|
|
||||||||



Divisions of
*
Molecular Immunology and
Immunobiology, Cincinnati Childrens Hospital Research Foundation, Cincinnati, OH 45229,
Infectious Disease Center, University of Cincinnati Medical Center, Cincinnati, OH 45267; and
AIDS Vaccine Program, Science Applications International Corporation-Frederick, National Cancer Institute, Frederick, MD 21702
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Among the APC functions that have been reported defective in HIV infection is a marked impairment of production of IL-12 by PBMC and macrophages from HIV-infected (HIV+) patients (1, 2, 3, 4, 5, 6, 7, 8, 9). This defect in IL-12 production does not reflect a global deficiency in secretion of proinflammatory cytokines by APC, as production of TNF-
and IL-1
are not reduced (1, 2). IL-12 is a key link between innate and adaptive immunity (reviewed in Ref. 10). It is a potent inducer of IFN-
from T cells and NK cells, enhances NK cytotoxicity, as well as the generation of cytolytic CD8+ T lymphocytes. IL-12 is also comitogenic for T and NK cells and is necessary for in vivo delayed-type hypersensitivity reactions. Interestingly, all these functions are known to be dysfunctional in HIV+ patients. IL-12 has been shown to play a critical role in resistance in murine models of infection with a variety of intracellular microbes (including Mycobacteria, Cryptosporidia, Toxoplasma, and Histoplasma), which are all pathogens that cause disease of greater frequency and/or severity in HIV+ subjects than in HIV-uninfected (HIV-) individuals.
IL-12, which consists of two disulfide-linked subunits (p40 and p35) that form bioactive p70 heterodimers, is produced mainly by APC (monocytes/macrophages and dendritic cells). Production of IL-12 is induced by a variety of bacterial stimuli (signaling through Toll-like receptors) as well as by T cell-derived stimuli, especially CD40 ligand (CD40L)3 (10). One of the most potent inducers of IL-12 by human APC is Staphylococcus aureus Cowan (SAC). Although SAC can induce IL-12 production by purified APC, its IL-12-inducing activity is strongly enhanced by interactions with activated CD4+ T cells (11), and with CD40L in particular (12).
CD40L, a member of the TNF superfamily, undergoes tightly regulated, inducible expression on the surface of CD4+ T cells as a result of signals derived from TCR stimulation (13). CD40L expression appears to be largely controlled at the mRNA level (both transcriptionally and posttranscriptionally), although posttranslational regulation (by endocytosis or proteolytic cleavage) occurs as well (reviewed in Ref. 13). We and others have shown that the defective IL-12 production (and CD8+ T cell function) in HIV infection can be ameliorated in vitro by the addition of exogenous CD40L (9, 12, 14, 15, 16). Further, patients who have AIDS and patients who have the X-linked hyperIgM syndrome (due to a CD40L genetic mutation) suffer from a similar spectrum of opportunistic infections (17). Taken together, these data strongly suggest that defective CD40/CD40L interactions are mechanistically important to HIV-related abnormalities in cell-mediated immunity and to the IL-12 deficit in particular.
The capacity to up-regulate CD40L on purified CD4+ T cells becomes progressively impaired in HIV infection, in parallel with overall immunosuppression (9, 18). Underlying mechanisms of CD40L impairment likely involve interactions between the major HIV-1 surface glycoprotein, gp120, and the CD4 receptor on the surface of CD4+ T cells (in our study and in Ref. (19). HIV gp120 is present at high concentrations in tissues (20, 21), and circulates in the blood of HIV+ donors on the surface of virions (both infectious and noninfectious) and as a free protein (22). Thus, gp120-mediated alterations in CD40L expression provide a potential mechanism for defective T cell (and APC) HIV-infected and uninfected CD4+ T cells alike.
In the present study, we have further investigated molecular mechanisms underlying IL-12 impairment during HIV infection. First, we report for the first time the existence of a correlation between anti-CD3/CD28-induced CD40L expression and the production of IL-12 after SAC stimulation. Second, we show that pre-engagement of CD4, via anti-CD4 mAb or inactivated virions, is sufficient to inhibit CD40L up-regulation after TCR stimulation. Induction of CD40L is regulated at many levels (transcriptional, posttranscriptional, and posttranslational) (13). Importantly, the present study demonstrates that dysregulation of CD40L induction in HIV infection likely occurs at the level of transcription, possibly in the upstream signaling cascades leading to CD40L mRNA induction. Furthermore, our data clearly implicate major defect(s) in the early events following TCR engagement, following pre-engagement of CD4 as well as in activated T cells from HIV+ donors. Importantly, increased apoptosis does not appear to represent a major underlying mechanism of CD40L dysregulation in our experimental system. Taken together, our results suggest a causal relationship between exposure to native, virion-associated gp120 and impaired IL-12 production, which is consequent to the defective up-regulation of CD40L expression. This defect may be an important factor contributing to the cellular immune deficits observed in HIV infection.
| Materials and Methods |
|---|
|
|
|---|
Heparinized blood samples were obtained from 26 HIV+ adult patients from the University of Cincinnati Infectious Diseases Center (Cincinnati, OH) and were processed within 4 h of collection. Patients had CD4 counts lower than 500 CD4/mm3 with detectable viral loads (>50 copies/ml, Ultrasensitive HIV RT-PCR 1.0; Roche Diagnostic Systems, Indianapolis, IN). They had no active opportunistic infections or cancer. Blood samples from 26 healthy adult HIV- donors were obtained by recruitment of healthy volunteers at the Cincinnati Childrens Research Foundation (Cincinnati, OH). In addition, buffy coats from healthy adult donors were obtained from the Hoxworth Blood Bank Center, Cincinnati, OH. All protocols were approved by the corresponding Institutional Review Boards.
Cell preparation
PBMC. PBMC were separated on lymphocyte separation medium (Ficoll-Hypaque; Amersham Biosciences, Piscataway, NJ) and resuspended at 107/ml in complete medium (RPMI 1640 containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, and 5 mM HEPES; all from Life Technologies, Gaithersburg, MD).
T cells. T cells were purified from PBMC by negative selection. After a first step of plastic adherence (45 min at 37°C), nonadherent cells were treated by a mixture of lytic Ab and complement, according to the manufacturers instructions (T-Qwick; One-Lambda, Los Angeles, CA). Purified T cells were >90% pure, as assessed by FACS.
CD4+ T cells. CD4+ T cells were further purified from T cells by magnetic negative selection, according to the manufacturers instructions (CD4 Negative Selection kit; Dynal Biotech, Lake Success, NY). Purified CD4+ T cells were >95% pure, as assessed by FACS.
Cell stimulation
Cytokine production. PBMC were stimulated with SAC (pansorbine; Calbiochem, La Jolla, CA) at a 0.01% final concentration at 37°C at 1.5 x 106/ml in duplicate in 96-well plates, in complete medium supplemented with 5% heat-decomplemented human AB+ serum (Gemini Bio-Products, Calabasa, CA). As a control, cells were also cultured without stimulation. The 24-h supernatants were harvested and kept frozen at -80°C before cytokine analysis. IL-12 p70 production was measured by ELISA, using R&D Systems kits (Minneapolis, MN) at a detection limit of 4 pg/ml. For statistical purpose, all values below the detection limit were assigned an arbitrary value of one-half the detection limit.
Expression of activation markers on T cells. A total of 5 x 105 T cells (or purified CD4+ T cells) were stimulated (or not stimulated, as a control) for different times with magnetic beads coated with anti-CD3 and anti-CD28 Ab (T cell Expander; Dynal Biotech) in duplicate in 96-well plates in complete medium supplemented with 2% human AB+ serum. Preliminary experiments had determined the optimal concentration to be 2.5 µl beads/106 T cells; this concentration was therefore used throughout the study. After incubation, cells were washed with FACS buffer (PBS, 10% FCS, 0.01% sodium azide), and incubated with human IgG (20 µg/ml, Sigma-Aldrich, St. Louis, MO) for 10 min at +4°C, to block Fc receptor. They were then stained for 3- or 4-color FACS analysis with labeled Ab that recognize CD4, CD40L (CD154), CD69, or OX40 (CD134), or with isotype-matched control Ab (all Ab from BD PharMingen, Mountain View, CA), for 30 min at +4°C. The cells were then washed twice before being fixed in FACS buffer containing 4% paraformaldehyde (30 min minimum at +4°C). Surface expression was analyzed using a FACSCalibur and the CellQuest software (BD Biosciences, San Jose, CA). A minimum of 15,000 cells (debris and dead cells gated out using forward-scatter analysis) was analyzed. Results are expressed as the percentage of cells expressing a given marker compared with the isotype staining or as the mean fluorescence intensity (MFI) of such markers.
CD40L mRNA expression. A total of 2 x 106 T cells (or CD4+ T cells) were stimulated (or not, as a control) with anti-CD3/CD28 beads in 48-well plates in complete medium supplemented with 2% human AB+ serum. In some experiments, CD4+ T cells were stimulated with the phorbol ester PMA (100 ng/ml; Calbiochem) or the Ca2+ ionophore ionomycin (10 µg/ml; Calbiochem). In some experiments, PBMC (2 x 106/condition) were stimulated with SAC (0.01% final concentration) or anti-CD3/CD28 beads. After incubation, cells were washed twice with PBS, resuspended in RNAlater (Qiagen, Santa Clarita, CA) and kept at -20°C before RNA extraction. Total RNA was extracted using RNAeasy mini kits, following manufacturers instruction (Qiagen). RNA was quantified by spectrophotometer absorbance and 0.5 µg of RNA was reverse-transcribed using superscript reverse transcriptase (Life Technologies) and random primers (Roche Molecular Systems, Pleasanton, CA), as described earlier (2). A one-fourth dilution of the RT product was amplified using real-time PCR, performed in a Light-Cycler (Roche) using a SYBR green PCR kit (Roche) and specific primers to amplify 100200 bp fragments from the different genes analyzed. The sequences for synthesized primers are (listed 5' to 3'): CD40L (forward: CCACAGTTCCGCCAAACCT, reverse: GAAGACTCCCAGCGTCAGCT); CD4 (forward: AAGCATGGAGCATGGGACTG, reverse: TCCATCCTTGACTGGCTTGG). Melting curves and agarose gel electrophoresis established the purity of the amplified band. A threshold was set in the linear part of the amplification curve, and the number of cycles needed to reach it was calculated for each gene. Threshold cycle values for each gene were then normalized to CD4 using the equation 1.8(CD4-CD40L), where CD4 is the mean threshold cycle of duplicate CD4 runs and CD40L is the mean threshold cycle of duplicate runs of CD40L, as previously described (23). Fold increase of CD40L mRNA expression in stimulated vs unstimulated cultures was then calculated for each donor.
Pre-engagement of the CD4 receptor. CD4+ T cells from HIV- donors were incubated for 1 h at +4°C with Ab against the domain 1 of the CD4 molecule (clone QS4120), or against the domain 2 (clone M-T441), or with an isotype control Ab (mouse IgG1), with all Ab at 10 µg/ml (Ancell, Bayport, MN), or left untreated. After several washes, cells were stimulated with anti-CD3/CD28 beads for 24 or 48 h, for protein expression (measured by FACS), or for 2 h for mRNA expression (measured by quantitative RT-PCR), as previously described.
CD4+ T cells from HIV- donors were also stimulated with anti-CD3/CD28 beads in presence of either inactivated HIV-1MN or HIV-1ADA treated with aldrithiol-2 (AT-2) (24). As a control, cultures were treated with the corresponding microvesicles, prepared from uninfected cultures of the cell lines used to propagate the viruses, CEM x 174 and SEMT1, respectively. Graded concentrations of AT-2-treated HIV, expressed in quantity of HIV p24gag equivalent/106 cells (25), were added to the cultures. Microvesicles were added at a concentration that provides an equal amount of total protein as the equivalent AT-2-treated virus. In addition, a preparation of AT-2-inactivated HIVMN that was heat treated (60°C) to dissociate gp120 from the surface of the virus (26) was used to determine the involvement of gp120 in CD40L dysregulation. To further determine whether inactivated viruses act through gp120-mediated engagement of CD4, we analyzed whether soluble CD4, which encompasses the N-terminal 183 amino acid residues of CD4 (27), would block AT-2 activity. This reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health (soluble CD4-183 from Amersham Biosciences). Graded concentrations (0.1 to 10 µg/ml) of soluble CD4 were incubated with AT-2-treated viruses (or microvesicles or medium) for 30 min at +4°C, before adding the CD4+ T cells. Cells were then cultured as previously described. To determine the role of apoptosis in CD40L dysregulation, CD4+ T cells from HIV- donors were preincubated for 1 h at +37°C with the pan-caspase inhibitor BD-fmk (50 µM; Enzyme Systems Products, Livermore, CA) or with DMSO (1/500; Sigma-Aldrich), as a control, or left untreated. Cells were then stimulated with anti-CD3/CD28 beads for 48 h in presence (or absence) of AT-2-treated HIV-1MN. Induction of apoptosis was determined by costaining with propidium iodide and FACS analysis.
CD40L mRNA stability. T cells (or purified CD4+ T cells) from HIV- and HIV+ donors were cultured either with medium or anti-CD3/CD28 beads. In some experiments, CD4+ T cells from HIV- donors were first treated with the anti-domain 1 of CD4 or an isotype-matched control Ab (as previously mentioned) before being stimulated. After 2 h, mRNA was harvested from unstimulated cells. At the same time, anti-CD3/CD28 beads were removed by magnetic separation and the stimulated cells were divided in 4 aliquots. One was used to prepare mRNA (time 0); the three others were cultured in presence of actinomycin D (10 µg/ml; Sigma-Aldrich) for an additional 15, 30, or 60 min. CD40L mRNA was measured by RT-PCR in all samples and values normalized using the corresponding CD4 mRNA levels. The fraction of remaining CD40L after treatment was calculated considering the time 0 value as 1. Fit curves were used to estimate the mRNA half-life.
Statistical analysis
Expression of proteins or genes was compared between HIV+ and HIV- donors using the unpaired two-tail t test. Correlations were analyzed using ANOVA tests. The effect of treatment with anti-CD4 Ab or inactivated virus was analyzed using paired t test. Values of p < 0.05 were considered to be significant.
| Results |
|---|
|
|
|---|
The mechanisms underlying IL-12 impairment in HIV infection have not been completely elucidated. Due to the cellular context in which IL-12 impairment was described in HIV+ donors (whole PBMC, as opposed to isolated monocytes), deficient CD4+ T cell help, and deficient CD40-CD40L interactions in particular, represents a possible underlying mechanism (12). To address this question, we determined whether levels of IL-12 production and CD40L induction were correlated. Consistent with our previous results, a profound defect in the production of IL-12 p70 (Fig. 1A) was observed after stimulation with SAC (p < 0.005, unpaired t test, compared with HIV- donors). Importantly, SAC-induced IL-12 production was directly correlated with anti-CD3/CD28-induced CD40L expression (Fig. 1B). These results thus suggest blunted up-regulation of CD40L expression as a potential mechanism underlying IL-12 dysregulation in HIV infection.
|
Blunted up-regulation of surface expression of CD40L has been shown in HIV+ donors (9, 18). Because expression of this marker is tightly regulated, with different levels of regulation (transcription, posttranscription, posttranslation), the first focus of our studies was to determine the level of dysregulation in HIV+ donors. The kinetics of CD40L protein and mRNA expression was first analyzed in HIV- donors, as the published data (arising from varying experimental systems) have not reached a consensus. Using a polyclonal T cell activation system that mimics peptide-laden APC-mediated T cell activation (beads coupled to mAb to CD3 and CD28), up-regulation of CD40L protein expression occurred from 6 to 48 h, with rapid down-regulation thereafter. CD40L mRNA expression peaked 2 h after stimulation (data not shown).
Based on these data, the kinetic expression of CD40L (protein and mRNA) by T cells from HIV+ donors was compared with that of cells from HIV- donors. HIV+ donors who had already reached the chronic phase of infection were enrolled. This population was chosen as published data suggest that they are more likely to exhibit dysregulation of CD40L (9, 18). Data obtained from 13 HIV+ donors (compared with 15 HIV- individuals) confirmed that CD40L protein expression on activated CD4+ T cells was impaired in HIV+ donors at 24 and 48 h (Fig. 2, A and B). Up-regulation of CD40L expression occurs as a shift of the overall population, not as a marker expressed in a discrete subpopulation. In the case of HIV+ donors, this shift was dramatically reduced (Fig. 2A shows an example of CD40L expression in representative HIV+ and HIV- donors). Importantly, induction of CD40L mRNA expression was decreased at all time points (Fig. 2C), with a >3-fold decrease at 2 h, when expression peaks. Furthermore, protein expression at 24 h (Fig. 2D) and at 48 h (data not shown) was highly correlated with the magnitude of induction of mRNA expression, in both HIV+ and HIV- donors. Thus, the primary site of dysregulation of CD40L expression in HIV appears to be either at the mRNA level (transcription or posttranscription) or upstream, in the signaling cascades leading to CD40L mRNA induction.
|
Expression of other T cell activation markers, CD69, an early activation marker, and OX40 (CD134), another member of the TNF superfamily (28), was also analyzed. Up-regulation of these two markers on stimulated CD4+ cells from HIV+ donors was also decreased at 24 and 48 h (Table I). However, the reduction was less pronounced than what was observed for CD40L expression: both CD69 and OX40 expression was reduced by
25%, compared with >50% for CD40L expression (Fig. 2). Again, the deficit did not appear to be due to delayed kinetics, as percentages of expressing cells were decreased at both 24 and 48 h. To document the selectivity of CD40L impairment, coexpression of CD69 and CD40L was determined on stimulated CD4+ T cells from HIV+ and HIV- donors. Cells that coexpress CD69 and CD40L were significantly decreased in HIV+ donors compared with HIV- donors, at both 24 h (mean percentage of 9.8 ± 1.8% vs 22.3 ± 2.5% for HIV+ vs HIV- donors, respectively; p = 0.0008 by unpaired t test) and 48 h (15.0 ± 3.2% vs 34.1 ± 4.4%; p = 0.003).
|
To gain further insights into CD40L dysregulation in HIV, we modeled in vitro the engagement of CD4 with gp120, before activation. Two models were used (anti-CD4 Ab, inactivated HIV virions), followed by stimulation with anti-CD3/CD28 beads.
CD4+ T cells from HIV- donors were treated with an anti-CD4 Ab that binds to the same domain 1 of the CD4 molecule as gp120 (29). This Ab is also capable of blocking HIV infection. As controls, another anti-CD4 mAb, which binds elsewhere (domain 2) and fails to block HIV infection, and an unrelated Ab of the same isotype, were used. As shown in Fig. 3A, the domain 1 mAb uniquely inhibited the expression of CD40L. This inhibition was specific, as induction of CD69 was not altered. Furthermore, treatment with domain 1 Ab decreased activation-induced CD40L mRNA expression (Fig. 3B).
|
|
|
One potential confounding factor in the interpretation of these data may be increased apoptosis induced by CD4 pre-engagement, as previously shown by several laboratories (31, 32, 33, 34, 35), something that could nonspecifically interfere with the capacity to up-regulate CD40L. To address this issue, induction of apoptosis was determined in CD4+ T cells from five HIV- donors that were stimulated with anti-CD3/CD28, in presence (or absence) of AT-2-treated HIVMN. After 48 h, only a modest increase in apoptosis was observed in the T cells exposed to AT-2-treated HIV (18.4 ± 2.4% in AT-2-treated cultures vs 13.1 ± 0.9% in untreated cultures, p = 0.06, paired t test). Moreover, HIV-mediated inhibition of CD40L induction was not significantly decreased by culturing the CD4+ T cells in the presence of the pan-caspase inhibitor BD-fmk (36). Indeed, mean percentages of CD40L inhibition were 46.3 ± 4.4%, 42.7 ± 3.9%, and 47.8 ± 4.1% in untreated, BD-fmk-treated, and DMSO-treated T cells, respectively (all p > 0.2, paired t test). These results suggest that apoptosis does not represent a major underlying mechanism of CD40L dysregulation in our experimental system.
Decreased CD40L mRNA expression is not due to decreased mRNA half-life
Several studies have reported that mRNA stability plays an important role in CD40L expression (37, 38, 39, 40). We thus investigated whether increased mRNA instability could underlie blunted CD40L up-regulation. Stability of CD40L mRNA was analyzed by adding the RNA synthesis inhibitor actinomycin D to activated T cells at the peak of mRNA accumulation (2 h), and following the kinetics of subsequent mRNA decay by real-time RT-PCR. The half-life of CD40L mRNA in HIV- donors was determined to be 20.9 ± 4.9 min (Fig. 5A). Importantly, the half-life of CD40L mRNA appeared increased in the cells from HIV+ donors (with clinical characteristics similar to the donors described in Fig. 2) compared with those from HIV- donors, with >50% of CD40L mRNA remaining after 60 min of actinomycin D treatment (Fig. 5B). In all HIV+ donors, CD40L mRNA decay was not linear, with a first phase of stability, followed by decline. mRNA half-life was also determined in cells from HIV- donors pretreated with either the anti-CD4 Ab (against the domain 1, as previously described) or an isotype control. No clear difference in mRNA stability was observed between anti-CD4 and isotype-treated cells (Fig. 5C). Taken together, these data suggest that increased mRNA instability is not likely to be the main mechanism of blunted CD40L expression in HIV infection.
|
The cooperative activity of several transcription factors is needed for optimal CD40L transcription. In particular, several transcription factor binding sites have been identified in the CD40L promoter, i.e., a CD28 responsive element (which binds elements of the NF-
B/Rel family and AP-1 complex (41)); a NF-
B binding site (42); and several NF-AT binding sites (43). In addition, a NF-
B binding site located in the 3' untranslated region regulates the promoter activity (44). Therefore, to begin to analyze the signaling steps potentially involved in CD40L dysregulation, we determined CD40L mRNA induction after stimulation with PMA or ionomycin, used separately. Those compounds were used as a first step of analysis because they both bypass the proximal steps of TCR-CD28 signaling and directly activate downstream steps involved in CD40L induction, i.e., both the Ras/AP-1 and the NF-
B pathway for PMA and the calcineurin/NF-AT pathway for ionomycin (45, 46, 47).
As shown in Fig. 6A, induction of CD40L mRNA by either PMA or ionomycin was not affected by pre-engagement of CD4 (mean inhibition of
10% compared with isotype-treated T cells, p > 0.2, paired t test), whereas anti-CD3/CD28-induced CD40L was strongly affected, as expected (p < 0.005). Similarly, CD40L mRNA induced by PMA or ionomycin was not decreased in T cells from HIV+ donors compared with those of HIV- donors (Fig. 6B).
|
| Discussion |
|---|
|
|
|---|
and recombinant CD40L (12). This previous study also showed that neutralization of CD40L signaling significantly decreased SAC-induced IL-12 production by PBMC from HIV- donors. Results from the present study tend to confirm this hypothesis, as a tight correlation was found between anti-CD3/CD28 induced CD40L expression and IL-12 production (Fig. 1). These data are in agreement with the concept that signaling through pattern-recognition receptors, such as Toll-like receptors, results in limited cytokine production unless it is followed by signals provided by activated T cells, which amplify APC activation (49, 50). Therefore, impaired CD40L may represent a key mechanism for impaired cytokine production by APC, together with an independent impairment in Toll-like receptor signaling. Of note, SAC also induces CD40L mRNA expression, albeit less efficiently than anti-CD3/CD28 stimulation and with a different kinetics (
60% of the levels induced by anti-CD3/CD28, maximum levels achieved at 6 h; data not shown). A blunted capacity to up-regulate CD40L on CD4+ T cells has been described in chronically infected HIV+ patients (9, 18). The underlying mechanisms, and in particular, the level of dysregulation have not been defined however. Our data, showing that CD40L mRNA and protein levels are tightly correlated, suggest that such dysregulation occurs at the level of transcription, or upstream in the signaling cascades leading to CD40L mRNA induction. The expression of other activation markers, CD69 and OX40, was also decreased on T cells from HIV+ patients, but not as markedly as CD40L, suggesting that CD40L dysregulation could not be solely explained by a generalized lack of T cell response to stimuli. In contrast, basal expression of CD40L and OX40 were increased on unstimulated T cells. Such increases are consistent with a previous study (51) and with the widely reported immune activation occurring in individuals with ongoing HIV replication.
As for the mechanism(s) underlying CD40L dysregulation in HIV, Chirmule et al. (19) have suggested that interactions between HIV gp120 and the CD4 receptor may play a role. Several in vitro studies have indeed demonstrated that HIV gp120 can profoundly alter T cell function (19, 31, 32, 33, 52), reproducing defects seen in CD4+ T cells from HIV+ donors (53, 54, 55). Supporting a role for CD4 engagement in CD40L dysregulation, in vivo administration of a humanized anti-CD4 Ab to rheumatoid arthritis patients induces blunted CD40L expression (56). To further analyze the role of gp120, two in vitro models (anti-CD4 Ab and AT-2-inactivated virions) were used. Of note, only a very limited fraction (<0.1%) of all observable virions are demonstrably infectious (57, 58), therefore interactions with AT-2-inactivated virus may mimic the most frequent type of CD4 virus interaction that occur in vivo. Notably, a marked decrease in the ability to up-regulate CD40L (protein and mRNA) by stimulated CD4+ T cells was observed in those models. Three experiments strongly support a principal role for gp120 in this defect: the inhibitory effect of AT-2-inactivated virus was 1) blocked by soluble CD4; 2) abolished by heat treatment, which promotes dissociation of gp120 from virions; and 3) similar between CCR5-using and CXCR4-using strains. Furthermore, the intact conformation of gp120 appears crucial for providing inhibitory signals as no inhibition of CD40L up-regulation was observed using recombinant gp120 (data not shown), something that is consistent with previous data on the induction of apoptosis in CD4+ T cells (59). Interestingly, CD40L expression was more affected than CD69 expression in response to both anti-CD4 treatment and inactivated HIV, similar to what is observed with stimulated cells from HIV+ patients.
Two principal mechanisms may be involved in decreased levels of steady-state CD40L mRNA, i.e., increased instability of the mRNA transcripts or decreased mRNA transcription due to altered upstream signaling. The half-life of CD40L mRNA was not decreased in cells from HIV+ patients nor was it affected by anti-CD4 treatment, ruling out increased mRNA instability as a major mechanism underlying blunted CD40L expression. In contrast, the stability of CD40L mRNA appeared to be increased in activated T cells from HIV+ donors, something that was not reproduced in anti-CD4-treated T cells. This discrepancy between ex vivo results and in vitro model may reflect the differences occurring between a sustained chronic exposure to HIV particles (cells taken ex vivo from HIV+ donors) and an acute exposure (in vitro CD4 engagement).
An alternative mechanism underlying CD40L dysregulation could be the existence of defects in the signaling cascades upstream of CD40L promoter activation. The cooperative activity of several transcription factors (41, 42, 43, 44) is needed for optimal CD40L transcription. CD40L mRNA induction after stimulation with ionomycin or PMA was intact, strongly suggesting a major defect in the early events following TCR engagement. Such a hypothesis is in agreement with studies demonstrating defective p56lckmediated signaling and inhibition of CD4 dimerization in T cells in which CD4 had been pre-engaged (60, 61, 62). Alternatively, the strength of the signals provided by these compounds may have overcome the signaling defects. Our data do not support the latter hypothesis, as maximum induction of CD40L mRNA followed anti-CD3/CD28, but not PMA or ionomycin stimulation (Fig. 6B).
CD40L expression was more affected than CD69 or OX40 expression, either following CD4 pre-engagement or in T cells from HIV+ patients. One potential mechanism is that both CD69 and OX40 are dependent on one principal signaling pathway in contrast to CD40L, which requires the optimal and coordinated activation of several signaling pathways. Indeed, CD69 expression mainly depends on activation of the Ras/mitogen-activated protein kinase pathway (63, 64, 65); OX40 induction largely follows c-fos and c-jun translocation (66). Interestingly, a similar selective defect is observed with partial agonists (67). Such agonists induce CD69 expression, albeit more transiently than full agonists, but do not induce proliferation or cytokine production by T cells, something that require coordinated activation of several signaling cascades.
In the present study, we demonstrate that CD40L dysregulation is a key mechanism in APC dysregulation in HIV infection. Defects in up-regulation of CD40L expression are expected to have disproportionate consequences, starting a vicious cycle, whereby defective APC fail to give optimal feedback signal to T cells, which in turn, fail to provide signals critical for APC survival. An acquired deficiency in CD40L would be predicted to impair control, not only of HIV, but also of the many pathogens controlled by cellular immunity. The mechanisms by which HIV infection affects CD40L expression appear to involve HIV gp120-mediated engagement of CD4. Clear elucidation of mechanism(s) may well lead to the development of novel immunotherapeutic approaches to HIV infection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Claire Chougnet, Division of Molecular Immunology, Cincinnati Childrens Hospital Medical Center, 3333 Burnet Avenue, Mail Location Code 7021, Cincinnati, OH 45229-3039. E-mail address: Claire.Chougnet{at}cchmc.org ![]()
3 Abbreviations used in this paper: CD40L, CD40 ligand; AT-2, aldrithiol-2; MFI, mean fluorescence intensity; SAC, Staphylococcus aureus Cowan. ![]()
Received for publication July 2, 2003. Accepted for publication November 26, 2003.
| References |
|---|
|
|
|---|
restores deficient IL-12 production by peripheral blood mononuclear cells from HIV-seropositive donors. J. Immunol. 158:459.[Abstract]
synergistically restore IL-12 production in HIV-infected patients. Eur. J. Immunol. 28:646.[Medline]
B ligand, and TNF-
in the activation of dendritic cells and the expansion of viral specific CD8+ T cell memory responses in HIV-1-infected and HIV-1-uninfected individuals. J. Immunol. 170:1797.
B is involved in the regulation of CD154 (CD40 ligand) expression in primary human T cells. Clin. Exp. Immunol. 125:229.[Medline]
1 and the Ras pathway. Immunity 9:617.[Medline]
This article has been cited by other articles:
![]() |
A. M. Nyakeriga, C. J. Fichtenbaum, J. Goebel, S. A. Nicolaou, L. Conforti, and C. A. Chougnet Engagement of the CD4 Receptor Affects the Redistribution of Lck to the Immunological Synapse in Primary T Cells: Implications for T-Cell Activation during Human Immunodeficiency Virus Type 1 Infection J. Virol., February 1, 2009; 83(3): 1193 - 1200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Subauste, A. Subauste, and M. Wessendarp Role of CD40-Dependent Down-Regulation of CD154 in Impaired Induction of CD154 in CD4+ T Cells from HIV-1-Infected Patients J. Immunol., February 1, 2007; 178(3): 1645 - 1653. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nilsson, A. Boasso, P. A. Velilla, R. Zhang, M. Vaccari, G. Franchini, G. M. Shearer, J. Andersson, and C. Chougnet HIV-1-driven regulatory T-cell accumulation in lymphoid tissues is associated with disease progression in HIV/AIDS Blood, December 1, 2006; 108(12): 3808 - 3817. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chougnet and S. Gessani Role of gp120 in dendritic cell dysfunction in HIV infection J. Leukoc. Biol., November 1, 2006; 80(5): 994 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, J. Antony, S. Liu, J. A. Martinez, F. Giuliani, D. Zochodne, and C. Power CD8+ lymphocyte-mediated injury of dorsal root ganglion neurons during lentivirus infection: CD154-dependent cell contact neurotoxicity. J. Neurosci., March 29, 2006; 26(13): 3396 - 3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhang, J. D. Lifson, and C. Chougnet Failure of HIV-exposed CD4+ T cells to activate dendritic cells is reversed by restoration of CD40/CD154 interactions Blood, March 1, 2006; 107(5): 1989 - 1995. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Hodara, M. C. Velasquillo, L. M. Parodi, and L. D. Giavedoni Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques J. Virol., April 15, 2005; 79(8): 4679 - 4690. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Andersson, A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G. M. Shearer, and C. A. Chougnet Cutting Edge: The Prevalence of Regulatory T Cells in Lymphoid Tissue Is Correlated with Viral Load in HIV-Infected Patients J. Immunol., March 15, 2005; 174(6): 3143 - 3147. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balabanian, J. Harriague, C. Decrion, B. Lagane, S. Shorte, F. Baleux, J.-L. Virelizier, F. Arenzana-Seisdedos, and L. A. Chakrabarti CXCR4-Tropic HIV-1 Envelope Glycoprotein Functions as a Viral Chemokine in Unstimulated Primary CD4+ T Lymphocytes J. Immunol., December 15, 2004; 173(12): 7150 - 7160. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |