|
|
||||||||
by CD8+ Type 1 Cells and Down-Regulation of IFN-
Production by CD4+ Th1 Cells Contribute to Toxic Shock-Like Syndrome in an Animal Model of Fatal Monocytotropic Ehrlichiosis1
,
,

,
,
Departments of
*
Pathology and
Microbiology and Immunology,
Sealy Center for Vaccine Development, and
Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555
| Abstract |
|---|
|
|
|---|
in the serum, high frequency of Ehrlichia-specific, TNF-
-producing CD8+ T cells in the spleen, decreased Ehrlicha-specific CD4+ T cell proliferation, low IL-12 levels in the spleen, and a 40-fold decrease in the number of IFN-
-producing CD4+ Th1 cells. All groups contained negligible numbers of IL-4-producing cells in the spleen. Transfer of Ehrlichia-specific polyclonal Abs and IFN-
-producing Ehrlichia-specific CD4+ and CD8+ type 1 cells protected naive mice against lethal IOE challenge. Interestingly, infection with high dose E. muris provided protection against rechallenge with a lethal dose of IOE. Cross-protection was associated with substantial expansion of IFN-
-producing CD4+ and CD8+ cells, but not TNF-
-producing CD8+ T cells, a high titer of IgG2a, and a low serum level of TNF-
. In conclusion, uncontrolled TNF-
production by CD8+ T cells together with a weak CD4+ Th1 cell response are associated with immunopathology and failure to clear IOE in the fatal model of HME. | Introduction |
|---|
|
|
|---|
8 days after the onset of symptoms are also at increased risk of developing fatal HME. Severe cases of HME are often comparable in severity to Rocky Mountain spotted fever or toxic shock syndrome (5, 6, 7). Little is known about the host factors that influence susceptibility and resistance to severe HME, although some studies have suggested that humoral immune responses play an important role during infections with E. chaffeensis and other related Ehrlichia spp. (8). Although immunocompetent mice are generally resistant to infection with E. chaffeensis, SCID mice are highly susceptible, developing persistent and fatal infection. Transfer of immune serum obtained from immunocompetent C57BL/6 mice as well as Abs specific to the 28-kDa major outer membrane proteins of E. chaffeensis to C57BL/6 SCID mice provide significant, but transient, protection from disease (9). As infection of SCID mice with E. chaffeensis results in fatal disease with pathology that does not mimic the histopathological findings in HME, SCID mice may not be a suitable model to elucidate the immunological basis of resistance and susceptibility to infection by monocytotropic ehrlichiae.
The role of the cell-mediated response in the host defense against Ehrlichia is supported by the observations that intracellular killing of E. chaffeensis requires CD4+ T cell-dependent cellular effector mechanisms, including NO production by IFN-
-activated macrophages, and granulomatous inflammation (10). However, the roles of CD4+ and CD8+ T cells and their cytokines in host defense and pathogenesis of the disease are not yet defined.
In the present study we have analyzed the immunopathological mechanisms associated with susceptibility or resistance to ehrlichial infection, using two ehrlichial strains that are phylogenetically related to E. chaffeensis. The first one is a highly virulent ehrlichial strain isolated from Ixodes ovatus ticks (IOE) native to Japan (11) that causes fatal disease in immunocompetent mice (12). The second organism is a mildly virulent strain (Ehrlichia muris) that causes mild and self-limited disease in immunocompetent mice (13). Phylogenetic analysis supports the close relationships among monocytotropic Ehrlichia spp., including E. chaffeensis, E. muris, and IOE (14, 15, 16, 17). Additionally, serological cross-reactions occur between closely related monocytotropic Ehrlichia species (18, 19, 20), attributed mainly to a molecularly characterized major outer membrane proteins (p28) of Ehrlichia and major antigenic protein 2, the P28 orthologue identified in E. ruminantium (18, 19, 20).
In this study we assessed the course of infection and immune responses in C57BL/6 mice susceptible to fatal infection with IOE, but resistant to severe disease caused by E. muris infection. We also investigated whether a primary infection with E. muris can protect mice against rechallenge with virulent IOE and analyzed the immunological correlates of this cross-protection. We provide in this report compelling evidence that infection with virulent IOE causes overproduction of TNF-
by Ag-specific CD8+ T cells, which strongly correlates with pathology and a septic shock-like syndrome. More importantly impaired CD4 T cell proliferation and down-regulation of the Th1 response are other detrimental factors that result in high mortality in the animal model of fatal HME.
| Materials and Methods |
|---|
|
|
|---|
Two monocytotropic ehrlichial strains were used in this study, highly virulent Ehrlichia spp. (designated IOE) isolated from Ixodes ovatus ticks (a gift from Dr. M. Kawahara, Nagoya City Public Health Research Institute, Nagoya, Japan) and mildly virulent E. muris (provided by Dr. Y. Rikihisa, Ohio State University, Columbus, OH). To produce infectious stocks for reproducible studies, C57BL/6 mice were inoculated i.p. with 1 ml of a 10-1 dilution of the frozen stock. On day 7 after inoculation, the mice were sacrificed, the spleens and livers were harvested, and the homogenate was suspended in sucrose-phosphate-glutamate buffer (0.218 mol/L sucrose, 0.0038 mol/L KH2PO4, 0.0072 mol/L K2HPO4, and 0.0049 mol/L monosodium glutamic acid, pH 7.0). Large particles of debris were removed by centrifugation at 200 x g for 3 min, and the supernatant was then aliquoted and stored at -80°C as a 10-1 stock of IOE or E. muris. The LD50 of the IOE stock was estimated to be a dilution of 10-5, because i.p. inoculation with a 10-4 dilution killed 100% of the mice, whereas 100% of the mice survived when a 10-6 dilution was used (data not shown).
Sex-matched C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were used at 68 wk of age in all experiments. Mice were infected i.p. with 1 ml of fresh inoculum at the following doses: 10-2 or 10-4 dilution of IOE stock or 10-1, 10-2, or 10-3 dilution of E. muris stock. Quantitative real-time PCR determined that the 10-2 dilution of IOE stock (high dose IOE) contained 4 x 106 bacterial genomes, whereas the 10-1 dilution of E. muris stock (high dose E. muris) contained 6 x 108 bacterial genomes. For cross-protection experiments, mice were infected i.p. with a 10-1 dilution of E. muris and then challenged i.p. 30 days later with a high dose (10-2 dilution) of IOE. Subsequently, we refer to these mice as EM/IOE. Control mice were given 1 ml of a 10-1 or 10-2 dilution of a spleen homogenate from naive C57BL/6 mice. On the indicated days of infection, mice were sacrificed, and immune responses were assessed. Selected organs were harvested for histology, immunohistochemistry, and determination of bacterial load by real-time PCR and culture.
Histology and immunohistochemistry
Samples of liver, spleen, lung, and kidney were processed for histopathological examination as described previously (12). For immunohistochemistry, slides were incubated for 45 min at 37°C with canine anti-E. chaffeensis polyclonal Ab at dilution of 1/1000, which cross-reacts with E. muris and IOE Ags. Slides were then incubated for 30 min with a biotinylated goat anti-canine IgG (H+L) Ab used at a 1/800 dilution (Vector Laboratories, Burlingame, CA). The slides were then washed and incubated with avidin-HRP conjugate for 20 min at 37°C, followed by incubation with substrate containing 3-amino-9-ethylcarbazole for 8 min at 37°C (Vector Laboratories). Slides were counterstained with hematoxylin. Normal canine serum was used as a negative control.
Preparation of host cell-free Ehrlichia
E. muris was cultivated in P388D1 cells with 5% bovine calf serum-supplemented MEM at 37°C. Ehrlichiae were harvested when
90100% of the cells were infected, and cell-free ehrlichiae were prepared as previously described (21). The total protein concentration of the resulting bacterial preparations was determined using a bicinchoninic acid protein assay kit (Pierce, Rockford, IL) and was used as the Ag in ELISPOT assay and ELISA. The uninfected cell lysates were prepared similarly and used as a negative control (mock Ag). For preparation of host cell-free IOE Ag, IOE-infected spleens and livers were harvested from day 7 infected mice, and cell-free IOE Ags were prepared as previously described (21). Spleen and liver of naive mice were prepared as the E. muris-infected P388D1 cells and were used as a negative control in all experiments using cell-free IOE Ags (mock Ag).
ELISPOT assays for Ag-specific, cytokine-producing T cells
Single-cell suspensions were obtained from the spleen of control and infected mice. CD4+ and CD8+ T cells were isolated by negative selection using mouse CD4 or CD8 subset enrichment columns (R&D Systems, Minneapolis, MN), and the purity ranged from 8090% as determined by FACS analysis. Splenocytes and purified T cell subsets were assessed via ELISPOT for cytokine production, as described previously (22, 23, 24). Briefly, 96-well nitrocellulose plates (Millipore, Bedford, MA) were coated at 4°C overnight with mAbs (1.25 µg/ml; 100 µl/well) that are specific for murine IFN-
, IL-4, or TNF-
(BD PharMingen, San Diego, CA). Two-fold dilutions of spleen cells were added to wells starting at 106 to 2 x 105 cells/well in the presence of an additional 1 x 106 spleen cells from naive, unimmunized mice. The addition of normal spleen cells was necessary to ensure that the number of Ag-dependent spots observed was proportional to the number of immune spleen cells plated and that the response was linear. Immune spleen cells or purified T cells were stimulated with either the specific E. muris or IOE Ags at concentration of 10 µg/well or with nonspecific Ag such as SRBC. Spleen cells from EM/IOE-infected mice were stimulated with cell-free E. muris or IOE Ags. Positive and negative controls contained 5 µg/ml Con A or medium, respectively. After incubation at 37°C in 5% CO2 for 16 h, the plates were washed and incubated with 100 µl of the appropriate biotinylated secondary mAb (1.25 µg/ml; BD PharMingen) at 37°C for 2 h. The spots were developed by the addition of alkaline phosphatase-streptavidin (0.2 µg/ml; BD PharMingen), followed by the phosphatase substrate (buffer containing 0.1 M Tris, 0.1 M NaCl, 0.05 M MgCl2, 8.75 µg/ml nitro blue tetrazolium chloride, and 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate, toluidine in 67% (v/v) DMSO; Sigma-Aldrich, St. Louis, MO). The reaction was stopped by thorough washing with deionized water. The spots were counted under a dissecting microscope. In all experiments, Ag-specific spots were determined by subtraction of the background spots (spots detected in the Ag-negative wells) from spots detected in the Ag-positive wells.
Flow cytometry
Before staining, spleen cells were incubated with an anti-Fc III/II receptor (BD PharMingen, San Diego, CA) mAb and 10% normal mouse serum in PBS containing 0.1% BSA and 0.01% NaN3. The lymphocytes were identified by characteristic size (forward light scatter) and granularity (side light scatter) in combination with anti-CD4 or anti-CD8 (FITC conjugated; BD PharMingen) surface staining or FITC-conjugated isotype control rat IgG2a or IgG2b (BD PharMingen). For each sample, between 200,000 and 400,000 cells were analyzed. The data were collected and analyzed using a FACS flow cytometer (BD Biosciences, Mountain View, CA).
CD4+ T cell proliferation assay
Purified CD4+ T cells from individual mice in different groups were plated in triplicate at (1.5 x 106 cells/ml) together with irradiated APC (5 x 105) from syngeneic naive mice in 96-well plates and were stimulated with the relevant cell-free E. muris or IOE Ags. The cultures were incubated for 72 h at 37°C in 5% CO2 and then pulsed with 50 µCi/ml [3H]thymidine for 16 h. CD4+ T cells from IOE- or EM/IOE-infected mice were stimulated with cell-free E. muris, IOE Ags, or Con A. Control cultures excluded either Ag or APC, or cells were stimulated with 5 µg/ml Con A. Plates were harvested, and the incorporation of [3H]thymidine was measured using liquid scintillation spectroscopy (25).
Peritoneal macrophages and in vitro stimulation
For in vitro stimulation, peritoneal exudate cells were used. To obtain peritoneal exudate cells, mice were injected with 1 ml of 10% thioglycolate (Difco Laboratories, Detroit, MI) i.p., and peritoneal lavage was performed with 10 ml of ice-cold PBS 18 h later. Macrophages were isolated by negative selection using mouse CD11b subset enrichment columns (R&D Systems, Minneapolis, MN), and the purity ranged from 8590%, as determined by FACS analysis. Purified macrophages were stimulated with medium or IOE or E. muris Ags for 6 and 24 h, and culture supernatants were examined for IL-12p40 production by ELISA as previously described (22).
Cytokine ELISA
Single-cell suspensions of spleens were cultured at 5 x 106 cells/ml in DMEM containing 10% FBS, 2 mM glutamine, 100 U/ml penicillin G sodium, 100 µg/ml streptomycin sulfate, and 5 x 10-5 M 2-ME in the presence or the absence of 50 µg/ml E. muris or IOE Ags (prepared as described above). Supernatants were collected at 72 h and assayed for IL-4, IL-10, IL-12p40, and IL-12p70 using a sandwich ELISA, as previously described (22). Standard curves were generated using recombinant mouse cytokines (BD PharMingen). The detection limits were 50 pg/ml for IL-4, 150 pg/ml for IL-10, and 122 pg/ml for IL-12p70. In some cases, sera were collected at different time points of infection and were assayed for IL-12p40 and TNF-
levels using an immunoassay kit (Quantikine; R&D Systems). The detection limit for TNF-
was 5 pg/ml.
Ehrlichial load determination by quantitative real-time PCR
The ehrlichial load in tissues was determined by real-time PCR (with SYBR Green) of the Ehrlichia dsb gene, which encodes a thio-disulfide oxireductase or disulphide bond formation protein of E. muris and IOE (GenBank accession no. AY236484 and AY26485). Primer sequences are as follow: IOE forward, GAATAGAAAATGAAGAAATGAG; IOE reverse, CAATAGCCACAAGAATAGTCAAAGA; E. muris forward, GAACAGAGGGGTCATTAAAAGCTGTTC; E. muris reverse, GATTCAACGCTGCATGGTAA; mouse GAPDH forward, CAACTACATGGTCTACATGTTC; and GAPDH reverse, CTCGCTCCTGGAAGATG. The substrate for amplification was DNA purified from frozen tissue samples using the DNeasy Tissue kit (Qiagen, Valencia, CA). Quantitative real-time PCR was performed using the iCycler from Bio-Rad (Hercules, CA) and SYBR Green iQ Supermix (Bio-Rad). The results were normalized to the levels of expression of the eukaryotic housekeeping gene GAPDH in the same sample and expressed as copy number per 104 GAPDH copies (standard curves for dsb and GAPDH with >94% efficiency and linear amplification across 1 to 106107 copies were used to obtain the copy number of the samples). PCR analyses were considered negative for ehrlichial DNA if the critical threshold (CT) values exceeded 40 cycles. Expression of the ehrlichial load in terms of the number of copies of GAPDH is a valid approach in this case, because ehrlichiae are obligately intracellular bacteria.
Adoptive transfer
T cells were isolated from the spleens of mice infected with E. muris (E. muris-specific T cells) or E. muris-primed mice rechallenged with a lethal dose of IOE (EM/IOE-specific T cells), respectively, on day 7 postinfection (p.i.) or rechallenge. The Th1/Th2 phenotype of transferred cells was determined by ELISPOT assay. CD4+ and/or CD8+ T cells were purified and adoptively transferred i.p. (107 each subset) into naive mice with or without mouse polyclonal serum anti-ehrlichial Abs. Serum polyclonal Ab was obtained from EM/IOE-infected mice on day 30 after rechallenge with IOE and diluted 1/5, and 1 ml was transferred i.p. to each mouse. The titer and isotype of the polyclonal Abs at this time point after infection, as determined by immunofluorescence assay and ELISA, were 1/8192 and IgG2a isotype, respectively. Control group mice were adoptively transferred i.p. with naive CD4+ and/or CD8+ T cells with or without 1 ml of normal mouse serum. One day later, mice were challenged i.p. with a high dose (10-2) of IOE. The course of infection and cytokine responses were assessed on day 7 after IOE challenge.
Immunofluorescence assay for detection of specific or cross-reactive Abs to E. muris Ags
Serum samples from infected and control mice were measured for Ehrlichia-specific IgG Abs by indirect immunofluorescence assay using E. muris as a surrogate or homologous Ag as previously described (12). A serial 2-fold dilution of serum samples was applied to the Ag slides. After incubation at 37°C for 30 min in a humid chamber, slides were stained with FITC-labeled anti-mouse IgG (Kirkegaard & Perry Laboratories, Gaithersburg, MD) at a dilution of 1/100. Slides were examined under a photofluorescent microscope (Nikon, Tokyo, Japan). Serological titers were expressed as the reciprocal of the highest dilution at which specific fluorescence was detected.
Quantitative ELISA to measure IgG subclasses
Quantitative ELISA was performed to measure the concentration of Ehrlichia-specific IgG subclass Abs as described previously (21). Briefly, the 96-well ELISA plates were coated with the purified E. muris or IOE Ags at a concentration of 25 ng/well using 50 mM sodium bicarbonate buffer, pH 9.6. Serum samples were diluted 1/50, and 100 µl of each sample was added to Ag-coated wells and incubated at 25°C for 2 h. HRP-conjugated goat anti-mouse IgG1 and IgG2a Abs were added at a dilution of 1/2000, and the color was developed using substrate 3,3',5,5'-tetramethylbenzidine (Cal-Biochem, San Diego, CA.). The color was measured using an ELISA plate reader at 450 nm. For determining the concentration of IgG subclasses, serial dilutions of purified mouse IgG1 or IgG2a were added to plates coated with goat anti-mouse Ig. Standard curve obtained by incubating standards with goat anti-mouse IgGs, and substrate was used to determine the concentration of each isotype. All assays including the serial dilution standards were performed in triplicate wells, and the average values were calculated for analysis.
Statistical analysis
For comparisons of the means of various groups, the pairwise t test was used.
| Results |
|---|
|
|
|---|
We compared the course of disease in mice infected with different doses of highly virulent IOE or mildly virulent E. muris. C57BL/6 mice given a high dose (10-2 dilution) of IOE developed progressive disease with weight loss and severe hypoglycemia (data not shown), and all died between days 8 and 10, presumably due to the lethal inflammatory multiorgan pathology previously reported (12) in this mouse model of fatal HME (Fig. 1A). When a lower dose (10-4 dilution) of IOE was given, mice showed no major signs of disease on day 7, but started to lose weight thereafter. All mice infected with low dose (10-4 dilution) IOE succumbed to infection and died between days 15 and 17. These two models were used to evaluate the host immune response associated with fatal ehrlichiosis caused by the highly virulent ehrlichial strain.
|
We then assessed whether an infection with E. muris could provide cross-protection against subsequent infection with a lethal dose of IOE. Four weeks after primary infection with high (10-1) or low (10-2 and 10-3) doses of E. muris, mice were challenged with the high dose of IOE. Control groups were injected with PBS and challenged with a high dose of IOE or a high dose (10-1 dilution) of E. muris. All mice primarily infected with a high dose of E. muris survived for >4 mo after lethal challenge with IOE. We used the term EM/IOE to refer to this cross-protected group. In contrast, survival was only prolonged in mice primarily infected with the lower doses of E. muris and then challenged with the high dose of IOE, where mice succumbed between days 16 and 20 p.i. (data not shown).
Histopathological examination of the liver on day 7 p.i. in mice infected with high dose IOE revealed abundant, partially confluent foci of necrosis of contiguous hepatocytes with regions of cellular infiltration (Fig. 2A). Apoptotic cells were observed diffusely throughout the liver, which is consistent with the presence of a large number of TUNEL-positive cells (12) (data not shown). Similarly, histopathological evaluation of the lung tissue from these mice revealed severe interstitial pneumonitis marked by infiltration of lymphohistiocytic cells throughout interstitial regions, necrosis, and the presence of inflammatory cell infiltration into interalveolar septa (Fig. 2B). The marginal zone of the spleen was prominent and consisted of activated, moderately enlarged lymphocytes and macrophages. The red pulp contained focal areas of moderately increased numbers of macrophages and plasma cells.
|
In contrast, histopathological examination of the liver in mice infected with a high dose of E. muris showed moderate focal accumulation of lymphocytes in the perisinusoidal and perivascular areas. The hepatocytes manifested no evidence of injury and were similar to hepatocytes in control animals. Most notably, mice infected with a high dose of E. muris developed well-defined granulomas on day 30 p.i. (time point at which these mice were rechallenged with a high dose IOE) in the liver, mainly adjacent to blood vessels (Fig. 2C) in foci of infiltrates containing plasma cells and lymphocytes.
Immunohistochemical staining of the liver revealed that mice infected with high dose IOE (Fig. 2D), low dose IOE (not shown), or high dose E. muris (Fig. 2E) showed similar distributions of morulae containing ehrlichiae. Morulae were located mostly in cells lining the sinusoidal spaces (Kupffer cells and/or endothelial cells) and in monocytes present in the vascular lumens. Ehrlichiae were seldom detected within hepatocytes, suggesting that the liver pathology was independent of direct hepatocellular infection. The relative bacterial burden on day 7 p.i., as judged by immunohistochemical examination, was not markedly different among these three groups (compare Fig. 2, D and E).
Evaluation of Ehrlichia infection in different groups of mice
We reasoned that the fatal infection with the IOE strain might be due to a greater ability to disseminate and/or replicate in vivo compared with the nonlethal E. muris. To examine this possibility, the number of bacterial genomes in different organs of mice infected with a high dose of IOE, a high dose of E. muris, or EM/IOE was determined on day 7 p.i./rechallenge using quantitative real-time PCR. IOE and E. muris organisms were equally capable of dissemination in vivo, with marked tropism to the spleen, liver, and lung (Fig. 1B).
On day 7 p.i., mice infected with high dose IOE had 2- to 3-fold more ehrlichiae in the lung and liver than E. muris-infected mice. In contrast, the concentrations of IOE and E. muris were comparable in the spleen of infected mice.
Interestingly, compared with naive mice infected with high dose IOE, cross-protected EM/IOE-infected mice were able to radically eliminate IOE from spleen, liver, and lung on day 7 after IOE challenge. Additionally, EM/IOE-infected mice harbored fewer E. muris organisms in all organs than naive mice infected with E. muris only on day 37 p.i. (Fig. 1B). Ehrlichiae were detected in spleen cell cultures from E. muris-infected mice through day 37 p.i. (Table I). In contrast, Ehrlichia were not cultured from the spleens of EM/IOE-infected mice at any time point after IOE challenge (Table I). These data are consistent with our demonstration by real-time PCR that the spleens of EM/IOE-infected mice contained fewer E. muris than were present in the spleens of naive mice infected with E. muris on day 37 p.i. (Fig. 1B). The EM/IOE model was used subsequently to define the immunological parameters associated with cross-protection against monocytotropic Ehrlichia spp.
|
in IOE-induced toxic shock-like syndrome
The systemic pathology during lethal IOE infection suggested that tissue damage might be a consequence of overinduction of proinflammatory cytokines (26). To determine whether infection with high doses of IOE induce greater systemic levels of TNF-
than nonlethal ehrlichial infections, serum levels of TNF-
were determined at different time points during acute infection. An extremely high serum level (
900 pg/ml) of TNF-
was detected on day 7 p.i. in mice infected with high dose IOE (Fig. 3A). During infection with the lower dose of IOE, serum TNF-
levels were only moderately increased on day 7 (Fig. 3A). However, 2 days before death, TNF-
was elevated to similar levels during both high and low dose infections. In contrast, serum levels of TNF-
in naive mice infected with E. muris or EM/IOE were not significantly different from those in uninfected mice.
|
is produced by IOE-specific CD4 or CD8+ T cells, as type 1 cells would be the major source of TNF-
at later stages of infection. TNF-
-producing, Ehrlichia-specific total splenocytes and purified CD4+ or CD8+ T cells after in vitro Ag stimulation were quantified using an ELISPOT assay. The absolute total number of IOE-specific, TNF-
-producing cells in the spleen of naive mice infected with high dose IOE was significantly higher than that of E. muris or IOE-specific, TNF-
-producing cells in naive mice infected with E. muris or in E. muris-primed mice rechallenged with IOE (EM/IOE; 5.7 x 104, compared with 4.4 x 103 and 7.2 x 103), respectively (Fig. 3B). Unstimulated spleen cells did not produce TNF-
. More intriguing, IOE-specific CD8+ T cells comprised
60% of the TNF-
-producing cells, whereas no significant production of TNF-
was derived from IOE-specific CD4+ T cells (Fig. 3B).
The high serum level of TNF-
induced during lethal IOE infection could have been due to inadequate stimulation of down-regulatory cytokines such as IL-10. Therefore, we determined whether lethal IOE infections induced similar levels of IL-10 compared with nonlethal E. muris infection. Lethal infection with high dose IOE induced IL-10 to an extent not significantly different from that induced by E. muris infection (Fig. 3C).
Ag-specific CD4+ T cell responses are impaired in susceptible C57BL/6 mice infected with a high dose of IOE
The studies described above revealed diverse outcomes of disease in mice infected with different doses and combinations of IOE and E. muris and the relative contributions of TNF-
and CD8+ T cells in these infections. To further analyze the roles of CD4+ and CD8+ T cells and their cytokines in these infections, we first examined the expansion of CD4+ and CD8+ cells quantitatively by FACS. The expansion of total spleen cells (not shown) as well as CD4+ and CD8+ T cells (Fig. 4A) in the spleens of E. muris- or EM/IOE-infected mice was significantly higher than that after infection with high dose IOE. Interestingly, prolonged survival of mice infected with low dose IOE was associated with significantly higher expansion of CD4+, but not CD8+, T cells on day 7 p.i. compared with that in mice infected with high dose IOE (p < 0.005).
|
Down-regulation of type 1 response is associated with susceptibility to IOE infection
To determine whether the Th1/Th2 cytokine profile predicts the resistance or susceptibility of a host to infection with monocytotropic ehrlichiae, we quantified the number of Ehrlichia-specific, IFN-
- and IL-4-producing cells in the spleen of different mice groups using ELISPOT assay. On day 7, splenocytes from mice resistant to infection with high dose E. muris or cross-protected EM/IOE-infected mice contained substantially higher numbers of Ehrlichia-specific, IFN-
-producing cells than mice susceptible to infection with either a high or a low dose of IOE (Fig. 5A). A substantial number of IFN-
-producing spleen cells was detected when splenocytes from all mouse groups, including IOE-infected mice, were stimulated with Con A in the ELISPOT assay (not shown). All groups contained negligible numbers of IOE-specific, IL-4-producing cells by ELISPOT assay (Fig. 5A), and we did not detect significant IL-4 production in the culture supernatant of splenocytes from any infected group by ELISA (data not shown).
|
-producing T cells per spleen in different mouse groups (Fig. 5B). On day 7 p.i., E. muris-infected mice had
7- and 3-fold more Ag-specific IFN-
-producing cells (3 x 105/spleen) than mice infected with either high or low dose IOE (4.7 x 104 and 1.0 x 105/spleen, respectively; Fig. 5B). On day 14 p.i. with low dose IOE, the total number of IFN-
-producing cells in the spleen had decreased to 3.6 ± 2 x 104 cells (data not shown). This significant decrease in the number of IFN-
-producing cells was concomitantly associated with an increase in serum TNF-
on day 14 (Fig. 3A) and a decrease in survival. Similarly, cross-protection of EM/IOE-infected mice against lethal IOE rechallenge was associated with substantial expansion of IOE- and E. muris-specific, IFN-
-producing cells (Fig. 5A). Significant production of Ag-specific IFN-
by immune spleen cells derived from EM/IOE-infected mice on day 7 after IOE rechallenge was detected by ELISPOT assay in the presence of E. muris or IOE Ags, but not in the absence of specific ehrlichial Ags or in the presence of unrelated Ag such as SRBC (data not shown). These data suggest that cross-protection of E. muris-primed mice against lethal IOE challenge is mediated by an Ag-specific response. IFN-
-producing cells were not detected in the spleen of naive mice stimulated in vitro with either E. muris or IOE. Together, these data suggest that a strong type 1 response is associated with resistance to disease caused by ehrlichiae, whereas a weak type 1 response, but not a Th2 response, is associated with susceptibility to severe ehrlichiosis. CD4+ and CD8+ T cell responses to infection with different ehrlichial strains
To further analyze the contributions of both CD4+ and CD8+ T cell responses to resistance or susceptibility to these pathogens, splenic CD4+ and CD8+ T cells were isolated on day 7 and assessed for Ag-specific IFN-
production by ELISPOT assay. Approximately 9% of IFN-
-producing cells in the spleens of mice infected with a high dose of IOE were IOE-specific, CD4+ T cells (Fig. 6A), whereas 94% of IFN-
-producing cells in the spleens of E. muris-infected mice were E. muris-specific, CD4+ T cells (Fig. 6B). Infection of naive mice with high dose IOE was associated with a 40-fold lower number of IFN-
-producing CD4+ T cells per spleen (2.7 x 105 compared with 6.8 x 103/spleen). In contrast, IOE rechallenge of E. muris-primed mice (EM/IOE) resulted in a high frequency of IOE-specific, IFN-
-producing CD4+ T cells (Fig. 6D).
|
production by purified CD8+ T cells showed that 88% of IFN-
-producing cells in the spleens of mice infected with high dose IOE are IOE-specific CD8+ T cells (Fig. 6A), whereas only 6% of IFN-
-producing cells in the spleens of E. muris-infected mice are E. muris-specific CD8+ T cells (Fig. 6B). Compared with nonlethal infection with E. muris, infection with high dose IOE was associated with a 2-fold greater total number of IFN-
-producing CD8+ T cells per spleen (2.6 x 104 compared with 4.2 x 104/spleen). Moreover, mice infected with low dose IOE contained a substantial number of IOE-specific, IFN-
-producing CD4+ T cells on day 7 p.i (8.5 x 104/spleen, 82% of total IFN-
-producing cells/spleen; Fig. 6C). However, on day 14 p.i. (23 days before the death of the animals), the number of IFN-
-producing CD4+ T cells in the low dose IOE-infected mice declined dramatically (5.6 x 103/spleen and 18% of total IFN-
-producing cells/spleen; Fig. 6C) and was accompanied by significant increase in the total number of Ag-specific, IFN-
-producing CD8+ type-1 cells (78% of total IFN-
-producing cells/spleen) and very high serum level of TNF-
(Fig. 3A). The total number of IOE-specific, IFN-
producing CD8 T cells per spleen in these mice was 2.9 x 104 on day 7 p.i., which increased to 5.3 x 104/spleen on day 14 p.i. No significant production of IFN-
by macrophages was observed in any group of infected mice (data not shown). Weak Th1 response and IOE lethality are associated with low IL-12 production in IOE-infected mice
As the development of a protective IFN-
Th1 response after infection with several intracellular pathogens is dependent on IL-12 production (27, 28), we asked whether high and low virulence ehrlichial strains differ in their IL-12-inducing capability. IOE (high virulence) or E. muris (low virulence) Ags were used to stimulate 18-h thioglycolate-elicited peritoneal macrophages in vitro. As shown in Fig. 7A, the high virulence IOE strain produced a significantly lower level of IL-12p40 in culture supernatant collected 6 and 24 h after culture (data not shown) than that produced by low virulence E. muris. A minimal amount of IL-12p40 (360 pg/ml) was produced in supernatants from macrophages cultured with medium alone.
|
Interestingly, in vivo the serum IL-12p40 response on day 7 p.i. after i.p. infection with IOE was significantly lower than that detected in the serum of mice infected i.p. with E. muris or LPS (LPS stimulation, 118 ± 1.8 ng/ml; E. muris infection, 106 ± 8.4 ng/ml; IOE infection, 28 ± 6.6 ng/ml). Taken together, these results suggested that the defective development of Ag-specific, IFN-
-producing CD4+ Th1 cells in IOE-infected mice could be due to a deficiency in IL-12 production.
Substantial production of Ehrlichia-specific IgG2a is associated with cross-protection against a lethal dose of IOE in EM/IOE-infected mice
To determine the role of Abs in the control of Ehrlichia infection, we examined the titer and isotypes of serum anti-Ehrlichia Abs in all infected groups of mice. Primary infection with either nonlethal E. muris or lethal IOE induced a high Ag-specific IgM titer by day 7 p.i., which declined in E. muris-infected mice on day 14 and was undetectable by day 30 (Table II). The E. muris-specific IgG response appeared on day 30 and had increased on day 60. All the EM/IOE-infected mice developed a very high titer (1/4096) of Ehrlichia-specific IgG on day 7 after IOE challenge. The level of IgG Abs increased further thereafter. Analysis of the IgG isotype response showed that EM/IOE-infected mice have a high level of Ehrlichia-specific IgG2a and a low level of Ehrlichia-specific IgG1 on days 7, 14, 30, and 60 after challenge with IOE (Fig. 7C).
|
To further determine what components of the immune response induced during ehrlichial infection contribute to protection against lethal IOE infection, we adoptively transferred Ehrlichia-specific, IFN-
-producing, CD4+ or CD8+ type 1 cells derived from either E. muris (E. muris-specific) or EM/IOE-infected mice (EM/IOE-specific) with or without polyclonal anti-Ehrlichia serum. Control mice were transferred with naive CD4+ cells, CD8+ T cells, and/or normal mouse serum. Recipients of Ehrlichia-specific CD4+ or CD8+ T cells isolated from day 7 E. muris or EM/IOE-infected donors (data not shown) or naive CD4+ and CD8+ T cells plus polyclonal anti-Ehrlichia Abs (group II) succumbed to infection (Fig. 8A). All these groups of mice mounted a weak type-I response, which was indistinguishable from that induced in control mice that received either PBS (group I; Fig. 8B), or naive CD4 and CD8+ T cells and normal serum (data not shown). Transfer of E. muris-specific CD4+ and CD8+ T cells without (group III) or with (group IV) polyclonal serum or EM/IOE-specific CD4+ and CD8+ T cells without polyclonal serum (group V) resulted in the generation of a significantly higher number (p < 0.005) of IFN-
-producing splenic Th1 cells compared with that in controls (Fig. 8B). Although these mice survived longer than controls, they succumbed to infection at later time points (Fig. 8A). In contrast, mice that received both EM/IOE-specific CD4+ and CD8+ T cells isolated from EM/IOE-infected donors with anti-Ehrlichia polyclonal Abs (group VI) 1 day before infection generated a significantly higher number (p < 0.001) of IFN-
-producing cells than mice transferred with EM/IOE-specific CD4 and CD8 T cells only (group V; p < 0.005; Fig. 8B) and survived until day 30 p.i. (Fig. 8A). The previous group of mice (group VI) also developed a high titer of anti-Ehrlichia IgM Abs at early time points after infection, which was followed by an increasing titer of anti-Ehrlichia IgG on day 14 (Table II). These results suggest that both EM/IOE-specific CD4+ and CD8+ T cells and EM/IOE-specific Abs provide effective components for the protective responses.
|
| Discussion |
|---|
|
|
|---|
-producing Th1 cells are strongly associated with susceptibility to fatal disease. Mice infected with a high dose of nonlethal E. muris produced a 75-fold greater number of total Ag-specific, IFN-
-producing CD4+ T cells than mice infected with a high dose of lethal IOE. Therefore, the contribution of CD4 T cells to IFN-
production was dramatically decreased in IOE-infected mice. IL-12 production by macrophages, which is characteristic of a Th1 response (27), was also deficient on days 3 and 7 p.i. in IOE-infected mice. The fact that mice infected with high dose IOE succumbed to infection despite production of IFN-
by CD8+ T cells suggests that IFN-
production must come from CD4 T cells to be effective, and that IFN-
production by CD8 T cells is insufficient to control the infection.
Second, overproduction of TNF-
by Ag-specific splenic CD8+ T cells and very high levels of serum TNF-
are strongly associated with severe and fatal disease. After primary infection, E. muris and IOE did not differ substantially in their ability to disseminate in vivo or to reach similar tissues (Fig. 1B). Therefore, the ability of IOE to cause lethal infections in mice was not due merely to the direct effects of the bacteria. These data are consistent with previous studies showing a disparity between ehrlichial quantity and the severity of disease in immunocompetent patients infected with E. chaffeensis (2, 3). However, a key property of the IOE Ehrlichia infection is the dramatic increase in serum TNF-
levels and the number of Ag-specific, TNF-
-producing CD8 T cells in the spleen after high or low dose challenge.
Minimal production of TNF-
by CD8 T cells in mice infected only with nonlethal E. muris or cross-protected EM/IOE mice was associated with mild disease and long term survival, further substantiating the contribution of TNF-
production by CD8 T cells to disease pathogenesis (29, 30, 31, 32). In support of our results, a previous study showed that CD8+ T cell knockout mice were less susceptible than wild-type or CD4+ T cell knockout mice to infection with Ehrlichia ruminantum (another tick-transmitted Ehrlichia strain that is very closely related to other monocytotropic Ehrlichia, including IOE). In this study 50% of the CD8+ T cell knockout mice survived infection, whereas the other half died after a prolonged period (33).
Decreased TNF-
production in EM/IOE cross-protected mice could be attributed to efficient containment of IOE at early stages of infection by an existing immune response against cross-reactive E. muris Ags. The efficient decrease in bacterial burden in EM/IOE-infected mice at an early time point after infection may account for the substantial generation of IOE-specific, IFN-
-producing CD4+ Th1 cells (Fig. 6D). Efficient generation of CD4+ Th1 lymphocytes may play a regulatory role in controlling the generation of Ag-specific TNF-
-producing CD8+ T cells.
The elevated levels of systemic TNF-
preceding death together with weight loss and hypoglycemia in lethal ehrlichiosis in IOE-infected mice resemble toxic shock-like syndrome caused by infections with Gram-negative bacterial pathogens. Although genetic and molecular characterization of E. muris and IOE has shown that these strains are very closely related (13, 14, 15, 16, 17), the basis for the dramatic difference in virulence between IOE and E. muris is presently unknown. Ehrlichia spp. differ from these prototypical Gram-negative bacterial pathogens in the absence of LPS (34, 35). Nevertheless, the massive inflammatory response that occurs during IOE infections could be due to host responses to a substance produced by the organism, analogous to the inflammatory response generated by bacterial LPS (yet clearly distinct) (36, 37), or uncontrolled induction and production of TNF-
-producing CD8+ T cells.
Our data exclude the possibility that overproduction of TNF-
is due to a strong/uncontrolled CD4+ Th1 response (38), because the level of IL-12 in serum and spleen and the number of IFN-
producing CD4+ Th1 cells were lower in IOE-infected mice than in E. muris-infected mice. The finding that mice infected with high dose IOE have very high serum levels of TNF-
, but low IL-12 levels may in part be explained by the inhibitory effect of TNF-
on IL-12 production (39). Although lethal IOE infection was not associated with significant decrease in IL-10 production compared with that produced by E. muris-infected mice (Fig. 3C), one cannot exclude the possibility that the level of IL-10 in IOE-infected mice may be inadequate to down-regulate the pathological overproduction of TNF-
(40, 41).
This study shows that a weak CD4+ Th1 response is associated with susceptibility to infection after infection with high dose IOE. As mice infected with a low dose of lethal IOE contained a substantially higher number of IFN-
-producing CD4+ T cells in the spleen on day 7 p.i. than the high dose IOE recipients, and these IFN-
-producing CD4+ cells dramatically diminished on day 14 p.i. (2 days before death), we hypothesize that the presence of the lower number of IFN-
-producing CD4+ T cells in the spleen of mice infected with high dose IOE on day 7 p.i. might be due to apoptotic cell death of the splenic CD4+ Th1 cells after infection with high dose IOE. In support of this conclusion, we have demonstrated previously that the splenic pathology in mice infected with a high dose of IOE was associated with extensive apoptosis, as detected by the TUNEL assay (12).
The synthesis of IL-12 and IFN-
is often coordinately regulated, a finding that may relate to the ability of IFN-
to enhance IL-12 production and vice versa (42). Our data suggest that the weak CD4+ Th1 response after lethal IOE challenge could be due to an early decrease in IL-12 production. As shown in Fig. 7, B and C, infection of C57BL/6 mice with high dose IOE results in inefficient stimulation of IL-12p40 and IL-12p70 in vivo. Moreover, thioglycolate-elicited macrophages were impaired in their ability to produce IL-12 upon in vitro stimulation with IOE Ags compared with stimulation with E. muris Ags (Fig. 7A). As the host target cells for monocytotropic ehrlichiae, including IOE and E. muris, are macrophages and monocytes, our data suggest that decreased IL-12 production by IOE-infected macrophages in vivo could be responsible for inefficient generation of IFN-
-producing CD4+ Th1 cells. Nevertheless, on day 7 p.i., spleen cells from susceptible IOE-infected mice synthesized less IL-12p40 and IL-12p70 than cells from resistant E. muris-infected mice. The latter observation could be due to weak IFN-
production by CD4+ Th1 cells, where IFN-
plays an important role in enhancing the induction of IL-12 during infection with some intracellular pathogens (42).
CD4+ T cells have been believed to be important in protection against other infections, such as Mycobacterium tuberculosis (42), Plasmodium spp. (43), and Toxoplasma gondii (44). Ehrlichiae are obligately intracellular pathogens that replicate within host macrophages. Therefore, macrophages activated by IFN-
-producing CD4 T cells are essential for limiting ehrlichial infection. In support of this conclusion, the presence of granulomas in the liver (Fig. 2C) of EM/IOE-infected mice was associated with substantial elimination of both IOE and E. muris organisms from tissues (Fig. 1B). Macrophages activated by IFN-
produce reactive nitrogen intermediates and kill intracellular pathogens (45, 46, 47). In vitro studies also suggest that IFN-
-mediated activation of human macrophages controls Ehrlichia by limiting available cytoplasmic iron (48, 49). Therefore, an obvious conclusion from our studies is that the primary role of CD4+ T cells in protection against ehrlichiosis is early production of IFN-
. However, it is likely that early IFN-
production is not the only role for CD4 T cells in protection against ehrlichiosis.
The effect of CD4+ T cells on CD8+ T cell development and function must also be taken into account. One role for CD4+ T cells in eliciting an effective and protective CD8+ T cell response is the production of IL-2 (50). Additionally, CD4+ T cells help priming of effective cytotoxic CD8+ T cells. Several studies have classified the CD8+ response to acute infections with intracellular pathogens such as M. tuberculosis (42), T. gondii (44), and Plasmodium spp. (43) as CD4+ helper-dependent. CD4+ T cells are required to activate APCs through CD40 signaling, licensing the APC to stimulate a full-blown CD8 response. In contrast, other infectious agents, such as the intracellular Gram-positive pathogen Listeria monocytogenes, which carries a plethora of immunostimulatory signals (such as cell wall components, flagellin, and CpG DNA), activate APCs directly, thereby bypassing the need for CD4 help (51, 52). Taken together, one can envisage that if CD4+ Th1 cell differentiation were impaired early in the response as a result of several factors such as cytokine environment, costimulatory signals from APCs, the amount of Ag, and the affinity of the epitope-TCR interactions (53), this could subsequently affect the induction of effective CD8+ CTL by dendritic cells or other APCs. This situation might explain the failure of mice infected with high dose IOE to control infection despite significant generation of IFN-
-producing CD8+ T cells.
The generation of a strong CD4+ Th1 cell response in the presence of few IFN-
-producing CD8+ T cells in mice infected with E. muris suggests that the CD4+ T cells themselves are sufficient to contain infection with the less virulent Ehrlichia spp. In contrast, our adoptive transfer experiments and protection of E. muris-primed animals against lethal rechallenge with IOE suggest that both CD4+ and CD8+ type 1 cells producing high levels of IFN-
, but not TNF-
, contribute to protection against lethal ehrlichiosis caused by IOE. These observations led us to hypothesize that the absence of a strong CD4+ Th1 response could result in not only inefficient control of lethal IOE infection, but also failure in controlling the induction of pathogenic TNF-
-producing CD8+ T cells.
Role of Ab response against infection with an obligatory intracellular pathogen
It is usually thought that Abs play a minor role in host defense against obligately intracellular pathogens because their lifestyle renders them generally inaccessible to Abs. However, our data show that complete protection of E. muris-primed mice against lethal challenge with high dose IOE is positively associated with production of substantially high levels of Ehrlichia-specific Th1 isotype (IgG2a) Abs at all time points after infection. Furthermore, in these experiments adoptive transfer of E. muris-specific Abs together with IFN-
-producing CD4+ and CD8+ T cells, but not alone, significantly increased the survival of naive mice challenged with high dose IOE (Table II). The mechanism by which IgG2a mediates protection is most likely via FcR-enhanced opsonization (54), because the generation of a substantial Ag-specific IgM response in IOE-infected mice, which is an effective component of complement-mediated lysis, was not protective. These data are consistent with previous studies showing that anti-E. chaffeensis Abs confer a level of protective immunity in SCID mice (9, 55).
In summary, we have shown that susceptibility to severe ehrlichiosis is strongly correlated with two interrelated immunopathological factors: first, overproduction of TNF-
production by IOE-specific CD8+ T cells and a systemic TNF-
-mediated inflammatory response; and second, down-regulation of Ag-specific CD4 T cell proliferation and Th1 differentiation. More important, an IFN-
, but not TNF-
-producing, CD4 and CD8 type 1 response and a Th1-Ab response are critical for protection against rechallenge with the lethal ehrlichial strain. The ability to induce cross-protective immunity against heterogeneous ehrlichial strains might be useful as a vaccine strategy for the control of Ehrlichia infection in humans and animals.
Our data strongly indicate that CD4 and CD8 T cells are performing at least some different functions during ehrlichial infection, and studies to further define these functions are essential to our understanding of this disease and the most effective means for vaccination. A better understanding of why IOE and E. muris infections trigger totally different types of responses in the same host and how these divergent responses are regulated would lead to more efficient control of the infection and treatment of severely infected patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David H. Walker, Department of Pathology, Center for Biodefense and Emerging Infectious Diseases, 301 University Boulevard, Galveston, TX 77555-0609. E-mail address: dwalker{at}utmb.edu ![]()
3 Abbreviations used in this paper: HME, human monocytotropic ehrlichiosis; EM/IOE, mice primed with high dose E. muris and rechallenged with high dose IOE; IOE, Ixodes ovatus Ehrlichia; MOI, multiplicity of infection; OMP, outer membrane protein; p.i., postinfection. ![]()
Received for publication October 24, 2003. Accepted for publication November 18, 2003.
| References |
|---|
|
|
|---|
-producing T cells. J. Immunol. Methods 227:99.[Medline]
requires transcriptional arrest. J. Immunol. 153:1778.[Abstract]
and early death in C57BL/6 mice. J. Immunol. 163:2089.
induced interleukin 12 production: a potential mechanism for the anti-inflammatory activities of tumor necrosis factor. Proc. Natl. Acad. Sci. USA 95:13806.
and TNF-
. J. Immunol. 157:798.[Abstract]
interferon and tumor necrosis factor
in mice with Rickettsia conorii-infected endothelium: impairment of rickettsicidal nitric oxide production resulting in fatal, overwhelming rickettsial disease. Infect. Immun. 62:1952.
interferon-induced inhibition of Ehrlichia chaffeensis infection in human monocytes with iron-transferrin. Infect. Immun. 62:4804.This article has been cited by other articles:
![]() |
K. Miura and Y. Rikihisa Liver Transcriptome Profiles Associated with Strain-Specific Ehrlichia chaffeensis-Induced Hepatitis in SCID Mice Infect. Immun., January 1, 2009; 77(1): 245 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, M. Lin, X. Wang, T. Kikuchi, H. Mottaz, A. Norbeck, and Y. Rikihisa Proteomic Analysis of and Immune Responses to Ehrlichia chaffeensis Lipoproteins Infect. Immun., August 1, 2008; 76(8): 3405 - 3414. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Racine, M. Chatterjee, and G. M. Winslow CD11c Expression Identifies a Population of Extrafollicular Antigen-Specific Splenic Plasmablasts Responsible for CD4 T-Independent Antibody Responses during Intracellular Bacterial Infection J. Immunol., July 15, 2008; 181(2): 1375 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Thirumalapura, H. L. Stevenson, D. H. Walker, and N. Ismail Protective Heterologous Immunity against Fatal Ehrlichiosis and Lack of Protection following Homologous Challenge Infect. Immun., May 1, 2008; 76(5): 1920 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Stevenson, E. C. Crossley, N. Thirumalapura, D. H. Walker, and N. Ismail Regulatory Roles of CD1d-Restricted NKT Cells in the Induction of Toxic Shock-Like Syndrome in an Animal Model of Fatal Ehrlichiosis Infect. Immun., April 1, 2008; 76(4): 1434 - 1444. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nandi, K. Hogle, N. Vitko, and G. M. Winslow CD4 T-Cell Epitopes Associated with Protective Immunity Induced following Vaccination of Mice with an Ehrlichial Variable Outer Membrane Protein Infect. Immun., November 1, 2007; 75(11): 5453 - 5459. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bitsaktsis, B. Nandi, R. Racine, K. C. MacNamara, and G. Winslow T-Cell-Independent Humoral Immunity Is Sufficient for Protection against Fatal Intracellular Ehrlichia Infection Infect. Immun., October 1, 2007; 75(10): 4933 - 4941. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ismail, E. C. Crossley, H. L. Stevenson, and D. H. Walker Relative Importance of T-Cell Subsets in Monocytotropic Ehrlichiosis: a Novel Effector Mechanism Involved in Ehrlichia-Induced Immunopathology in Murine Ehrlichiosis Infect. Immun., September 1, 2007; 75(9): 4608 - 4620. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Ganta, C. Cheng, E. C. Miller, B. L. McGuire, L. Peddireddi, K. R. Sirigireddy, and S. K. Chapes Differential Clearance and Immune Responses to Tick Cell-Derived versus Macrophage Culture-Derived Ehrlichia chaffeensis in Mice Infect. Immun., January 1, 2007; 75(1): 135 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bitsaktsis and G. Winslow Fatal Recall Responses Mediated by CD8 T cells during Intracellular Bacterial Challenge Infection J. Immunol., October 1, 2006; 177(7): 4644 - 4651. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Stevenson, J. M. Jordan, Z. Peerwani, H.-Q. Wang, D. H. Walker, and N. Ismail An Intradermal Environment Promotes a Protective Type-1 Response against Lethal Systemic Monocytotropic Ehrlichial Infection. Infect. Immun., August 1, 2006; 74(8): 4856 - 4864. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ismail, H. L. Stevenson, and D. H. Walker Role of Tumor Necrosis Factor Alpha (TNF-{alpha}) and Interleukin-10 in the Pathogenesis of Severe Murine Monocytotropic Ehrlichiosis: Increased Resistance of TNF Receptor p55- and p75-Deficient Mice to Fatal Ehrlichial Infection Infect. Immun., March 1, 2006; 74(3): 1846 - 1856. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Yager, C. Bitsaktsis, B. Nandi, J. W. McBride, and G. Winslow Essential Role for Humoral Immunity during Ehrlichia Infection in Immunocompetent Mice Infect. Immun., December 1, 2005; 73(12): 8009 - 8016. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Stone, K. Dierberg, G. Aram, and J. S. Dumler Human Monocytic Ehrlichiosis JAMA, November 10, 2004; 292(18): 2263 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Olano, G. Wen, H.-M. Feng, J. W. McBride, and D. H. Walker Histologic, Serologic, and Molecular Analysis of Persistent Ehrlichiosis in a Murine Model Am. J. Pathol., September 1, 2004; 165(3): 997 - 1006. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |