|
|
||||||||
B Interaction in Acute Allograft Rejection and CD40L-Independent Chronic Allograft Rejection1



* Institut National de la Santé et de la Recherche Médicale Unit 437, and Institut de Transplantation et de Recherche en Transplantation, Nantes, France;
Service dAnatomie Pathologique du Centre Hospitalier Régional Universitaire de Nantes, Nantes, France;
Plateforme de Microscopie Confocale et Imagerie de lIFR26, Faculté de Médecine, Nantes, France; and Departments of
Pathology and Laboratory Medicine and
¶ Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
B (RANK) which is mostly expressed on mature dendritic cells, during allogenic responses in vivo using a rodent heart allograft model. TRANCE mRNA was strongly up-regulated in acutely rejected allografts on days 4 and 5 posttransplantation whereas RANK was detected as early as day 1 but did not show further up-regulation during the first week. Immunofluoresence analyses of heart allografts showed that 80 and 100% of TRANCE and RANK-expressing cells were T cells and APCs, respectively. We show for the first time that short-term TRANCE blockade using a mouse RANKIg fusion molecule can significantly prolong heart allograft survival in both rat and mouse models. Similarly, rat heart allografts transduced with a RANKIg encoding recombinant adenovirus exhibited a significant prolongation of survival (14.3 vs 7.6 days, p < 0.0001). However, TRANCE blockade using RANKIg did not appear to inhibit allogeneic T and B cell priming humoral responses against RANKIg. Interestingly, TRANCE blockade induced strong up-regulation of CD40 ligand (CD40L) mRNA in allografts. Combined CD40L and TRANCE blockade resulted in significantly decreased chronic allograft rejection lesions as well as allogeneic humoral responses compared with CD40L blockade alone. We conclude that TRANCE-RANK interactions play an important role during acute allograft rejection and that CD40L-independent allogeneic immune responses can be, at least in part, dependent on the TRANCE pathway of costimulation. | Introduction |
|---|
|
|
|---|
are strongly up-regulated in allografts during acute rejection (1) and are likely to play a role in the effector mechanisms leading to graft destruction. More attention has been paid recently to the role of the CD40 pathway of costimulation during allograft rejection. It is now well established that the CD40 pathway is critical in the generation and the control of T-dependent immune responses (2). In rodent (3, 4) and primate (5, 6, 7, 8) models, anti-CD40 ligand (CD40L)5 mAbs prevent acute allograft rejection. However, whether CD40L blockade prevents chronic rejection is still a matter of debate. Despite its crucial role in most Th cell-mediated immune responses, some responses against pathogens such as the lymphocytic choriomeningitis virus (LCMV) or vesicular stomatitis viruses can develop in the absence of CD40 (2). This indicates that some pathogens can activate CD4+ T cells using a CD40L/CD40 independent pathway. Therefore, this also suggests that some acute or chronic alloimmune responses may be CD40-independent in vivo.
TNF-related activation induced cytokine (TRANCE), also known as receptor-activating NF-
B ligand (RANK) ligand, osteoprotegrin ligand, osteoclast differentiation factor, or TNFSF11, is a recently described member of the TNF superfamily of proteins that has emerged as a key regulator of the immune system and of bone development and homeostasis (9, 10). TRANCE, expressed by osteoblast and stromal cells, is necessary and sufficient to induce osteoclast differentiation and activation (11, 12). The activity of TRANCE can be inhibited by the soluble decoy receptor osteoprotegerin that is also produced by osteoblast and stromal cells (13). Moreover, osteoprotegerin can be neutralized by TRAIL, suggesting that TRANCE is part of a complex network that regulates a diverse set of functions (9). In the immune system, TRANCE is expressed by activated CD4+ and CD8+ T cells, with the highest level of expression on CD4+ T cells (14). TRANCE mediates its effects via the TRANCE receptor, also known as RANK or TNFRSF11a. Although RANK mRNA is widely expressed, the distribution of RANK protein appears restricted to dendritic cells (DC) (5), activated T and B cells, osteoclasts, and osteoclast lineage cells (14, 15, 16, 17). High levels of RANK are found on mature DC (15), while low levels of expression are found on activated T and B cells (14). In mice, RANK is expressed by myeloid DC, but is absent, or present at lower levels on lymphoid DC (our unpublished observations).
TRANCE has two major effects on mature DC: 1) it promotes their survival, probably by up-regulating the expression of anti-apoptotic molecules such as BcL-xL (15); 2) it induces the production of multiple cytokines in mature DC such as the proinflammatory cytokines IL-1 and IL-6 and also two cytokines involved in T cell activation and differentiation, IL-12 and IL-15 (14). Therefore, during a productive T cell/DC interaction, TRANCE probably provides survival and regulatory cytokine signals to the DC to amplify its T cell stimulatory capacity. Indeed, we have shown that, in vivo, TRANCE enhanced primary and secondary Ag-specific immune responses induced by S/C injection of mature DC pulsed with a soluble Ag (18). Moreover, following LCMV or vesicular stomatitis virus infection in mice and in the absence of the CD40L/CD40 pathway, the immune system can use the TRANCE/RANK pathway to activate CD4+ T cells (19). Finally, TRANCE-deficient mice lack all lymph nodes but have normal spleen structure and Peyers patches (20, 21) and although their DC appear normal, these mice exhibit defects in their early differentiation of T and B lymphocytes (20).
We hypothesized that the TRANCE pathway might be involved in allogeneic immune responses in vivo. We therefore studied the expression of TRANCE and RANK during acute allograft rejection and assessed the effect of TRANCE blockade on acute and chronic allograft rejection in heart allograft models.
| Materials and Methods |
|---|
|
|
|---|
Rat model. Eight- to 12-wk-old male Lewis.1W (LEW.1W, haplotype RT1u) and Lewis.1A (LEW. 1A, haplotype RT1a) congeneic rats, obtained from the Centre dElevage Janvier (Le Genest-Saint-Isle, France), differed in their entire MHC region. Heterotopic LEW.1W heart transplantation into LEW.1A recipients was performed using Ono and Lindseys technique (22) and graft function was evaluated daily by palpation through the abdominal wall. All sentinel rats housed in the same colony were pathogen-specific free.
Mouse model. C57BL/6 mice received vascularized cardiac allografts from BALB/c mice. Donor specific splenocyte transfusion (DST) consisted in 5 x 106 spleen cells given i.v. on the day of transplantation. Fusion proteins/Abs were given at doses of 0.2 mg on days 0, 2, and 4.
Reagents
The RANKIg fusion molecule, made up of the extracellular part of murine RANK and the Fc portion of human IgG1 has been previously described (14, 15). RANKIg specifically binds to murine TRANCE, but not to other known members of the TNF superfamily (14). In control experiments, we found that RANKIg could bind rat TRANCE-tranfected but not untransfected 293T cells as well as activated rat CD4+ T cells (data not shown). RANKIg cDNA was subcloned into a pMT vector (Invitrogen, Carlsbad, CA) and was used to transfect S2 cells. Control human IgG1 was purchased from Sigma-Aldrich (St. Louis, MO). The rat anti-murine RANK mAb (clone 1E6) has been produced in our laboratory and described previously (21). Polyclonal goat anti-murine RANK and TRANCE Abs were purchased from R&D Systems (Minneapolis, MN). Anti-rat TCR
(clone R7/3), MHC class II monomorphic (clone OX6), and CD68 (clone ED1) producing hybridomas were obtained from the European Cell Culture Collection (Porton Down, U.K.). Abs were purified from supernatants and conjugated to FITC (Bioatlantic, Nantes, France). Streptavidin-Alexa 568 was purchased from Molecular Probes (Eugene, OR).
Quantitative RT-PCR
Total RNA was purified on a cesium chloride gradient (23) and reverse transcribed into cDNA as previously described (24). Real-time quantitative PCR was performed in an Applied Biosystems GenAmp 7700 Sequence Detection System using SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, CA). The following oligonucleotides were used in this study: rat TRANCE forward: CAGCATCGCTCTGTTCCTGTA; rat TRANCE reverse: GCAAACCTGTATTTTCACGGAG; rat CD40L forward: CAGATGATTGGGTCGGTGC; rat CD40L reverse: CACTGAAGAACAGATGCTGCATT; rat RANK forward: TCTCAGATGTCTTTTCGTCAACAG; rat RANK reverse: AGCCACCACTACCACAGAGATG; rat hypoxanthine phosphoribosyl transferase (HPRT) (5) forward: GCGAAAGTGGAAAAGCCAAGT; rat HPRT reverse: GCCACATCAACAGGACTCTTGTAG. A constant amount of cDNA corresponding to the reverse transcription of 100 ng of total RNA was amplified in 25 µl of PCR mix containing 300 nM of each primer; 200 µM dATP, dGTP, dCTP; 400 µM dUTP; 3 mM MgCl2; 0.25 U of uracyl-N-glycosylase; 0.625 U of AmpliTaq Gold DNA polymerase and 2.5 µl of 10x SYBR Green buffer. The reaction started with a step of 2 min at 55°C to allow the uracyl-N-glycosylase to eliminate putative PCR contaminants, followed by 10 min at 95°C to activate the AmpliTaq Gold DNA polymerase, and then 40 cycles consisting each of 15 s at 95°C and 1 min at 60°C. The real-time PCR data were plotted as the
Rn fluorescence signal vs the cycle number. The
Rn values were calculated by the Applied Biostystems 7700 sequence detection software using the formula:
Rn = (Rn+) -(Rn-), where Rn+ is the fluorescence signal of the product at any given time, Rn- is the mean fluorescence signal during cycles 313 and referred to as the baseline. The Ct value is defined as the cycle number at which the
Rn crosses a threshold. The threshold is set above the background fluorescence to intersect the exponential portion of the amplification curve of a positive reaction. The Ct is inversely proportional to the log amount of template within the PCR. HPRT was used as an endogenous control gene to normalize RNA amounts. The transcript accumulation index (TAI) is expressed as the fold change in mRNA levels between a given sample (transplanted heart) (Q) and a calibrator (a native normal heart in Fig. 1 and an acutely rejected heart allograft from an untreated recipients in Fig. 4) (CB), where the calibrator represents the 1-fold expression of each gene. The TAI is calculated as: TAI = 2-
Ct, where 
Ct = (CtTarget-CtHPRT)Q-(CtTarget-CtHPRT)CB. A prerequisite for the use of the 2-
Ct method is that the efficiency of each gene-specific PCR is >96%, as determined by the slope of the curve Ct = f(log[target DNA]) (25).
|
|
The cDNA sequences coding for the extracellular portion of mouse RANK fused to the coding sequences of the constant domains of human IgG1 (14, 15) was subcloned into the pTrack-CMV shuttle plasmid and a recombinant adenovirus (AdRANKIg) was generated according to standard protocols, as previously described (26). The adenoviral vector coding for the extracellular portion of mouse CD40 fused to the coding sequences of the constant domains of human IgG1 (AdCD40Ig) has been described previously (27). The CD40Ig molecule interacts with mouse and rat (27) CD40L. The noncoding adenoviral vector control adenovirus (Addl324) has been described previously (28). The quantification of infectious adenoviral particles (IP) was performed using a replication center assay as previously described (27, 29). Adenovirus stocks were tested for the absence of replication-competent adenoviruses by PCR amplification of the E1 adenoviral region (the detection limit was 1 adenoviral particle in 109 IP). For gene transfer into the heart, recombinant adenoviruses (15 x 1010 IP in 150 µl) were slowly injected into the apex and ventricular walls of the heart at four different points as previously described in detail (30). For gene transfer into the liver, recombinant adenoviruses (1 x 1010 IP in 150 µl) were injected into the portal vein as previously described (31).
ELISAs for the detection of RANKIg and CD40Ig
Serum RANKIg was detected using a sandwich ELISA. Plates (Nunc Maxisorb; Nunc, Roskilde, Denmark) were coated overnight at 4°C with anti-mouse RANK mAb (clone 1E6) (50 µl at 10 µg/ml). Plates were incubated (90 min at 37°C) with blocking buffer (PBS containing 0.1% Tween and 10% rat serum) and then incubated with serial dilutions of rat serum in PBS containing 0.1% Tween (2 h at 37°C). After washing, a biotin-conjugated rat IgG-absorbed donkey anti-human IgG (Jackson Laboratories, West Grove, PA) was added and incubated for 1 h at 37°C. Plates were then incubated with HRP-conjugated streptavidin (45 min at 37°C) (Vector Laboratories, Burlingame, CA), the reaction was developed using ABTS (Boehringer-Mannheim, Mannheim, Germany) and the absorbance of duplicate samples read at 405 nm. Purified RANKIg diluted in rat serum was used as a standard. The ELISA detection limit was 0.02 ng/ml.
ELISAs for the detection of Abs against RANKIg
Plates (Nunc Maxisorb) were coated overnight at 4°C with RANKIg (10 µg/ml), blocked with PBS containing 0.1% Tween and 10% rat serum and then incubated with serial dilutions of rat serum in PBS containing 0.1% Tween (1 h at 37°C). After washing, a biotin-conjugated mouse anti-rat IgG Ab (Jackson Laboratories) was added and incubated for 1 h at 37°C. Plates were then incubated with HRP-conjugated streptavidin (45 min at 37°C) (Vector Laboratories), the reaction was developed using ABTS (Boehringer-Mannheim) and the absorbance of duplicate samples read at 405 nm.
ELISAs for the detection of Abs against adenoviruses
Anti-adenovirus Abs were detected by ELISA using a previously described technique (28). Briefly, plates (Nunc Maxisorb) were coated overnight at 4°C with adenoviruses (109 particles in 50 µl PBS), fixed for 20 min with 1% formaldehyde, blocked, washed, and incubated with serial dilutions of sera (all with PBS containing 0.1% Tween and 0.1% BSA). Human IgG-absorbed biotin-conjugated donkey anti-rat IgG (
-chain specific) or rat IgM (µ-chain specific) (Jackson Laboratories) was added and incubated for 2 h at 37°C. Binding was detected as described above for the detection of CD40Ig by ELISA.
Immunofluorescence and immunohistology studies
Heart allografts were removed embedded in Optimal Cutting Temperature compound (OCT Compound; Tissue Tek, Miles Laboratories, Elkhardt, IN), immediately snap-frozen in liquid nitrogen, and then stored at -70°C until use. Five-micrometer cryostat sections were cut at -20°C, air dried, fixed in acetone for 10 min at room temperature, and stored at -20°C.
For immunofluoresence studies of TRANCE and RANK expression, sections were thawed, fixed in formol calcium for 1 min at room temperature, and incubated overnight at 4°C with anti-TRANCE or anti-RANK polyclonal Abs at 5 µg/ml, followed by biotinylated anti-goat Abs and then a streptavidin-Alexa 568 conjugate. Sections were then incubated with a FITC-conjugated mouse anti-rat leukocyte Ags mAb for 30 min at room temperature and mounted in ProLong AntiFade Kit (Molecular Probes). The fluorescence was observed by confocal microscopy (Leica TCS-SP1; Heidelberg, Germany) (
ex, 490, and 598
em, 516 nm, and 630 nm, respectively). The green and red emissions were collected using two photomultiplier tubes. The grayscale digital images were visualized with a 24-bit imaging system including Leicas TCS-NT software. The images generated were imported into Adobe Photoshop 6.0 (San Jose, CA), pseudo-colored, and in some cases overlapped to produce merged images. Cell counting was performed manually on images taken at a magnification of x400 by identifying TRANCE or RANK+ cells and then evaluating the coexpression by each cell of the different cell markers (MHC class II, TCR
, and TCR
). A minimum of 10 sections were analyzed for each marker.
For immunoperoxidase studies, sections were thawed and labeled using a 3-step indirect immunoperoxidase technique. Nonspecific staining was controlled by omission of the primary Ab. Positive cells in each graft were quantified using a square grid (15 fields, x40 objective) and expressed as the percentage of the area of biopsy occupied by cells (32).
Histological and morphometric analysis of cardiac grafts
The upper third of the graft was fixed in paraformaldehyde, embedded in paraffin, and coronal 5 µm sections were stained with H&E-safran. Tissues were analyzed by a pathologist (K.R.) blinded to the study. Three sections of at least 3 different biopsy levels were analyzed for each graft. Only vessels that displayed a clear internal elastica interna were scored. An average of 24 vessel sections were analyzed for each graft. The percentage of vessel occlusion by intimal thickening was determined using the following scoring system: 0 = no occlusion; 1 = <20%; 2 = 2050%; 3 = 5080%; and 4 = >80%. Vasculitis was quantified using the following scoring system: 0 = no leukocyte adhesion to the endothelium; 1 = leukocyte adhesion to the endothelium; 2 = leukocyte infiltration of the intima; 3 = fibrosis of the intima; and 4 = leukocyte infiltration of the media. The percentage of pathological vessels was scored taking into account the presence of vessel occlusion and/or vasculitis. Myocardial fibrosis was quantified using the following scoring system: 0 = no fibrosis; 1 = focal; 2 = diffuse-moderate; and 3 = diffuse-severe. Interstitial myocardial leukocyte infiltration was quantified using the following scoring system: 0 = no leukocyte infiltration; 1 = minimal; 2 = mild; 3 = discrete; 4 = moderate; and 5 = severe. Mast cells and eosinophils were evaluated after May-Grünwald-Giemsa staining of cryostat sections and the number of positive cells were counted (10 fields, x40 objective).
Immunization against SRBC
SRBC (109 in 800 µl sterile PBS) were injected i.v. on the day of transplantation. Serum levels of anti-SRBC Abs were determined at day 17 after immunization by incubation of serially diluted heat-inactivated serum with SRBC followed by incubation with human IgG-absorbed biotin-conjugated F(ab') 2 goat anti-rat IgG (
-chain specific) and with FITC-coupled streptavidin. Ab binding was detected by cytofluorimetry (FACSCalibur; BD Biosciences, San Jose, CA).
Alloantibody detection
Alloantibodies were measured by cytofluorimetry following incubation of serially diluted heat-inactivated serum with splenocytes that had been cultured with Con A for 3 days, followed by incubation with human IgG-absorbed biotin-conjugated F(ab ')2 goat anti-rat IgG (
-chain specific) or rat IgM (µ-chain specific) (Jackson Laboratories) and with FITC-coupled streptavidin. The results were expressed as mean channel fluorescence for each serum dilution.
Allogeneic CTL detection
Splenocytes were isolated and used directly as effector cells. 51Cr (100 µCi for 1 h at 37°C)-labeled LEW.1W, BN and LEW.1A spleen Con A (2 µg/ml, in the presence of IL-2 at 100 U/ml for 3 days) blasts were used as target cells. The effector and target cells were plated in triplicate in round-bottom 96-well microtiter plates (104 target cells/well) at E:T ratios ranging from 100:1 to 12.5:1 in the culture medium defined above. After incubation (6 h at 37°C), the plates were centrifuged, 51Cr was measured using a beta counter, and the percentage of specific lysis was calculated as 100 x (cpm experimental release - spontaneous release)/cpm (maximal release - spontaneous release). Maximal release: cells incubated with 1% SDS; spontaneous release: cells incubated with medium. Spontaneous release was always <10%.
Statistical analysis
Statistical significance was evaluated using a one-way ANOVA test (Fischer exact test) and Kaplan-Meier analysis of graft survival (log-rank test); p
0.05 were considered significant.
| Results |
|---|
|
|
|---|
We first analyzed, by real-time quantitative PCR, the expression of TRANCE mRNA in acutely rejected heart allografts in LEW.1A recipient rats as compared with syngeneic grafts. Previous studies have shown that the acute allograft rejection that occurs during the first week in this model is associated with a strong up-regulation of both Th1- (IFN-
, IL-2) and Th2- (IL-4, IL-13) related cytokines, of the TNF superfamily members FasL and TNF-
and of the activated macrophage products iNOS and IL-10 (1, 24, 33). TRANCE mRNA up-regulation was detected on day 3 and peaked on day 5 in acutely rejected allografts (Fig. 1A). TRANCE expression dramatically decreased by day 7, when all grafts had been rejected in this strain combination (see Table I). In syngeneic heart grafts, TRANCE showed a very low but statistically significant up-regulation on days 3 and 4. Considerable interindividual variations in TRANCE mRNA expression were observed in both allogeneic and syngeneic grafts, accounting for the large SD observed in Fig. 1A. Because TRANCE and CD40L share functional properties (9), we also analyzed the expression of CD40L mRNA. Similar to TRANCE, CD40L mRNA expression was strongly up-regulated on days 4 and 5 during acute allograft rejection (Fig. 1B). Low levels of CD40L mRNA were detected on days 3, 4, and 7 in syngeneic grafts (Fig. 1B).
|
Expression of TRANCE and RANK proteins in allografts during acute rejection
We next analyzed the expression of TRANCE and RANK proteins in cardiac allografts during acute rejection using two-color immunofluoresence and confocal microscopy. This analysis was performed on day +5 when TRANCE and RANK mRNA expression were strongly up-regulated in acutely rejected allografts and significantly more than in syngeneic grafts (Fig. 1). Although a mAb to rat CD40L has been described recently (34), it did not stain CD40L on tissue sections, precluding any comparative expression study of TRANCE and CD40L. The expression of TRANCE was detected in this study using a polyclonal Ab against mouse TRANCE. We confirmed that this Ab could stain rat activated CD4+ T cells as well as rat-TRANCE transfected 293-T cells (data not shown). As shown in Fig. 2, on day 5 posttransplantation, TRANCE expression was detected on graft infiltrating cells during acute allograft rejection. We found that all TRANCE-expressing cells were MHC class II- (Fig. 2, GI) and that 80% of TRANCE-expressing cells coexpressed TCR
(Fig. 2, AF) However, roughly 20% of TRANCE expressing cells did not stain for TCR
(Fig. 2, CE) or 
(data not shown). The nature of these cells remains unknown.
|
In vivo TRANCE blockade prolongs heart allograft survival
To assess the role of TRANCE-RANK interactions during allograft rejection, we used a fusion molecule made up of the extracellular domain of murine RANK and the Fc portion of human IgG1 (14). We previously showed that RANKIg specifically bound to murine TRANCE in vitro, but not to other known members of the TNF superfamily (14). In control experiments, we found that murine RANKIg could bind rat TRANCE-transfected but not untransfected 293T cells as well as activated rat CD4+ T cells (data not shown). Allograft recipients treated with 3 i.p. injections of 0.5 mg RANKIg on days 0, 2, and 4 posttransplantation exhibited a significant prolongation of graft survival (21.5 ± 16 days, p = 0.01) as compared with control IgG-injected rats (Table I) (7 ± 0 days). A schedule of two IV injections of 1 mg of RANKIg on days 0 and 2 also led to a comparable prolonged allograft survival (26 ± 12.8 days). However, 3 of 4 animals treated on the day of transplantation with 1 mg of RANKIg rejected their allografts in 8 days, while the remaining survived until day 34. The effect of TRANCE blockade was also assessed in mice using a heart allograft model (BALB/c
B6). TRANCE blockade alone using RANKIg administration did not enhance allograft survival as compared with control mice. However, when B6 mice were given 5 x 106 BALB/c donor spleen cells i.v. on the day of transplantation and treated with either human IgG1 or RANKIg on days 0, 2, and 4 (0.2 mg per injection), a significant prolongation of allograft survival (58.1 ± 32.3, p < 0.001) was observed with 3 of 10 animals exhibiting long term suvival (>100 days) (Table I). Therefore, short-term TRANCE blockade during the first week posttransplantation delays acute heart allograft rejection in both rat and mouse models.
To assess the effect of a prolonged treatment with RANKIg in the rat model, we generated a recombinant adenovirus encoding the RANKIg molecule and transduced heart allografts. Heart grafts were injected with recombinant adenovirus or Addl324 after transplantation into allogeneic hosts. We previously showed that this gene delivery method led to prolonged local and systemic production of the transgene (27, 30). In control in vitro experiments, we detected RANKIg in the supernatant of COS cells transduced with RANKIg (0.5 to 2 µg/ml as measured by ELISA) but not in that of Addl324-transduced cells. Allogeneic grafts transduced with 5 x 1010 IP AdRANKIg (n = 11) exhibited a significant prolongation of survival as compared with grafts transduced with noncoding adenoviruses (Table I) (n = 10) (14.3 ± 3.3 vs 7.6 ± 1.6 days, p < 0.0001). Mean allograft survival was equivalent to that observed with RANKIg injection. To confirm in vivo production of RANKIg in transduced allografts, allografts were stained with a mAb against murine RANK (21). As shown in Fig. 3A, AdRANKIg transduced allografts exhibited a strong and patchy expression of RANK whereas Addl324 transduced allografts stained negative (data not shown). Moreover, we measured the levels of RANKIg fusion protein in the sera of allograft recipients. High levels of RANKIg were detected in the sera of recipients of AdRANKIg-transduced but not Addl324-transduced heart allografts and these levels decreased with time (Fig. 3B). The majority of animals that had received RANKIg transduced allografts exhibited a strong humoral response against RANKIg (Fig. 3D) and against adenoviruses (Fig. 3E). Taken together, these results indicate that the TRANCE blockade alone prolonged cardiac allograft survival but that immunization against the RANKIg fusion molecule and the adenoviral vector might have impaired its blocking action and have shortened the expression of RANKIg, respectively.
|
To analyze the immune mechanisms of TRANCE blockade-induced allograft enhancement in the rat model we first examined heart allografts by immunohistology. On day 5, AdRANKIg-transduced allografts exhibited a heavy leukocyte infiltrate similar to that observed in control allografts (data not shown). Moreover, we did not observe any difference in the phenotype (CD4, CD8, CD11b/c, CD45R, CD25, and MHC class II) of graft-infiltrating cells between the AdRANKIg and Addl324 groups (data not shown). We then measured the expression of several cytokines and surface markers by quantitative RT-PCR in heart allografts. As shown in Fig. 4, TRANCE blockade did not induce significant modification in the expression levels of IL-2, IFN-
, IL-10, IL-13, or TNF-
, suggesting that allogeneic T cell priming and differentiation had occurred normally in RANKIg treated animals. Interestingly, we found a 5-fold increase in CD40L mRNA expression in AdRANKIg-transduced allografts as compared with control Addl324-transduced allografts. TAI levels were lower than in Fig. 1 due to the use of untreated allogeneic grafts as calibrator vs native hearts in Fig. 1.
Chronic allograft rejection following CD40L blockade is partially TRANCE dependent
We and others have previously shown that long-term CD40L blockade can induce long-term or indefinite allograft survival (4, 27). However, we found that CD40L blockade did not inhibit chronic allograft rejection, suggesting CD40L-independent allogeneic immune responses in this settings (27). Because CD40Ig-treated animals exhibited strongly reduced immunization toward alloantigens (27), we hypothesized that CD40L blockade might also inhibit immunization toward RANKIg. Moreover, the strong overexpression of CD40L mRNA in AdRANKIg-transduced allografts suggested that TRANCE blockade might have enhanced the CD40L pathway of costimulation which in turn could have abrogated the effect of TRANCE blockade. This prompted us to analyze the effect of combined TRANCE and CD40L blockade in this model. For this purpose, we compared heart allografts transduced with AdCD40Ig or both AdCD40Ig and AdRANKIg. Comparable long-term allograft survival was obtained with combined CD40L and TRANCE blockade (100% of grafts) as compared with CD40 blockade alone (83% of grafts, p = NS). As compared with animals treated with RANKIg alone, cotreatment with CD40Ig significantly increased serum levels of RANKIg (Fig. 3C) and significantly inhibited the production of anti-RANKIg (Fig. 3D) and anti-adenovirus Abs (Fig. 3E).
Long-term heart allografts were then examined for the presence of chronic allograft rejection. As we have previously shown, CD40Ig-transduced allografts exhibited chronic allograft rejection as assessed by the presence of vasculopathy, fibrosis and leukocyte infiltration (Fig. 5A). In allografts from CD40Ig + RANKIg-treated animals (n = 11) we observed a significant decrease in fibrosis (0.86 ± 0.19), infiltration (1.91 ± 0.16), vessel occlusion (1.59 ± 0.32), and vessel lesions (1.68 ± 0.3) as compared with CD40Ig alone (1.42 ± 0.18, p = 0.04; 2.42 ± 0.15, p = 0.026; 2.46 ± 0.26, p = 0.036; 2.35 ± 0.13, p = 0.033, respectively) (Fig. 5A). The diminution of leukocyte infiltration in CD40Ig + RANKIg-transduced allografts was related to a decrease in macrophages and T cells infiltration whose numbers were decreased to the levels observed in syngeneic grafts (Fig. 5B). Interestingly, TRANCE blockade totally inhibited the infiltration by mast cells that occurred in CD40Ig-transduced allografts (Fig. 5C). Mast cell infiltration has been shown to correlate with chronic allograft rejection (38).
|
|
|
| Discussion |
|---|
|
|
|---|
In the immune system, TRANCE expression has been found restricted to activated T cells. We have previously shown that TRANCE is not expressed on the surface of resting murine T cells but under appropriate T cell stimulation in vitro, TRANCE can be detected on the surface of murine T cells after 4 h with a peak between 36 and 48 h, followed by a sustained expression for at least 48 h (14). This is an important difference between TRANCE and CD40L whose expression on activated CD4+ T cells is early but transient (2). This suggests that DC might firstly use CD40L and then TRANCE as a survival and activation signal provided by T cells. Our results indicate that activated T cells infiltrating allografts likely express both TRANCE and CD40L. Although 80% of TRANCE-expressing cells in acutely rejected grafts were T cells, roughly 20% of these cells were negative for both TCR and MHC class II. Importantly, TRANCE can be expressed on bone marrow stromal cells, osteoblasts (9), and endothelial cells (39) and it is possible that TRANCE expression is induced during inflammatory processes on some endothelial or mesenchymal cells in the heart.
In previous studies, we have shown that RANK is highly expressed on mature but not immature DC (15), whereas low levels of expression have also been detected on activated T and B cells (14). Graft infiltrating cells are, in our model, mainly monocytes/macrophages (>70%) and activated T cells (1015%), whereas B cells are poorly represented (33). Because maximal leukocyte infiltration occurs at day 5 (33), it is likely that the early as well as late RANK mRNA overexpression in rejected grafts does not depend on activated T cells or macrophages but rather on the up-regulation of RANK on resident donor DC or on graft infiltration by recipient DC. This is consistent with the fact that virtually all RANK-expressing cells are MHC class II+. Previous studies have shown that resident tissue DC rapidly migrate and therefore mature following allogeneic transplantation (36). In contrast, early tissue infiltration by DC is a common feature during inflammatory responses (40, 41). An early allograft infiltration by recipient DC has recently been clearly demonstrated by Saiki et al. (37) and another study has shown that the recruitment of recipient DC in kidney grafts can be induced by transplant surgery alone (42). Host DC then recirculate to lymphoid organs where they can prime recipient T cells by the indirect pathway of allostimulation (37).
Our results indicate that TRANCE-RANK interactions play a role during allograft rejection. However, TRANCE blockade delays but does not inhibit acute allograft rejection. In the same strain combination as that used in this study, recipient rats treated with a blocking CD40L mAb throughout the first week posttransplantation exhibited a prolongation of allograft survival similar to that observed with RANKIg (43). However, long-term blockade of the CD40L pathway alone using CD40Ig (27) but not of the TRANCE pathway was sufficient to induce long-term allograft survival. Because high levels of circulating RANKIg were detected in the sera of animals grafted with a AdRANKIg-transduced allografts (>100 µg/ml) during the first month, it is unlikely that we would be able to obtained better allograft survival than those described here with TRANCE blocking reagents alone. However, it is possible that the anti-RANKIg Abs that appear in these animals might decrease the efficiency of TRANCE blockade. It is interesting to note that a short-term treatment with RANKIg induced a better allograft survival than a prolonged treatment as that obtained with RANKIg adenovirus transduction. This might be related to a deleterious effect of adenovirus injection of heart tissue or to inhibition of active regulatory mechanisms induced by TRANCE (44). Although TRANCE blockade appeared to strongly up-regulate CD40L mRNA expression in heart allografts, these results suggest that the immune system cannot fully compensate for the transient absence of the CD40L or TRANCE pathway to mount an effective T cell response and therefore that these pathways of DC activation do not have completely overlapping functions.
The CD40L pathway of costimulation plays an important role in T cell and T-dependent B cells responses. However, CD40L-deficient mice can mount effective immune responses against several pathogens such as LCMV or the influenzae virus. Bachman et al. (19) have shown that TRANCE is critical for CD40L-independent Th cell responses against LCMV. CD40L blockade has shown great promise in clinical transplantation. However, several studies have demonstrated that short-term as well as prolonged CD40L blockade inhibits acute but not chronic rejection (27, 45, 46). When CD40L blockade was combined with injection of donor spleen cells at the time of grafting, chronic heart allograft rejection was prevented in a mouse model (47) but not in a rat model (43). The key feature of chronic rejection in heart allografts is a progressive vasculopathy that includes intimal thickening, smooth muscle cell proliferation, and vessel obstruction. The mechanisms of these lesions are not fully understood although factors such as oxido-reduction, alloantibodies, mastocytes, CTLs, and IFN-
have been proposed (48). Chronic rejection lesions following CD40L blockade are diminished by association with blockade of other costimulatory pathways, such as those triggered by inducible costimulator (49) or programmed death-1 (50). Our results strongly suggest that the TRANCE pathway plays at least a partial role in the chronic allograft rejection that occurred in recipients of CD40Ig transduced heart allografts. The mechanisms of this effect need to be clarified, however, our results suggest a role for alloantibodies. We have shown that RANK is expressed on activated B cells (14) and TRANCE deficient mice exhibit a defect in their early B cell progenitors (20). Although we could not detect any significant in vitro biological effect of recombinant TRANCE on B cells (14), it is possible that in the absence of CD40L signaling, TRANCE-RANK interactions play a role in B cell function, despite the fact that anti-viral Ab responses were not affected in RANKIg-treated mice (19). In contrast, the inhibitory effect of TRANCE blockade on alloantibody production in CD40Ig-treated animals might be explained by a synergistic inhibition of Th cell activation similar to that observed by the simultaneous blockade of both pathways in mice in the LCMV model (Abs not affected by stimultaneous blockade of CD40 and RANK) (19). This effect on T cells is suggested by the fact that TRANCE blockade almost completely inhibits T cell infiltration in long-term allografts from CD40Ig-treated rats.
Finally, a recent report indicates that TRANCE could induce angiogenesis (51) in human endothelial cells, suggesting that TRANCE-RANK interactions might play a direct role in the early stage of vasculopathy. The fact that TRANCE can also be induced on some endothelial cells by TGF-
(39), a cytokine that is strongly up-regulated in rejected allografts (24), suggests an autonomous model of TRANCE-dependent endothelial cell proliferation.
Mastocytes have been associated with chronic rejection (52) and eosinophils play a role in chronic rejection in the absence of CD40-CD40L interactions and CD8+ cells (46). We did not observe eosinophils in any of the experimental conditions of our chronic rejection model in rats. The fact that mastocytes were increased in hearts with chronic rejection after CD40Ig-treatment and were significantly inhibited by treatment with RANKIg suggests that these cells and some of their products, such as bFGF, may play a role in the pathogeneis of chronic rejection. These results also suggest a possible role for TRANCE in mastocyte biology that could explain previous reports of mast cell activation by surface molecules on T cells (53). Finally, CTLs and CD8+ T cells have been implicated in the pathogenesis of chronic rejection in certain models (48) and following interruption of CD40-CD40L interactions, depletion of CD8+ cells synergizes with the neutralization of IL-4 for the prevention of chronic rejection (46). CTL activity was comparable in recipients treated with RANKIg and CD40Ig vs CD40Ig alone and permanent depletion of CD8+ cells in rats treated with CD40Ig did not modify the intensity of chronic rejection lesions (our unpublished data), suggesting that CD8+ cells do not play a major role in this chronic rejection model.
In conclusion, our results indicate that the TRANCE pathway of costimulation plays a role during acute as well as chronic allograft rejection. The fact that TRANCE blockade delayed but did not inhibit acute rejection indicates, however, a partial role and that TRANCE-RANK interaction is not required for efficient allogeneic T cell priming in vivo. It is possible that, as recently shown for another member of the TNF superfamily, namely CD134 (54), the role of the TRANCE-RANK pathway is more critical for effector or memory cell activation than for naive T cells. This is also suggested by the fact that both CD4+ and CD8+ memory, but not naive T cells, constitutively express TRANCE mRNA in vivo (14). Taken together, these results indicate a high-level complexity in the regulation of these independent costimulation pathways during T cell-APC interaction.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 C.G. and C.L. contributed equally to this report. ![]()
3 I.A. and R.J. are both senior and corresponding authors. ![]()
4 Address correspondence and reprint requests to Drs. Régis Josien or Ignacio Anegon, Institut National de la Santé et de la Recherche Médicale Unité 437, Centre Hospitalier Régional Universitaire de Nantes, 30 Boulevard Jean Monnet, 44093 Nantes Cedex 1, France. E-mail addresses: rjosien{at}nantes.inserm.fr or ianegon{at}nantes.inserm.fr ![]()
5 Abbreviations used in this paper: CD40L, CD40 ligand; LCMV, lymphocytic choriomeningitis virus; TRANCE, TNF-related activation induced cytokine; RANK, receptor-activating NK-
B; DC, dendritic cell; HPRT, hypoxanthine phosphoribosyl transferase; TAI, transcript accumulation index; AdRANKIg, recombinant adenovirus; Addl324, control adenovirus; IP, infectious adenoviral particles; DST, donor-specific splenocyte transfusion. ![]()
Received for publication June 18, 2003. Accepted for publication November 19, 2003.
| References |
|---|
|
|
|---|
expression, and apoptosis during allograft rejection and tolerance. Transplantation 66:887.[Medline]
in donor transfusion-induced allograft tolerance. J. Clin. Invest. 102:1920.[Medline]
induces expression of receptor activator of NF-
B ligand in vascular endothelial cells derived from bone. J. Biol. Chem. 277:26217.
in pancreatic islets in the nonobese diabetic mouse. J. Immunol. 160:3585.This article has been cited by other articles:
![]() |
F. Lamoureux, G. Picarda, J. Rousseau, C. Gourden, S. Battaglia, C. Charrier, B. Pitard, D. Heymann, and F. Redini Therapeutic efficacy of soluble receptor activator of nuclear factor-{kappa}B-Fc delivered by nonviral gene transfer in a mouse model of osteolytic osteosarcoma Mol. Cancer Ther., October 1, 2008; 7(10): 3389 - 3398. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Ford, M. E. Wagener, S. S. Hanna, T. C. Pearson, A. D. Kirk, and C. P. Larsen A Critical Precursor Frequency of Donor-Reactive CD4+ T Cell Help Is Required for CD8+ T Cell-Mediated CD28/CD154-Independent Rejection J. Immunol., June 1, 2008; 180(11): 7203 - 7211. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guillonneau, C. Seveno, A.-S. Dugast, X.-L. Li, K. Renaudin, F. Haspot, C. Usal, J. Veziers, I. Anegon, and B. Vanhove Anti-CD28 Antibodies Modify Regulatory Mechanisms and Reinforce Tolerance in CD40Ig-Treated Heart Allograft Recipients J. Immunol., December 15, 2007; 179(12): 8164 - 8171. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-X. Hubert, C. Voisine, C. Louvet, J.-M. Heslan, A. Ouabed, M. Heslan, and R. Josien Differential Pattern Recognition Receptor Expression but Stereotyped Responsiveness in Rat Spleen Dendritic Cell Subsets J. Immunol., July 15, 2006; 177(2): 1007 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Duplan, G. Beriou, J.-M. Heslan, C. Bruand, P. Dutartre, L. T. Mars, R. S. Liblau, M.-C. Cuturi, and A. Saoudi LF 15-0195 Treatment Protects against Central Nervous System Autoimmunity by Favoring the Development of Foxp3-Expressing Regulatory CD4 T Cells J. Immunol., January 15, 2006; 176(2): 839 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-X. Hubert, C. Voisine, C. Louvet, M. Heslan, and R. Josien Rat Plasmacytoid Dendritic Cells Are an Abundant Subset of MHC Class II+ CD4+CD11b-OX62- and Type I IFN-Producing Cells That Exhibit Selective Expression of Toll-Like Receptors 7 and 9 and Strong Responsiveness to CpG J. Immunol., June 15, 2004; 172(12): 7485 - 7494. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |