Abstract/Free Full Text]



This article has been cited by other articles: