The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Lanier, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Lanier, L. L.
The Journal of Immunology, 2004, 172: 2001-2005.
Copyright © 2004 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Toll-Like Receptor Signaling in Macrophages Induces Ligands for the NKG2D Receptor 1

Jessica A. Hamerman, Kouetsu Ogasawara and Lewis L. Lanier2

Department of Microbiology and Immunology, and Cancer Research Institute, University of California, San Francisco, CA 94143


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Macrophages recognize the presence of infection by using the Toll-like receptor (TLR) family of proteins that detect ligands on bacterial, viral, and fungal pathogens. We show that murine macrophages stimulated with pathogen products known to signal through TLRs express ligands for the NKG2D receptor, found on NK cells, activated CD8+ T cells and activated macrophages. TLR signaling, through the MyD88 adaptor, up-regulates transcription of the retinoic acid early inducible-1 (RAE-1) family of NKG2D ligands, but not H-60 or murine UL16-binding protein-like transcript-1. RAE-1 proteins are found on the surface of activated, but not resting, macrophages and can be detected by NKG2D on NK cells resulting in down-regulation of this receptor both in vitro and in vivo. RAE-1-NKG2D interactions provide a mechanism by which NK cells and infected macrophages communicate directly during an innate immune response to infection.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Macrophages are distributed throughout the body where they are poised to alert the innate immune system to infection. They directly sense a wide variety of microbes through pattern recognition receptors, including the Toll-like receptors (TLRs), 3 which are involved in the recognition of conserved molecular patterns on bacterial, viral, and fungal pathogens (1). Rather than detecting the pathogen itself, NK cells use a variety of activating and inhibitory receptors to detect alterations in the infected cells (2, 3). Some NK cell activating receptors directly recognize pathogen-encoded proteins expressed on infected cells, as is the case with the NK receptor Ly49H binding to the murine CMV-encoded protein m157 (4, 5). Alternatively, NK cells may recognize host proteins only expressed after infection. This has also been shown in viral infection, where ligands for the NK receptor NKG2D are expressed on CMV-infected cells (6, 7).

The NKG2D receptor is constitutively expressed on all NK cells. NKG2D has no intrinsic signaling capacity and therefore complexes with transmembrane signaling adaptors, DAP10 and in mice DAP12 (8, 9, 10). Mouse NKG2D binds to the retinoic acid early inducible-1 (RAE-1) proteins (RAE-1 {alpha}, {beta}, {gamma}, {delta}, and {epsilon}), to the minor histocompatibility Ag H60, and to the murine UL16-binding protein-like transcript-1 (MULT-1) glycoprotein (11, 12, 13, 14). The RAE-1 proteins are expressed during embryogenesis, but have not been detected in adult tissue (15, 16), while the H60 peptide complexed with MHC class I has been detected on macrophages in BALB.b, but not C57BL/6 (B6) mice (17). MULT-1 mRNA has been found in many tissues, but whether protein expression correlates with this is unknown (13, 14).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Mice

BALB/c and B6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and Charles River Breeding Laboratories (Wilmington, MA), respectively. Macrophages from MyD88-/- mice (18) on a B6 background were generously provided by Dr. T. DeFranco (University of California, San Francisco, CA) and Dr. A. Aderem (Institute for Systems Biology, Seattle, WA).

Activation of macrophages in vitro and in vivo

Resident peritoneal macrophages were plate-adhered overnight, and nonadherent cells were removed by washing. Macrophages were cultured with pathogen products or whole bacteria for 24 h or with IFN-{gamma} (10 U/ml; Life Technologies, Rockville, MD) for 48 h for RNA isolation and flow cytometric analysis. Macrophages were exposed to 100 ng/ml LPS (S. Minnesota R595; List Biological Laboratories, Campbell, CA), 100 ng/ml Pam3CSK4 (Roche, Basel, Switzerland), or 100 µg/ml poly(I:C) (Amersham, Arlington Heights, IL). Heat-killed Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Mycobacterium bovis BCG (provided by Dr. A. Aderem), and zymosan (Molecular Probes, Eugene, OR) were used at 10 particles per macrophage. All macrophage activators, except LPS and E. coli, were treated with 10 µg/ml polymixin B (Sigma-Aldrich, St. Louis, MO) for 1 h before addition to macrophages. For in vivo macrophage activation, mice were injected i.p. with 10 µg of LPS.

Flow cytometry

FcR were blocked with 2.4G2 mAb (BD PharMingen, San Diego, CA) and macrophages were then stained with a fusion protein comprised of the extracellular domain of mouse NKG2D with the Fc domain of human IgG1 (NKG2D-Ig) (11), followed by PE-labeled goat anti-human Fc Ab (Jackson Immunoresearch Laboratories, West Grove, PA). For detection of RAE-1, macrophages were stained with a mAb that recognizes all known RAE-1 proteins (6) (186107; developed in collaboration with Dr. J. P. Houchins, R&D Systems, Minneapolis, MN). In vivo activated macrophages were costained with FITC-conjugated F4/80 mAb (Caltag Laboratories, Burlingame, CA).

Quantitative real-time PCR

Real-time PCR was performed using an ABI 7700 with Sequence Detector software (Applied Biosystems, Foster City, CA) as described (6, 19). The MULT-1 set included: probe 5'FAM-CCGGAAAGCCCCTCACTCTGCA-3'-TAMRA, sense primer TTCACATAGTGCAGGAGACTAACACA, and antisense primer ACTGGCCACACACCTCAGC.

NKG2D modulation in vitro and in vivo

B6 peritoneal macrophages were activated, as above, with LPS or heat-killed L. monocytogenes. After 48 h, splenocytes depleted of T and B cells were added to the macrophages at a ratio of 2:1 in the presence of 200 U/ml human recombinant IL-2 (provided by the National Cancer Institute Biological Resources Branch Preclinical Repository). After 24 h of coculture with macrophages, NK cells were stained with mAb against NK1.1, CD3 and CD44 (BD PharMingen) or NKG2D (CX5) (19) and analyzed by flow cytometry. For in vivo modulation of NKG2D, mice were injected with 10 µg of LPS and at 1–7 days after injection, peritoneal cells were stained with mAb to DX5, CD3 and NK1.1 or NKG2D (CX5) and analyzed by flow cytometry.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
NKG2D ligand expression on activated macrophages

We investigated whether pathogenic stimulation of macrophages induces expression of NKG2D ligands. Peritoneal macrophages from BALB/c mice were activated in vitro with LPS, a potent macrophage activator from the surface of Gram-negative bacteria. After 24 h, the cells were stained with NKG2D-Ig that recognizes all ligands for this receptor (11). While very low levels of staining were seen on unstimulated macrophages, an increase in staining was seen on LPS-activated cells (Fig. 1).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 1. NKG2D ligands are up-regulated on peritoneal macrophages in response to LPS. Resident peritoneal macrophages from BALB/c mice were cultured in medium alone or with LPS for 24 h. Macrophages were stained with NKG2D-Ig (solid line) or with control Ig (dotted line) and analyzed by flow cytometry. Results are representative of two independent experiments.

 
RAE-1{alpha}, RAE-1{beta}, and RAE-1{gamma} were initially described as three separate genes in 129 mice that were induced by retinoic acid treatment of the F9 teratocarcinoma (15, 16, 20). The proteins they encode were subsequently found to be ligands for mouse NKG2D, as were two additional members of this family, RAE-1{delta} and RAE-1{epsilon} (11, 12, 21). We used real-time PCR primer-probe sets that distinguish between the RAE-1 cDNAs, along with sets designed to detect H60 and MULT-1, to amplify cDNA generated from mRNA from resting and activated macrophages to obtain quantitative information about the levels of transcripts. We used a panel of ligands that are derivatives of pathogens and known to signal through various TLRs to activate macrophages, as well as IFN-{gamma}, another potent macrophage activator that signals through a distinct pathway. These stimuli included LPS from Gram-negative bacteria (TLR4); the synthetic bacterial lipopeptide, Pam3CSK4 (TLR2 + 1); zymosan, derived from yeast cell walls (TLR2 + 6); and poly(I:C), a synthetic double-stranded RNA (TLR3) (1).

In BALB/c macrophages, RAE-1 transcripts were induced by TLR ligands, but not by IFN-{gamma} (Fig. 2, A and B). In contrast, levels of mRNA for MULT-1 and H60 were unchanged in macrophages treated with microbial stimuli or IFN-{gamma}. We were interested in whether the TLR ligands had selective effects on the promoters of the different RAE-1 genes. In BALB/c macrophages (Fig. 2A), LPS equivalently induced transcription of RAE-1{alpha}, RAE-1{beta}, and RAE-1{gamma}, while other stimuli had differential effects. Particularly striking was the strong induction of RAE-1{alpha} mRNA by the TLR3 stimulus, poly(I:C), in comparison with the more modest effects of poly(I:C) on RAE-1{beta} and {gamma}. In fact, this was the only case in which a stimulus other than LPS gave the strongest induction of a RAE-1 gene. We also examined the induction of RAE-1 mRNA by whole bacteria, each of which display a variety of TLR ligands. Bacteria, including the Gram-negative bacterium E. coli, the Gram-positive bacteria S. aureus and L. monocytogenes; and the mycobacterium M. bovis BCG, induced RAE-1 transcription (Fig. 2B). These data suggest that the increase in NKG2D-Ig staining seen in LPS-activated macrophages (Fig. 1) was likely due to expression of the RAE-1 proteins and not MULT-1 or H60. Additionally, we have shown that infection of macrophages with murine CMV, a dsDNA virus, induces mRNA encoding all five known RAE-1 genes, though it is not clear whether this occurs through a TLR pathway or another mechanism (6). By contrast, IFN-{gamma} did not induce transcription of any NKG2D ligand genes.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2. RAE-1 transcripts are induced in macrophages in response to TLR ligands. A, Resident peritoneal macrophages from BALB/c mice were cultured for 24 h in medium alone (none) or with TLR ligands or for 48 h with IFN-{gamma}. cDNA was subjected to quantitative real-time PCR. RAE-1 transcription is expressed as the fold induction over untreated macrophages. SD for duplicate or triplicate samples was <1%. Data shown are representative of three to six experiments. B, Macrophages were cultured for 24 h alone or in the presence of LPS or heat-killed bacteria. Results are representative of two independent experiments. C, Resident peritoneal macrophages from MyD88-/- mice or from wild-type B6 controls were cultured alone or with LPS. Results are representative of three mice assayed in two experiments.

 
Taken together, these results show that the different RAE-1 genes, while all were induced by some microbial stimuli, are differentially regulated by particular agents. Differences in the promoters of the RAE-1 genes resulting in differential regulation could be one explanation for why multiple genes which encode proteins with greater than 90% homology and similar affinities for NKG2D exist (22).

Induction of RAE-1 mRNA is MyD88-dependent

While all RAE-1 genes were induced transcriptionally in response to signaling through the TLRs analyzed (TLR1, TLR2, TLR3, TLR4, TLR6), there were differences in the magnitude of the response. This led us to analyze the mechanism by which TLR signaling resulted in RAE-1 expression. TLRs mediate signaling through recruitment of a set of TIR-domain-containing adaptor molecules. MyD88 is the best studied adaptor and is required for many TLR responses (1). MyD88 interacts with all TLRs through its TIR domain linking TLR ligation to downstream signaling pathways resulting in activation of NF-{kappa}B (1).

It was unclear whether induction of RAE-1 by LPS would require MyD88, as do the inflammatory cytokines TNF-{alpha}, IL-1{beta}, and IL-6, or would be MyD88-independent as is costimulatory molecule induction in dendritic cells (1). To test whether induction of RAE-1 mRNA is dependent upon MyD88, we treated peritoneal macrophages from MyD88-deficient mice (18) on a B6 background with LPS. We found that the induction of RAE-1{delta} and RAE-1{epsilon} by LPS is completely dependent upon MyD88 signaling (Fig. 2C). Neither TNF-{alpha} nor IFN-{alpha}{beta} are required for LPS-induced RAE-1 expression because gene-deficient mice for TNF-{alpha} or IFN-{alpha}{beta} receptor demonstrated normal levels of RAE-1 induction in response to these stimuli (data not shown).

Induction RAE-1 surface expression by microbial stimuli

To examine whether the increase in mRNA for the RAE-1 proteins resulted in surface expression of these NKG2D ligands, we used a mAb that recognizes all known RAE-1 proteins (6). While untreated macrophages did not show RAE-1 surface expression, RAE-1 was detected on macrophages stimulated with LPS, poly(I:C), zymosan, E. coli, and L. monocytogenes (Fig. 3A). Because mAbs against H60 and MULT-1 are not available, we cannot exclude the possibility that the surface expression of H60 and MULT-1 are increased after TLR signaling, while the mRNA levels are constant (Fig. 2).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 3. RAE-1 is found on the surface of macrophages treated with TLR ligands in vitro and in vivo. A, Resident peritoneal macrophages from B6 mice were cultured alone or treated with TLR ligands. After 48 h, the macrophages were stained with a pan-RAE-1 mAb and analyzed by flow cytometry. The number in the upper right corner is the mean fluorescence intensity of the cells stained with the anti-RAE-1 mAb. B, Peritoneal cells were harvested from uninjected mice or from mice injected i.p. 48 h previously with LPS. Staining of the pan-RAE-1 mAb is shown (gating on F4/80-positive macrophages). Data are representative of four independent experiments.

 
RAE-1 surface expression was also observed on macrophages activated in vivo. Freshly isolated resident peritoneal macrophages did not express RAE-1, while after i.p. injection of LPS, surface RAE-1 was detected on the macrophages in the peritoneal cavity (Fig. 3B). Thus, we have demonstrated that the RAE-1 family of ligands for mouse NKG2D are expressed on the surface of macrophages after signaling through TLRs, the initiating step in the immune response to many pathogens.

RAE-1 on activated macrophages is recognized by NKG2D on NK cells in vitro and in vivo

We sought to determine whether the levels of RAE-1 protein found on the surface of activated macrophages were sufficient to be detected by NKG2D on NK cells. To do this, we took advantage of the fact that NKG2D is down-regulated on NK cells after interacting with its ligands (19). Unstimulated macrophages or macrophages activated for 24 h with LPS or Listeria monocytogenes were cultured overnight with NK cells and then NKG2D levels were assessed by flow cytometry. NKG2D levels were unchanged on NK cells cultured with unstimulated macrophages in comparison with NK cells cultured alone (Fig. 4A). In contrast, NKG2D levels were reduced on NK cells cultured with LPS or Listeria monocytogenes-treated macrophages. Surface levels of CD44 on the NK cells were unchanged these culture conditions (Fig. 4A). The modulation of NKG2D required cell-cell contact, as it did not occur when the NK cells and macrophages were separated during culture by a 0.4-µM Transwell filter (data not shown), suggesting the numerous cytokines produced by TLR-activated macrophages were not responsible for the NKG2D down-regulation on the NK cells.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 4. NKG2D on NK cells is down-regulated in response to RAE-1 on activated macrophages. A, Fresh NK cells were cocultured with macrophages from B6 mice that were untreated (none) or treated with LPS or heat-killed L. monocytogenes for 48 h before addition of NK cells. After 24 h, the NK cells were stained and analyzed by flow cytometry. The plots show the staining profiles of NK cells gated as NK1.1+CD3- for NKG2D (left panel) or CD44 (right panel). The thick line shows staining of NK cells cultured alone, the thin line of NK cells cultured with macrophages and the dotted line indicates staining with control mAb. B, B6 mice were injected i.p. with LPS. At indicated times after injection peritoneal cells were stained and analyzed by flow cytometry. The staining profiles for NKG2D (left panel) and NK1.1 (right panel) are shown for DX5+CD3- gated NK cells. The plots show the levels of NKG2D or NK1.1 on NK cells from an uninjected mouse (thick lines), an LPS-injected mouse (thin lines) or stained with control mAb (dotted lines). Three injected mice were assayed per experiment and the results shown are representative of three independent experiments.

 
Given that NK cells cultured with LPS-activated macrophages in vitro modulated NKG2D levels, we examined whether this happens in vivo. As early as 24 h after LPS injection, NKG2D was reduced on NK cells in the peritoneal cavity in comparison with the NKG2D staining seen on NK cells from uninjected mice (Fig. 4B). This modulation of NKG2D was not permanent, as NKG2D levels returned to normal within 7 days after injection. This may reflect the fact that RAE-1 expression on peritoneal macrophages after in vivo LPS treatment peaked at 48 h and returned to background levels at 96 h after injection (data not shown). At all time points, the level of NK1.1, another NK cell activating receptor, had not changed. The efficient modulation of NKG2D on NK cells after LPS injection in vivo suggests that NK cells are responding to RAE-1-bearing cells, presumably including macrophages, in vivo. As NKG2D is also expressed on mouse CD8+ T cells and activated macrophages (12, 23), it is possible that the RAE-1 on macrophages signals to these cell types as well. Ligand-induced modulation of NKG2D levels has been shown to depend upon signaling through the YXXM motif in DAP10, the NKG2D-associated signaling adaptor in the resting NK cells used in these experiments (19). Taken together, these data suggest that the levels of RAE-1 protein found on the surface of activated macrophages is sufficient to induce NKG2D signaling in NK cells, resulting in modulation of receptor levels.

In summary, RAE-1 expression on macrophages in response to pathogenic stimuli may contribute to both the innate and adaptive immune responses to infection. RAE-1-NKG2D interactions may delineate a mechanism by which NK cells and infected macrophages interact directly during infection, in addition to the well-defined indirect activity of macrophage-produced cytokines on NK cell IFN-{gamma} production. Indeed, we have seen that NK cells can kill LPS-activated macrophages in vitro (J. Hamerman, unpublished observations), and we are currently investigating the receptors involved in this function.


   Acknowledgments
 
We thank Drs. Tony DeFranco, Alan Aderem, Elizabeth Gold, Adrian Ozinsky, and Tom Hawn for providing macrophages from MyD88-deficient mice and the TLR ligands and bacteria used in these studies. We thank Dr. Adrian Ozinsky for critical review of the manuscript.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant CA95137. J.A.H. is supported by the Irvington Institute for Immunological Research. K.O. is supported by a Human Frontier Science Program Long-Term Fellowship. L.L.L. is an American Cancer Society Research Professor. Back

2 Address correspondence and reprint requests to Dr. Lewis L. Lanier, Department of Microbiology and Immunology, Box 0414, University of California, San Francisco, CA 94143. E-mail address: lanier{at}itsa.ucsf.edu Back

3 Abbreviations used in this paper: TLR, Toll-like receptor; RAE-1, retinoic acid early inducible-1; MULT-1, murine UL16-binding protein-like transcript-1. Back

Received for publication November 20, 2003. Accepted for publication December 22, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Takeda, K., S. Akira. 2003. Toll receptors and pathogen resistance. Cell Microbiol. 5:143.[Medline]
  2. Yokoyama, W. M., B. F. Plougastel. 2003. Immune functions encoded by the natural killer gene complex. Nat. Rev. Immunol. 3:304.[Medline]
  3. Cerwenka, A., L. L. Lanier. 2001. Natural killer cells, viruses and cancer. Nature Rev. Immunol. 1:41.[Medline]
  4. Arase, H., E. S. Mocarski, A. E. Campbell, A. B. Hill, L. L. Lanier. 2002. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296:1323.[Abstract/Free Full Text]
  5. Smith, H. R., J. W. Heusel, I. K. Mehta, S. Kim, B. G. Dorner, O. V. Naidenko, K. Iizuka, H. Furukawa, D. L. Beckman, J. T. Pingel, et al 2002. Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc. Natl. Acad. Sci. USA 99:8826.[Abstract/Free Full Text]
  6. Lodoen, M., K. Ogasawara, J. A. Hamerman, H. Arase, J. P. Houchins, E. S. Mocarski, L. L. Lanier. 2003. NKG2D-mediated natural killer cell protection against cytomegalovirus is impaired by viral gp40 modulation of retinoic acid early inducible 1 gene molecules. J. Exp. Med. 197:1245.[Abstract/Free Full Text]
  7. Groh, V., R. Rhinehart, J. Randolph-Habecker, M. S. Topp, S. R. Riddell, T. Spies. 2001. Costimulation of CD8{alpha}{beta} T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat. Immunol. 2:255.[Medline]
  8. Wu, J., Y. Song, A. B. Bakker, S. Bauer, T. Spies, L. L. Lanier, J. H. Phillips. 1999. An activating immunoreceptor complex formed by NKG2D and DAP10. Science 285:730.[Abstract/Free Full Text]
  9. Diefenbach, A., E. Tomasello, M. Lucas, A. M. Jamieson, J. K. Hsia, E. Vivier, D. H. Raulet. 2002. Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat. Immunol. 3:1142.[Medline]
  10. Gilfillan, S., E. L. Ho, M. Cella, W. M. Yokoyama, M. Colonna. 2002. NKG2D recruits two distinct adapters to trigger NK cell activation and costimulation. Nat. Immunol. 3:1150.[Medline]
  11. Cerwenka, A., A. B. Bakker, T. McClanahan, J. Wagner, J. Wu, J. H. Phillips, L. L. Lanier. 2000. Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12:721.[Medline]
  12. Diefenbach, A., A. M. Jamieson, S. D. Liu, N. Shastri, D. H. Raulet. 2000. Ligands for the murine NKG2D receptor: expression by tumor cells and activation of NK cells and macrophages. Nat. Immunol. 1:119.[Medline]
  13. Carayannopoulos, L. N., O. V. Naidenko, D. H. Fremont, W. M. Yokoyama. 2002. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J. Immunol. 169:4079.[Abstract/Free Full Text]
  14. Diefenbach, A., J. K. Hsia, M. Y. Hsiung, D. H. Raulet. 2003. A novel ligand for the NKG2D receptor activates NK cells and macrophages and induces tumor immunity. Eur. J. Immunol. 33:381.[Medline]
  15. Nomura, M., Z. Zou, T. Joh, Y. Takihara, Y. Matsuda, K. Shimada. 1996. Genomic structures and characterization of Rae1 family members encoding GPI-anchored cell surface proteins and expressed predominantly in embryonic mouse brain. J. Biochem. 120:987.[Abstract/Free Full Text]
  16. Nomura, M., Y. Takihara, K. Shimada. 1994. Isolation and characterization of retinoic acid-inducible cDNA clones in F9 cells: one of the early inducible clones encodes a novel protein sharing several highly homologous regions with a Drosophila polyhomeotic protein. Differentiation 57:39.[Medline]
  17. Malarkannan, S., T. Horng, P. Eden, F. Gonzalez, P. Shih, N. Brouwenstijn, H. Klinge, G. Christianson, D. Roopenian, N. Shastri. 2000. Differences that matter: major cytotoxic T cell-stimulating minor histocompatibility antigens. Immunity 13:333.[Medline]
  18. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11:115.[Medline]
  19. Ogasawara, K., J. A. Hamerman, H. Hsin, S. Chikuma, H. Bour-Jordan, T. Chen, T. Pertel, C. Carnaud, J. A. Bluestone, L. L. Lanier. 2003. Impairment of NK cell function by NKG2D modulation in NOD mice. Immunity 18:41.[Medline]
  20. Zou, Z., M. Nomura, Y. Takihara, T. Yasunaga, K. Shimada. 1996. Isolation and characterization of retinoic acid-inducible cDNA clones in F9 cells: a novel cDNA family encodes cell surface proteins sharing partial homology with MHC class I molecules. J. Biochem. 119:319.[Abstract/Free Full Text]
  21. Girardi, M., D. E. Oppenheim, C. R. Steele, J. M. Lewis, E. Glusac, R. Filler, P. Hobby, B. Sutton, R. E. Tigelaar, A. C. Hayday. 2001. Regulation of cutaneous malignancy by {gamma}{delta} T cells. Science :
  22. O’Callaghan, C. A., A. Cerwenka, B. E. Willcox, L. L. Lanier, P. J. Bjorkman. 2001. Molecular competition for NKG2D: H60 and RAE1 compete unequally for NKG2D with dominance of H60. Immunity 15:201.[Medline]
  23. Jamieson, A. M., A. Diefenbach, C. W. McMahon, N. Xiong, J. R. Carlyle, D. H. Raulet. 2002. The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity 17:19.[Medline]



This article has been cited by other articles:


Home page
 JEMHome page
W. Cao, L. Bover, M. Cho, X. Wen, S. Hanabuchi, M. Bao, D. B. Rosen, Y.-H. Wang, J. L. Shaw, Q. Du, et al.
Regulation of TLR7/9 responses in plasmacytoid dendritic cells by BST2 and ILT7 receptor interaction
J. Exp. Med., July 6, 2009; 206(7): 1603 - 1614.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Hedlund, A.-C. Stenqvist, O. Nagaeva, L. Kjellberg, M. Wulff, V. Baranov, and L. Mincheva-Nilsson
Human Placenta Expresses and Secretes NKG2D Ligands via Exosomes that Down-Modulate the Cognate Receptor Expression: Evidence for Immunosuppressive Function
J. Immunol., July 1, 2009; 183(1): 340 - 351.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. E. Butler, M. B. Moore, S. R. Presnell, H.-W. Chan, N. J. Chalupny, and C. T. Lutz
Proteasome Regulation of ULBP1 Transcription
J. Immunol., May 15, 2009; 182(10): 6600 - 6609.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
T. Vaisar, S. Y. Kassim, I. G. Gomez, P. S. Green, S. Hargarten, P. J. Gough, W. C. Parks, C. L. Wilson, E. W. Raines, and J. W. Heinecke
MMP-9 Sheds the {beta}2 Integrin Subunit (CD18) from Macrophages
Mol. Cell. Proteomics, May 1, 2009; 8(5): 1044 - 1060.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Lapaque, T. Walzer, S. Meresse, E. Vivier, and J. Trowsdale
Interactions between Human NK Cells and Macrophages in Response to Salmonella Infection
J. Immunol., April 1, 2009; 182(7): 4339 - 4348.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
A. Cerwenka
New twist on the regulation of NKG2D ligand expression
J. Exp. Med., February 16, 2009; 206(2): 265 - 268.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Kloss, P. Decker, K. M. Baltz, T. Baessler, G. Jung, H.-G. Rammensee, A. Steinle, M. Krusch, and H. R. Salih
Interaction of Monocytes with NK Cells upon Toll-Like Receptor-Induced Expression of the NKG2D Ligand MICA
J. Immunol., November 15, 2008; 181(10): 6711 - 6719.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Lunemann, J. D. Lunemann, S. Roberts, B. Messmer, R. B. da Silva, C. S. Raine, and C. Munz
Human NK Cells Kill Resting but Not Activated Microglia via NKG2D- and NKp46-Mediated Recognition
J. Immunol., November 1, 2008; 181(9): 6170 - 6177.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. C. Wesselkamper, B. L. Eppert, G. T. Motz, G. W. Lau, D. J. Hassett, and M. T. Borchers
NKG2D Is Critical for NK Cell Activation in Host Defense against Pseudomonas aeruginosa Respiratory Infection
J. Immunol., October 15, 2008; 181(8): 5481 - 5489.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. Iannello, O. Debbeche, S. Samarani, and A. Ahmad
Antiviral NK cell responses in HIV infection: I. NK cell receptor genes as determinants of HIV resistance and progression to AIDS
J. Leukoc. Biol., July 1, 2008; 84(1): 1 - 26.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. B. Walsh, M. B. Lodoen, R. A. Edwards, L. L. Lanier, and T. E. Lane
Evidence for Differential Roles for NKG2D Receptor Signaling in Innate Host Defense against Coronavirus-Induced Neurological and Liver Disease
J. Virol., March 15, 2008; 82(6): 3021 - 3030.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. B. Walsh, L. L. Lanier, and T. E. Lane
NKG2D Receptor Signaling Enhances Cytolytic Activity by Virus-Specific CD8+ T Cells: Evidence for a Protective Role in Virus-Induced Encephalitis
J. Virol., March 15, 2008; 82(6): 3031 - 3044.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Vales-Gomez, S. E. Chisholm, R. L. Cassady-Cain, P. Roda-Navarro, and H. T. Reyburn
Selective Induction of Expression of a Ligand for the NKG2D Receptor by Proteasome Inhibitors
Cancer Res., March 1, 2008; 68(5): 1546 - 1554.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Takada, S. Yoshida, M. Kajikawa, Y. Miyatake, U. Tomaru, M. Sakai, H. Chiba, K. Maenaka, D. Kohda, K. Fugo, et al.
Two Novel NKG2D Ligands of the Mouse H60 Family with Differential Expression Patterns and Binding Affinities to NKG2D
J. Immunol., February 1, 2008; 180(3): 1678 - 1685.
[Abstract] [Full Text] [PDF]

Home page
 Brief Funct Genomic ProteomicHome page
G. B. Scott, J. L. Meade, and G. P. Cook
Profiling killers; unravelling the pathways of human natural killer cell function
Brief Funct Genomic Proteomic, January 21, 2008; (2008) elm037v1.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
T. Ebihara, H. Masuda, T. Akazawa, M. Shingai, H. Kikuta, T. Ariga, M. Matsumoto, and T. Seya
Induction of NKG2D ligands on human dendritic cells by TLR ligand stimulation and RNA virus infection
Int. Immunol., October 1, 2007; 19(10): 1145 - 1155.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Hyka-Nouspikel, L. Lucian, E. Murphy, T. McClanahan, and J. H. Phillips
DAP10 Deficiency Breaks the Immune Tolerance against Transplantable Syngeneic Melanoma
J. Immunol., September 15, 2007; 179(6): 3763 - 3771.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Babu, C. P. Blauvelt, and T. B. Nutman
Filarial Parasites Induce NK Cell Activation, Type 1 and Type 2 Cytokine Secretion, and Subsequent Apoptotic Cell Death
J. Immunol., August 15, 2007; 179(4): 2445 - 2456.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Cerboni, A. Zingoni, M. Cippitelli, M. Piccoli, L. Frati, and A. Santoni
Antigen-activated human T lymphocytes express cell-surface NKG2D ligands via an ATM/ATR-dependent mechanism and become susceptible to autologous NK- cell lysis
Blood, July 15, 2007; 110(2): 606 - 615.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Guan, M. Moretto, D. J. Bzik, J. Gigley, and I. A. Khan
NK Cells Enhance Dendritic Cell Response against Parasite Antigens via NKG2D Pathway
J. Immunol., July 1, 2007; 179(1): 590 - 596.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Zhou, H. Wei, R. Sun, J. Zhang, and Z. Tian
NKG2D recognition mediates Toll-like receptor 3 signaling-induced breakdown of epithelial homeostasis in the small intestines of mice
PNAS, May 1, 2007; 104(18): 7512 - 7515.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Nedvetzki, S. Sowinski, R. A. Eagle, J. Harris, F. Vely, D. Pende, J. Trowsdale, E. Vivier, S. Gordon, and D. M. Davis
Reciprocal regulation of human natural killer cells and macrophages associated with distinct immune synapses
Blood, May 1, 2007; 109(9): 3776 - 3785.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. E. McCann, P. Eissmann, B. Onfelt, R. Leung, and D. M. Davis
The Activating NKG2D Ligand MHC Class I-Related Chain A Transfers from Target Cells to NK Cells in a Manner That Allows Functional Consequences
J. Immunol., March 15, 2007; 178(6): 3418 - 3426.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Akazawa, T. Ebihara, M. Okuno, Y. Okuda, M. Shingai, K. Tsujimura, T. Takahashi, M. Ikawa, M. Okabe, N. Inoue, et al.
Antitumor NK activation induced by the Toll-like receptor 3-TICAM-1 (TRIF) pathway in myeloid dendritic cells
PNAS, January 2, 2007; 104(1): 252 - 257.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. T. Borchers, N. L. Harris, S. C. Wesselkamper, M. Vitucci, and D. Cosman
NKG2D ligands are expressed on stressed human airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L222 - L231.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Dhanji, M. T. Chow, and H.-S. Teh
Self-Antigen Maintains the Innate Antibacterial Function of Self-Specific CD8 T Cells In Vivo
J. Immunol., July 1, 2006; 177(1): 138 - 146.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
M. T. Borchers, N. L. Harris, S. C. Wesselkamper, S. Zhang, Y. Chen, L. Young, and G. W. Lau
The NKG2D-Activating Receptor Mediates Pulmonary Clearance of Pseudomonas aeruginosa.
Infect. Immun., May 1, 2006; 74(5): 2578 - 2586.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. D. Bui, L. N. Carayannopoulos, L. L. Lanier, W. M. Yokoyama, and R. D. Schreiber
IFN-Dependent Down-Regulation of the NKG2D Ligand H60 on Tumors
J. Immunol., January 15, 2006; 176(2): 905 - 913.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Nausch, L. Florin, B. Hartenstein, P. Angel, M. Schorpp-Kistner, and A. Cerwenka
Cutting Edge: The AP-1 Subunit JunB Determines NK Cell-Mediated Target Cell Killing by Regulation of the NKG2D-Ligand RAE-1{epsilon}
J. Immunol., January 1, 2006; 176(1): 7 - 11.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. M. Routes, S. Ryan, K. Morris, R. Takaki, A. Cerwenka, and L. L. Lanier
Adenovirus serotype 5 E1A sensitizes tumor cells to NKG2D-dependent NK cell lysis and tumor rejection
J. Exp. Med., December 5, 2005; 202(11): 1477 - 1482.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
Y. Lin, Y. Zeng, J. Di, and S. Zeng
Murine CD200+CK7+ trophoblasts in a poly (I:C)-induced embryo resorption model
Reproduction, October 1, 2005; 130(4): 529 - 537.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Vankayalapati, A. Garg, A. Porgador, D. E. Griffith, P. Klucar, H. Safi, W. M. Girard, D. Cosman, T. Spies, and P. F. Barnes
Role of NK Cell-Activating Receptors and Their Ligands in the Lysis of Mononuclear Phagocytes Infected with an Intracellular Bacterium
J. Immunol., October 1, 2005; 175(7): 4611 - 4617.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. J. Smyth, J. Swann, E. Cretney, N. Zerafa, W. M. Yokoyama, and Y. Hayakawa
NKG2D function protects the host from tumor initiation
J. Exp. Med., September 6, 2005; 202(5): 583 - 588.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. D. Coudert, J. Zimmer, E. Tomasello, M. Cebecauer, M. Colonna, E. Vivier, and W. Held
Altered NKG2D function in NK cells induced by chronic exposure to NKG2D ligand-expressing tumor cells
Blood, September 1, 2005; 106(5): 1711 - 1717.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. K. Kriegeskorte, F. E. Gebhardt, S. Porcellini, M. Schiemann, C. Stemberger, T. J. Franz, K. M. Huster, L. N. Carayannopoulos, W. M. Yokoyama, M. Colonna, et al.
NKG2D-independent suppression of T cell proliferation by H60 and MICA
PNAS, August 16, 2005; 102(33): 11805 - 11810.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Rincon-Orozco, V. Kunzmann, P. Wrobel, D. Kabelitz, A. Steinle, and T. Herrmann
Activation of V{gamma}9V{delta}2 T Cells by NKG2D
J. Immunol., August 15, 2005; 175(4): 2144 - 2151.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
A. A. Dandekar, K. O'Malley, and S. Perlman
Important Roles for Gamma Interferon and NKG2D in {gamma}{delta} T-Cell-Induced Demyelination in T-Cell Receptor {beta}-Deficient Mice Infected with a Coronavirus
J. Virol., August 1, 2005; 79(15): 9388 - 9396.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Wiemann, H.-W. Mittrucker, U. Feger, S. A. Welte, W. M. Yokoyama, T. Spies, H.-G. Rammensee, and A. Steinle
Systemic NKG2D Down-Regulation Impairs NK and CD8 T Cell Responses In Vivo
J. Immunol., July 15, 2005; 175(2): 720 - 729.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. Hasan, A. Krmpotic, Z. Ruzsics, I. Bubic, T. Lenac, A. Halenius, A. Loewendorf, M. Messerle, H. Hengel, S. Jonjic, et al.
Selective Down-Regulation of the NKG2D Ligand H60 by Mouse Cytomegalovirus m155 Glycoprotein
J. Virol., March 1, 2005; 79(5): 2920 - 2930.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J.-F. Bach, A. Bendelac, M. B. Brenner, H. Cantor, G. De Libero, M. Kronenberg, L. L. Lanier, D. H. Raulet, M. J. Shlomchik, and M. G. von Herrath
The Role of Innate Immunity in Autoimmunity
J. Exp. Med., December 20, 2004; 200(12): 1527 - 1531.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. J. Smyth, J. Swann, J. M. Kelly, E. Cretney, W. M. Yokoyama, A. Diefenbach, T. J. Sayers, and Y. Hayakawa
NKG2D Recognition and Perforin Effector Function Mediate Effective Cytokine Immunotherapy of Cancer
J. Exp. Med., November 15, 2004; 200(10): 1325 - 1335.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Lanier, L. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamerman, J. A.
Right arrow Articles by Lanier, L. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS