The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palmowski, M. J.
Right arrow Articles by Collins, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palmowski, M. J.
Right arrow Articles by Collins, M. K.
The Journal of Immunology, 2004, 172: 1582-1587.
Copyright © 2004 by The American Association of Immunologists

Intravenous Injection of a Lentiviral Vector Encoding NY-ESO-1 Induces an Effective CTL Response1

Michael J. Palmowski*, Luciene Lopes{dagger}, Yasuhiro Ikeda{dagger}, Mariolina Salio*, Vincenzo Cerundolo* and Mary K. Collins2,{dagger}

* Tumour Immunology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom; and {dagger} Department of Immunology and Molecular Pathology, Windeyer Institute, University College, London, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lentiviral vectors can efficiently transduce a variety of nondividing cells, including APCs. We assessed the immunogenicity of a lentiviral vector encoding the melanoma Ag NY-ESO-1 in HLA-A2 transgenic mice. Direct i.v. injection of NY-ESO-1 lentivirus induced NY-ESO-1157–165-specific CD8+ cells, detected ex vivo with an A2/H-2Kb chimeric class I tetramer. These NY-ESO-1157–165-specific CD8+ cells could be expanded by boosting with an NY-ESO-1 vaccinia virus and could kill NY-ESO-1157–165 peptide-pulsed targets in vivo. Such direct lentiviral vector injection was similar in potency to the injection of in vitro-transduced dendritic cells (DC). In addition, human monocyte-derived DC transduced by the NY-ESO-1 lentivirus stimulated an NY-ESO-1157–165-specific specific CTL clone. These data suggest that direct lentiviral transduction of DC in vivo might provide a powerful immunotherapeutic strategy.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effective protective or therapeutic vaccination remains a significant clinical problem for many infectious diseases; for example, AIDS (1). Vaccination has also been proposed as a highly specific and nontoxic cancer treatment, but, again, effective protocols await development (2). Dendritic cells (DC)3 are the natural initiators of an immune response, so effective vaccination requires mobilization of DC to present Ag (3). For example, DNA vaccination probably results in both gene and Ag uptake by DC and also activation of DC, as DNA stimulates Toll-like receptors (4). Adoptively transferred DC have been shown to be highly effective cellular adjuvants in mice, stimulating protective T cell responses against pathogens and tumors (5, 6). A similar approach is being applied to human tumor immunotherapy (7, 8, 9). In these protocols the DC must be in some way engineered to present specific Ags. This could be achieved by loading the DC with exogenous protein Ag, but delivery of Ag genes to DC is also an attractive idea, because it might allow long term, high level presentation of the endogenously expressed Ag. In addition, endogenous presentation allows more efficient loading of antigenic peptides onto MHC class I molecules.

The development of recombinant viral vector systems for gene therapy has prompted examination of their efficacy in gene delivery to DC and in direct immunization. Adenovirus vectors were shown to deliver Ag genes to human (10) or mouse (11) DC in vitro. The endogenously synthesized Ag was efficiently presented to CD8+ T cells; however pre-existing immunity to viral proteins expressed by the vector prevented effective immunization (11). Retroviral vectors based on murine leukemia virus (MLV) have also been used to express Ags in human DC, which could be efficiently presented to CD8+ T cells (12, 13, 14). However, MLV-based vectors only infect dividing cells, so the human DC had to be generated from CD34+ hemopoietic progenitor cells. Injection of MLV-based vector into mice could stimulate immunity (15) and resulted in some transduction of DC, but at low efficiency (16).

Like retroviral vectors, lentiviral vectors based on HIV-1 do not encode any viral proteins. This eliminates problems of pre-existing immunity and avoids competition in the generation of anti-vector vs anti-transgene CTL. Lentiviral vectors can infect nondividing, human peripheral blood-derived DC, and transduced human DC expressing antigenic peptides can stimulate specific CTL responses in vitro (17, 18). An advantage of lentiviral vectors is that they do not activate DC constitutively, like adenoviral vectors (19), or block their activation, like herpes simplex viral vectors (20). Previous studies have used lentiviral vectors expressing a tumor Ag to infect mouse DC in vitro before injection, and CTL responses (18) and tumor protection were established in the mice (21). Direct injection of lentiviruses in mice has been reported to transduce APCs and B cells in spleen (22) and DC in a draining lymph node (23). Direct injection of lentiviral vectors expressing peptide epitopes or a HLA-Cw3 transgene in HLA-A2 transgenic mice has been shown to induce lytic activity against peptide-pulsed targets (24) and peptide or transgene-specific CTL responses (23).

Our aim was to develop HIV-1-based vectors that efficiently expressed a tumor Ag in mouse DC. As an Ag we chose NY-ESO-1 (25), a cytoplasmic protein (26) expressed in melanoma and other tumors. NY-ESO-1 is highly immunogenic, eliciting a spontaneous immune response in 50% of patients with NY-ESO-1-expressing cancers (reviewed in Ref.27). NY-ESO-1 elicits a combined Ab and T cell response (28). Several epitopes of NY-ESO-1 presented by HLA class II molecules (29, 30, 31, 32) and HLA class I molecules (28, 33, 34) have been identified. Previous work from our group has shown that priming of HLA-A2 (A2) transgenic mice with plasmid DNA and recombinant vaccinia virus encoding the A2-restricted epitope NY-ESO-1157–165 elicits a strong NY-ESO-1157–165-specific CTL response (35).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lentiviral vector production

The green fluorescence protein (GFP)-expressing HIV vector pHRSIN-CSGW was provided by A. Thrasher (Institute of Child Health, London, U.K.) (36). In pHRSIN-NY, an NY-ESO-1 cDNA replaces GFP. To make virus, 293T cells were cotransfected with pHRSIN-NY, pCMVR8.91, and pMDG plasmids (37) as previously described (38). Unenveloped NY-ESO-1-lentivirus was produced by transfection without pMDG. Culture supernatants were concentrated by ultracentrifugation. Titers were determined on 293T cells by measurement of GFP or NY-ESO-1-expression, using a FACScan and CellQuest software (BD Biosciences, Mountain View, CA). NY-ESO-1 was detected in cells fixed with 4% paraformaldehyde and permeabilized in 0.1% saponin using an anti-NY-ESO-1 Ab (gift from Dr. G. Spagnoli, University Hospital, Basel, Switzerland) (26) and goat anti-mouse Texas Red conjugate (Molecular Probes, Eugene, OR).

Infection of .45 cells and immunoblotting analysis

Cells from the EBV-transformed, HLA-A2+ B cell line .45 were infected with GFP- or NY-ESO-1-expressing vector at MOI 20. Two weeks later, when >90% of the cells were positive for NY-ESO-1 expression, total protein was separated on a 12% denaturing SDS-polyacrylamide gel. Expression of NY-ESO-1 was detected with the anti-NY-ESO-1 Ab and goat anti-mouse HRP (Harlan, Indianapolis, IN).

Transduction of DC

Mouse DC were prepared from bone marrow as previously described (39). Human monocytes were isolated with CD14 beads (Miltenyi Biotec, Auburn, CA) and differentiated into DC in RPMI 1640 with 10% FCS, IL-4 (50 ng/ml), and GM-CSF (1000 U/ml). Day 4–5 immature human or murine DCs were transduced with GFP-, NY-ESO-1-, or NY-ESO-1-noEnv lentiviruses at MOI 40. DCs were analyzed for GFP, NY-ESO-1, CD11c (BD PharMingen, San Diego, CA), and CD1a (eBioscience, San Diego, CA) expression after 5 days by fluorescence microscopy (Axiovert 100 (Zeiss, Oberkocken, Germany) with a MRC 1024 Confocal (Bio-Rad, Hercules, CA)) or FACScan. Mouse DC were cultured for 4 days after transduction and incubated with 20 µg/ml CpG, to induce maturation before injection. Human DC were cultured for 4 days after transduction, then matured by cultivation with CD40 ligand-expressing J558L cells (gift from Dr. P. Lane, Birmingham, U.K.) before use in an ELISPOT assay. In some experiments mouse DC were purified from splenocytes using CD11c microbeads (Miltenyi Biotec). DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). Detection of the enhanced GFP sequence was conducted by nested PCR using enhanced GFP-specific primers and Ex-Taq (Takara, Ohtsu, Japan). Primer pair F1 and R1 was used for the first reaction with 0.4 µg of the total cellular DNA as a template. Primer pair F2 and R2 was used for the second reaction with 4 µl of the first PCR reactions as template: F1, atggtgagcaagggcgaggagctg; R1, tagtggttgtcgggcagcagcacg; F2, ggtggtgcccatcctggtcgag; and R2, tgctggtagtggtcggcgagctgc.

Mice and immunization

HHD mice (40) were immunized by injecting lentiviral vectors or bone marrow-derived DC transduced with lentiviral vectors suspended in PBS into the tail vein. Blood samples were taken 8 days after immunization. Some mice were primed with plasmid DNA encoding full-length NY-ESO-1 or boosted by injecting 106 PFU recombinant vaccinia virus encoding full-length NY-ESO-1 into the tail vein. PBL were prepared from blood samples using RBC lysis buffer (Invitrogen, Carlsbad, CA). Cells were resuspended in RPMI 1640 (Sigma-Aldrich, St. Louis, MO) supplemented with 10% FCS. PBL samples were stained with NY-ESO-1 tetramer for 20 min at 37°C, then cells were costained with anti-CD8-{alpha} (Caltag Laboratories, Burlingame, CA), washed, and analyzed on a FACSCalibur using CellQuest software (BD Biosciences).

CTL killing, ELISPOT assay

The human HLA-A2.01 (A2)-positive B cell line .45 transduced with lentiviruses (see above) was labeled with 51Cr and incubated with a CTL clone specific for the A2-restricted NY-ESO-1 epitope 157–165 (41). Specific lysis was determined according to this formula: ((experimental release - spontaneous release)/(total release - spontaneous release)) x 100. Transduced human DC (104; see above) were incubated with 102 NY-ESO-1157–165-specific CTL clone in anti-IFN-{gamma} (MabTech, Nacka, Sweden)-coated ELISPOT plates (Millipore, Watford, U.K.). Plates were developed according to the manufacturer’s directions.

In vivo killing assay

Freshly isolated splenocytes from HHD mice were incubated in RPMI 1640 medium with 1 µM peptide for 2 h and labeled with CFSE (Molecular Probes, Eugene, OR). Labeled cells were injected at 107 cells/mouse into the tail vein with a control population without peptide that had been labeled with a different concentration of CFSE. Disappearance of peptide/fluorochrome-labeled cells was tracked using FACS analysis of freshly isolated PBL 5 h after the injection. The level of specific cytotoxicity was calculated relative to the labeled unpulsed population using the following calculation: 100 x (100 - (percentage pulsed/percentage unpulsed)). WinMDI 2.8 software (J. Trotter, The Scripps Institute, La Jolla, CA; http://facs.scripps.edu) and CellQuest 3.3 software (BD Biosciences) were used to analyze the FACS data.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transduction of mouse DC ex vivo and in vivo

The HIV-1-based vector pHRSIN-CSGW was developed for high level, sustained transgene expression in human hemopoietic stem cells and their progeny (36). Fig. 1A shows that this vector transduced mouse bone marrow-derived DC cultures. Preferential GFP expression in the CD11c+ cells was seen, with up to 50% of CD11c+ cells expressing GFP. Transduction in vivo was then examined by injection of 5 x 107 293T infectious units (i.u.) in the tail vein, followed by analysis of GFP expression in spleen cells. Fig. 1B demonstrates that CD11c+ GFP+ cells were also detected in vivo (a typical mouse is shown); 0.3 and 0.4% of CD11c+ cells purified from spleen expressed GFP after 9 days in duplicate experiments. A similar percentage of GFP+/CD11c+ cells was detected in spleen between 5 and 12 days after GFP lentiviral vector injection (data not shown). The CD11c+ cells were transduced by the lentiviral vector, as demonstrated by the detection of GFP DNA in these cells (Fig. 1C). Injection of a control vector preparation without viral envelope did not result in GFP DNA detection (Fig. 1C). A previous study injected a higher dose of an essentially identical lentiviral vector in the tail vein of mice and demonstrated long term transduction of both APCs and B cells in spleen (22). It is therefore likely that CD11c- B cells are also transduced in our experiments. Injection of a lentiviral vector in the footpad transduced DC in the draining lymph node (23).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 1. GFP expression after lentiviral transduction of mouse DC cultures (A) or 9 days after lentiviral injection in the tail vein (B). B, CD11c+ cells purified from the spleen of a typical mouse; 0.3 and 0.4% of CD11c+ cells expressed GFP after injection of duplicate mice. C, Two mice were injected in the tail vein with 8 x 108 293T i.u. of GFP lentiviruses (GFP1 and GFP2). Control groups were injected with either PBS (uninf) or an equivalent amount of nonenveloped GFP lentivirus particles (no-Env1 and no-Env2). Six days later, spleens were removed and CD11c-positive (DC) and -negative (non-DC) cells were isolated. The GFP sequence was detected by nested PCR as described in Materials and Methods.

 
Direct immunization with lentiviral vector

To address whether in vivo transduction resulted in the induction of Ag-specific CTL, HLA-A2 transgenic (HHD) mice were injected with escalating doses of lentiviral vector encoding the tumor testis Ag NY-ESO-1. CTL responses were monitored in the blood by staining of PBL with a chimeric A2Kb/peptide tetramer (35, 42) (Fig. 2). At the highest dose, NY-ESO-1157–165-specific CD8+ cells could be detected in peripheral blood after injection; typical mice and a summary are shown in Fig. 2A. When the same group of animals was boosted with NY-ESO-1 recombinant vaccinia virus, NY-ESO-1157–165-specific CD8+ cells could be detected in all three groups of mice (Fig. 2A). Control mice injected with NY-ESO-1 vaccinia alone or mice boosted with irrelevant vaccinia virus showed only a weak NY-ESO-1157–165-specific response (mean responses, 0.025% CD8+ cells after NY-ESO-1 vaccinia alone, 0.25% CD8+ cells after NY-ESO-1 lentivirus, followed by irrelevant vaccinia virus). The NY-ESO-1157–165-specific CD8+ cells induced by lentiviral vector priming were effective CTL, as demonstrated by their ability to kill NY-ESO-1157–165 peptide-pulsed target cells in vivo (Fig. 2B).



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 2. A, NY-ESO-1157–165-specific CD8+ cells 8 days after injection of the number of lentiviruses shown and 8 days after boosting of the same mice with NY-ESO-1 vaccinia viruses. Typical mice from a group of three are shown, with the mean response of each group. B, Detection of NY-ESO-1157–165 peptide-pulsed splenocytes (R2) and unpulsed splenocytes (R3) 5 h after injection into immunized mice.

 
Immunization with ex vivo-transduced DC

Direct injection of 5 x 105 (293T i.u.) lentiviruses was able to prime an effective response. We therefore examined the efficiency of NY-ESO-1 lentiviral vector-transduced DC as immunogens. Because human and mouse DC are relatively refractory to lentiviral vector transduction, 4 x 107 i.u. were required to infect ~50% of 106 mouse DC. As a control, unenveloped virus was also used in a mock infection of DC, as phagocytic DC can ingest and present proteins from lentiviral vector preparations. Fig. 3 shows that NY-ESO-1157–165-specific CD8+ cells could be detected in peripheral blood of mice that received NY-ESO-1-transduced DC. This response could also be boosted with NY-ESO-1 vaccinia virus (Fig. 3). The boosted response after priming by transduced DC was not substantially higher than boosted responses after direct vector injection.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. NY-ESO-1157–165-specific CD8+ cells in peripheral blood of HHD mice 8 days after injection of 106 DC, transduced as indicated, and 8 days after boosting of the same mice with 106 NY-ESO-1 vaccinia viruses. Typical mice from a group of three are shown, with the mean response of each group.

 
NY-ESO-1 presentation by lentiviral vector-transduced human B cells and DC

To show that this approach might ultimately be used in clinical settings, we wanted to demonstrate that the NY-ESO-1 lentivirus could induce NY-ESO-1157–165 peptide presentation in human APC. The human EBV-transformed B cell line .45 was transduced with NY-ESO-1 lentivirus. Expression of NY-ESO-1 was detected by Western blot (Fig. 4A), and FACS analysis showed that ~90% of cells were NY-ESO-1-positive by intracellular staining (data not shown). NY-ESO-1157–165 peptide presentation by the B cells was demonstrated in a 51Cr release assay using an NY-ESO-1157–165-specific, HLA-A2-restricted CTL clone (Fig. 4A). We then used the NY-ESO-1 lentiviral vector to transduce human HLA-A2+, monocyte-derived DC, using a protocol that we previously reported can transduce up to 30% of DC without affecting their viability or ability to mature (38). Fig. 4B shows cytoplasmic expression of NY-ESO-1 in ~30% of the transduced CD1a+ DC. To demonstrate that the transduced DC could present an epitope from the cytoplasmic NY-ESO-1 protein, we used an NY-ESO-1157–165-specific CTL clone isolated by tetramer sorting from peripheral blood of a melanoma patient. Fig. 4C shows that the transduced DC could stimulate IFN-{gamma} secretion by this NY-ESO-1157–165-specific CTL clone in an ELISPOT assay. These data show that both immature and mature DC stably modified to express a cytoplasmic protein can present an epitope from that protein to CD8+ T cells. Previous reports using lentiviral vectors (17) or varicella-zoster virus (VSV)-G-pseudotyped HIV-1 (43, 44) to modify human DC have examined presentation of CTL epitopes engineered for secretion into the endoplasmic reticulum (17, 18) or HIV-1 Gag that buds from the cell (43, 44).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. A, Lysis of NY-ESO-1-transduced human B cells by an NY-ESO-1157–165-specific CTL clone in a 51Cr release assay. Expression of NY-ESO-1 in the transduced B cells was detected by immunoblot. B, Expression of NY-ESO-1 in human DC was detected by immunostaining. Stimulation of IFN-{gamma} release by an NY-ESO-1157–165-specific CTL clone by the transduced DC was determined in an ELISPOT assay. Well A, DC plus NY-ESO-1157–165 peptide; wells B and C, duplicate wells of transduced DC (C).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We compared immunization with lentiviral vectors expressing an Ag used either to modify DC ex vivo or to transduce DC and other cells in situ after i.v. injection. Both routes of immunization resulted in priming of an immune response that could be boosted with vaccinia virus expressing NY-ESO-1. Injection of as few as 5 x 105 (293T i.u.) NY-ESO-1 lentiviruses could prime an NY-ESO-1157–165-specific CD8+ T cell response. This response to a relatively low dose is encouraging if vaccination in larger animal models or the clinic is considered, as production of sufficient lentiviral vector would be feasible. A recent study in a similar mouse model, but with different Ags, reported up to 10% Ag-specific CD8+ cells after a single immunization of 5 x 107 lentiviruses (23). This stronger response is probably due to the Ags expressed, a human HLA-Cw3 or Cw3 or Melan-A peptides, as injection of 5 x 105 transduced DC expressing these Ags induced up to 5% Ag-specific CD8+ cells (23). Our data demonstrate that lentiviruses may also be used in a heterologous prime/boost strategy to elicit CTL responses to weakly antigenic and/or subdominant tumor Ags (35).

Lentiviral vectors are attractive for prime/boost protocols because there are no pre-existing neutralizing Abs to heterologous envelopes, such as VSV-G, that might inhibit CTL priming (45). Furthermore, as the vector encodes only the immunizing Ag, transduced APC will not express viral proteins that might inhibit priming due to competition by CTL at the APC (46). Heterologous prime/boost may be more efficient than homologous boost with lentivirus, as pre-existing anti lentiviral vector responses have been shown to inhibit immunization (22). Clearly, lentiviral vector safety will require rigorous testing before clinical trials, as there is potential for similar insertional mutagenesis to that seen with retroviral vectors (47). However, transduction of nondividing DCs is likely to be less oncogenic than transduction of rapidly proliferating hemopoietic stem cells; targeting vector to DCs may also enhance its safety. Although it is clear from our data that DC transduced ex vivo can prime an immune response, we cannot be sure that the CD11c+ cells transduced after i.v. injection are the cells responsible for immune stimulation. Again, surface or transcriptional targeting of NY-ESO-1 expression to DC will resolve this question.

HIV-1 itself infects DC in vitro and in patients, which may serve as a reservoir of infected cells (48), and also traffics to lymphoid tissue bound to the DC surface (49). To evade the immune response, wild-type HIV-1 has been reported to modulate DC function by a number of strategies, including Nef and Tat induction of cytokine and chemokine production in the absence of maturation (50, 51). It has been proposed that this serves to attract T cells, permitting HIV-1 transmission from DC without stimulating an immune response. HIV-1 viruses deleted in envelope (44) or envelope Nef, Vif, Vpr, and Vpu (43) and pseudotyped with VSV-G have been shown to infect DC in vitro and stimulate Gag-specific T cells. The lentiviral vectors we used in this study are further deleted for Tat, Rev, and HIV-1 Gag and Pol proteins, which will increase their immune stimulatory potential and focus the immune response on the NY-ESO-1 transgene. Indeed, the coding capacity of the lentiviral vectors will allow us to express potentially immunostimulatory molecules together with the Ag gene in future studies.


    Acknowledgments
 
We thank F. Lemonnier (Institute Pasteur, Paris, France) for the supply of HHD mice, and Mark Harries for NY-ESO-1 expression constructs.


    Footnotes
 
1 This work was supported by Cancer Research UK and Cancer Research Institute UK. M.J.P. is funded by the European Community (FP5). Back

2 Address correspondence and reprint requests to Dr. Mary K. Collins, Department of Immunology and Molecular Pathology, Windeyer Institute, 46 Cleveland Street, London, U.K. W1T 4JF. E-mail address: mary.collins{at}ucl.ac.uk Back

3 Abbreviations used in this paper: DC, dendritic cell; GFP, green fluorescence protein; i.u., infectious unit; MLV, murine leukemia virus; VSV, varicella-zoster virus. Back

Received for publication June 18, 2003. Accepted for publication November 13, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Letvin, N. L.. 2002. Strategies for an HIV vaccine. J. Clin. Invest. 110:15.[Medline]
  2. Yu, Z., N. P. Restifo. 2002. Cancer vaccines: progress reveals new complexities. J. Clin. Invest. 110:289.[Medline]
  3. Steinman, R. M., M. Pope. 2002. Exploiting dendritic cells to improve vaccine efficacy. J. Clin. Invest. 109:1519.[Medline]
  4. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, et al 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  5. Pulendran, B., K. Palucka, J. Banchereau. 2001. Sensing pathogens and tuning immune responses. Science 293:253.[Abstract/Free Full Text]
  6. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  7. Nestle, F. O., J. Banchereau, D. Hart. 2001. Dendritic cells: On the move from bench to bedside. Nat. Med. 7:761.[Medline]
  8. Banchereau, J., A. K. Palucka, M. Dhodapkar, S. Burkeholder, N. Taquet, A. Rolland, S. Taquet, S. Coquery, K. M. Wittkowski, N. Bhardwaj, et al 2001. Immune and clinical responses in patients with metastatic melanoma to CD34+ progenitor-derived dendritic cell vaccine. Cancer Res. 61:6451.[Abstract/Free Full Text]
  9. Schuler-Thurner, B., E. S. Schultz, T. G. Berger, G. Weinlich, S. Ebner, P. Woerl, A. Bender, B. Feuerstein, P. O. Fritsch, N. Romani, et al 2002. Rapid induction of tumor-specific type 1 T helper cells in metastatic melanoma patients by vaccination with mature, cryopreserved, peptide-loaded monocyte-derived dendritic cells. J. Exp. Med. 195:1279.[Abstract/Free Full Text]
  10. Ranieri, E., W. Herr, A. Gambotto, W. Olson, D. Rowe, P. D. Robbins, L. S. Kierstead, S. C. Watkins, L. Gesualdo, W. J. Storkus. 1999. Dendritic cells transduced with an adenovirus vector encoding Epstein-Barr virus latent membrane protein 2B: a new modality for vaccination. J. Virol. 73:10416.[Abstract/Free Full Text]
  11. Brossart, P., A. W. Goldrath, E. A. Butz, S. Martin, M. J. Bevan. 1997. Virus-mediated delivery of antigenic epitopes into dendritic cells as a means to induce CTL. J. Immunol. 158:3270.[Abstract]
  12. Heemskerk, M. H., E. Hooijberg, J. J. Ruizendaal, M. M. van der Weide, E. Kueter, A. Q. Bakker, T. N. Schumacher, H. Spits. 1999. Enrichment of an antigen-specific T cell response by retrovirally transduced human dendritic cells. Cell. Immunol. 195:10.[Medline]
  13. Meyer zum Buschenfelde, C., N. Nicklisch, S. Rose-John, C. Peschel, H. Bernhard. 2000. Generation of tumor-reactive CTL against the tumor-associated antigen HER2 using retrovirally transduced dendritic cells derived from CD34+ hemopoietic progenitor cells. J. Immunol. 165:4133.[Abstract/Free Full Text]
  14. Temme, A., A. Morgenroth, M. Schmitz, B. Weigle, J. Rohayem, D. Lindemann, M. Fussel, G. Ehninger, E. P. Rieber. 2002. Efficient transduction and long-term retroviral expression of the melanoma-associated tumor antigen tyrosinase in CD34+ cord blood-derived dendritic cells. Gene Ther. 9:1551.[Medline]
  15. Sallberg, M., K. Townsend, M. Chen, J. O’Dea, T. Banks, D. J. Jolly, S. M. Chang, W. T. Lee, D. R. Milich. 1997. Characterization of humoral and CD4+ cellular responses after genetic immunization with retroviral vectors expressing different forms of the hepatitis B virus core and e antigens. J. Virol. 71:5295.[Abstract]
  16. Song, E. S., V. Lee, C. D. Surh, A. Lynn, D. Brumm, D. J. Jolly, J. F. Warner, S. Chada. 1997. Antigen presentation in retroviral vector-mediated gene transfer in vivo. Proc. Natl. Acad. Sci. USA 94:1943.[Abstract/Free Full Text]
  17. Dyall, J., J. B. Latouche, S. Schnell, M. Sadelain. 2001. Lentivirus-transduced human monocyte-derived dendritic cells efficiently stimulate antigen-specific cytotoxic T lymphocytes. Blood 97:114.[Abstract/Free Full Text]
  18. Esslinger, C., P. Romero, H. R. MacDonald. 2002. Efficient transduction of dendritic cells and induction of a T-cell response by third-generation lentivectors. Hum. Gene Ther. 13:1091.[Medline]
  19. Miller, G., S. Lahrs, V. G. Pillarisetty, A. B. Shah, R. P. DeMatteo. 2002. Adenovirus infection enhances dendritic cell immunostimulatory properties and induces natural killer and T-cell-mediated tumor protection. Cancer Res. 62:5260.[Abstract/Free Full Text]
  20. Salio, M., M. Cella, M. Suter, A. Lanzavecchia. 1999. Inhibition of dendritic cell maturation by herpes simplex virus. Eur. J. Immunol. 29:3245.[Medline]
  21. Metharom, P., K. A. Ellem, C. Schmidt, M. Q. Wei. 2001. Lentiviral vector-mediated tyrosinase-related protein 2 gene transfer to dendritic cells for the therapy of melanoma. Hum. Gene Ther. 12:2203.[Medline]
  22. VandenDriessche, T., L. Thorrez, L. Naldini, A. Follenzi, L. Moons, Z. Berneman, D. Collen, M. K. Chuah. 2002. Lentiviral vectors containing the human immunodeficiency virus type-1 central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo. Blood 100:813.[Abstract/Free Full Text]
  23. Esslinger, C., L. Chapatte, D. Finke, I. Miconnet, P. Guillaume, F. Levy, H. R. MacDonald. 2003. In vivo administration of a lentiviral vaccine targets DCs and induces efficient CD8+ T cell responses. J. Clin. Invest. 111:1673.[Medline]
  24. Firat, H., V. Zennou, F. Garcia-Pons, F. Ginhoux, M. Cochet, O. Danos, F. A. Lemonnier, P. Langlade-Demoyen, P. Charneau. 2002. Use of a lentiviral flap vector for induction of CTL immunity against melanoma: perspectives for immunotherapy. J. Gene Med. 4:38.[Medline]
  25. Chen, Y. T., M. J. Scanlan, U. Sahin, O. Tureci, A. O. Gure, S. Tsang, B. Williamson, E. Stockert, M. Pfreundschuh, L. J. Old. 1997. A testicular antigen aberrantly expressed in human cancers detected by autologous antibody screening. Proc. Natl. Acad. Sci. USA 94:1914.[Abstract/Free Full Text]
  26. Schultz-Thater, E., C. Noppen, F. Gudat, U. Durmuller, P. Zajac, T. Kocher, M. Heberer, G. C. Spagnoli. 2000. NY-ESO-1 tumour associated antigen is a cytoplasmic protein detectable by specific monoclonal antibodies in cell lines and clinical specimens. Br. J. Cancer 83:204.[Medline]
  27. Jager, D., E. Jager, A. Knuth. 2001. Immune responses to tumour antigens: implications for antigen specific immunotherapy of cancer. J. Clin. Pathol. 54:669.[Abstract/Free Full Text]
  28. Jager, E., Y. T. Chen, J. W. Drijfhout, J. Karbach, M. Ringhoffer, D. Jager, M. Arand, H. Wada, Y. Noguchi, E. Stockert, et al 1998. Simultaneous humoral and cellular immune response against cancer-testis antigen NY-ESO-1: definition of human histocompatibility leukocyte antigen (HLA)-A2-binding peptide epitopes. J. Exp. Med. 187:265.[Abstract/Free Full Text]
  29. Jager, E., D. Jager, J. Karbach, Y. T. Chen, G. Ritter, Y. Nagata, S. Gnjatic, E. Stockert, M. Arand, L. J. Old, et al 2000. Identification of NY-ESO-1 epitopes presented by human histocompatibility antigen (HLA)-DRB4*0101–0103 and recognized by CD4+ T lymphocytes of patients with NY-ESO-1-expressing melanoma. J. Exp. Med. 191:625.[Abstract/Free Full Text]
  30. Zarour, H. M., W. J. Storkus, V. Brusic, E. Williams, J. M. Kirkwood. 2000. NY-ESO-1 encodes DRB1*0401-restricted epitopes recognized by melanoma-reactive CD4+ T cells. Cancer Res. 60:4946.[Abstract/Free Full Text]
  31. Zeng, G., C. E. Touloukian, X. Wang, N. P. Restifo, S. A. Rosenberg, R. F. Wang. 2000. Identification of CD4+ T cell epitopes from NY-ESO-1 presented by HLA-DR molecules. J. Immunol. 165:1153.[Abstract/Free Full Text]
  32. Zeng, G., X. Wang, P. F. Robbins, S. A. Rosenberg, R. F. Wang. 2001. CD4+ T cell recognition of MHC class II-restricted epitopes from NY-ESO-1 presented by a prevalent HLA DP4 allele: association with NY-ESO-1 antibody production. Proc. Natl. Acad. Sci. USA 98:3964.[Abstract/Free Full Text]
  33. Valmori, D., V. Dutoit, D. Lienard, D. Rimoldi, M. J. Pittet, P. Champagne, K. Ellefsen, U. Sahin, D. Speiser, F. Lejeune, et al 2000. Naturally occurring human lymphocyte antigen-A2 restricted CD8+ T-cell response to the cancer testis antigen NY-ESO-1 in melanoma patients. Cancer Res. 60:4499.[Abstract/Free Full Text]
  34. Gnjatic, S., Y. Nagata, E. Jager, E. Stockert, S. Shankara, B. L. Roberts, G. P. Mazzara, S. Y. Lee, P. R. Dunbar, B. Dupont, et al 2000. Strategy for monitoring T cell responses to NY-ESO-1 in patients with any HLA class I allele. Proc. Natl. Acad. Sci. USA 97:10917.[Abstract/Free Full Text]
  35. Palmowski, M. J., E. M. Choi, I. F. Hermans, S. C. Gilbert, J. L. Chen, U. Gileadi, M. Salio, A. Van Pel, S. Man, E. Bonin, et al 2002. Competition between CTL narrows the immune response induced by prime-boost vaccination protocols. J. Immunol. 168:4391.[Abstract/Free Full Text]
  36. Demaison, C., K. Parsley, G. Brouns, M. Scherr, K. Battmer, C. Kinnon, M. Grez, A. J. Thrasher. 2002. High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency [correction of imunodeficiency] virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter. Hum. Gene Ther. 13:803.[Medline]
  37. Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15:871.[Medline]
  38. Neil, S., F. Martin, Y. Ikeda, M. Collins. 2001. Postentry restriction to human immunodeficiency virus-based vector transduction in human monocytes. J. Virol. 75:5448.[Abstract/Free Full Text]
  39. Inaba, K., M. Inaba, M. Deguchi, K. Hagi, R. Yasumizu, S. Ikehara, S. Muramatsu, R. M. Steinman. 1993. Granulocytes, macrophages, and dendritic cells arise from a common major histocompatibility complex class II-negative progenitor in mouse bone marrow. Proc. Natl. Acad. Sci. USA 90:3038.[Abstract/Free Full Text]
  40. Firat, H., F. Garcia-Pons, S. Tourdot, S. Pascolo, A. Scardino, Z. Garcia, M. L. Michel, R. W. Jack, G. Jung, K. Kosmatopoulos, et al 1999. H-2 class I knockout, HLA-A2.1-transgenic mice: a versatile animal model for preclinical evaluation of antitumor immunotherapeutic strategies. Eur. J. Immunol. 29:3112.[Medline]
  41. Chen, J. L., P. R. Dunbar, U. Gileadi, E. Jager, S. Gnjatic, Y. Nagata, E. Stockert, D. L. Panicali, Y. T. Chen, A. Knuth, et al 2000. Identification of NY-ESO-1 peptide analogues capable of improved stimulation of tumor-reactive CTL. J. Immunol. 165:948.[Abstract/Free Full Text]
  42. Choi, E. M., M. Palmowski, J. Chen, V. Cerundolo. 2002. The use of chimeric A2K(b) tetramers to monitor HLA A2 immune responses in HLA A2 transgenic mice. J. Immunol. Methods 268:35.[Medline]
  43. Gruber, A., J. Kan-Mitchell, K. L. Kuhen, T. Mukai, F. Wong-Staal. 2000. Dendritic cells transduced by multiply deleted HIV-1 vectors exhibit normal phenotypes and functions and elicit an HIV-specific cytotoxic T-lymphocyte response in vitro. Blood 96:1327.[Abstract/Free Full Text]
  44. Granelli-Piperno, A., L. Zhong, P. Haslett, J. Jacobson, R. M. Steinman. 2000. Dendritic cells, infected with vesicular stomatitis virus-pseudotyped HIV-1, present viral antigens to CD4+ and CD8+ T cells from HIV-1-infected individuals. J. Immunol. 165:6620.[Abstract/Free Full Text]
  45. Sharpe, S., N. Polyanskaya, M. Dennis, G. Sutter, T. Hanke, V. Erfle, V. Hirsch, M. Cranage. 2001. Induction of simian immunodeficiency virus (SIV)-specific CTL in rhesus macaques by vaccination with modified vaccinia virus Ankara expressing SIV transgenes: influence of pre-existing anti-vector immunity. J. Gen. Virol. 82:2215.[Abstract/Free Full Text]
  46. Kedl, R. M., W. A. Rees, D. A. Hildeman, B. Schaefer, T. Mitchell, J. Kappler, P. Marrack. 2000. T cells compete for access to antigen-bearing antigen-presenting cells. J. Exp. Med. 192:1105.[Abstract/Free Full Text]
  47. Hacein-Bey-Abina, S., C. von Kalle, M. Schmidt, F. Le Deist, N. Wulffraat, E. McIntyre, I. Radford, J. L. Villeval, C. C. Fraser, M. Cavazzana-Calvo, et al 2003. A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N. Engl. J. Med. 348:255.[Free Full Text]
  48. Knight, S. C., S. E. Macatonia, S. Patterson. 1990. HIV I infection of dendritic cells. Int. Rev. Immunol. 6:163.[Medline]
  49. Steinman, R. M.. 2000. DC-SIGN: a guide to some mysteries of dendritic cells. Cell 100:491.[Medline]
  50. Messmer, D., J. M. Jacque, C. Santisteban, C. Bristow, S. Y. Han, L. Villamide-Herrera, E. Mehlhop, P. A. Marx, R. M. Steinman, A. Gettie, et al 2002. Endogenously expressed nef uncouples cytokine and chemokine production from membrane phenotypic maturation in dendritic cells. J. Immunol. 169:4172.[Abstract/Free Full Text]
  51. Izmailova, E., F. M. Bertley, Q. Huang, N. Makori, C. J. Miller, R. A. Young, A. Aldovini. 2003. HIV-1 Tat reprograms immature dendritic cells to express chemoattractants for activated T cells and macrophages. Nat. Med. 9:191.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
D. Escors, L. Lopes, R. Lin, J. Hiscott, S. Akira, R. J. Davis, and M. K. Collins
Targeting dendritic cell signaling to regulate the response to immunization
Blood, March 15, 2008; 111(6): 3050 - 3061.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Lopes, M. Dewannieux, U. Gileadi, R. Bailey, Y. Ikeda, C. Whittaker, M. P. Collin, V. Cerundolo, M. Tomihari, K. Ariizumi, et al.
Immunization with a Lentivector That Targets Tumor Antigen Expression to Dendritic Cells Induces Potent CD8+ and CD4+ T-Cell Responses
J. Virol., January 1, 2008; 82(1): 86 - 95.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-S. Chung, I. Dougherty, P. D. Cruz Jr., and K. Ariizumi
Syndecan-4 Mediates the Coinhibitory Function of DC-HIL on T Cell Activation
J. Immunol., November 1, 2007; 179(9): 5778 - 5784.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Pichlmair, S. S. Diebold, S. Gschmeissner, Y. Takeuchi, Y. Ikeda, M. K. Collins, and C. Reis e Sousa
Tubulovesicular Structures within Vesicular Stomatitis Virus G Protein-Pseudotyped Lentiviral Vector Preparations Carry DNA and Stimulate Antiviral Responses via Toll-Like Receptor 9
J. Virol., January 15, 2007; 81(2): 539 - 547.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Sato, X.-l. Yang, T. Yudate, J.-S. Chung, J. Wu, K. Luby-Phelps, R. P. Kimberly, D. Underhill, P. D. Cruz Jr., and K. Ariizumi
Dectin-2 Is a Pattern Recognition Receptor for Fungi That Couples with the Fc Receptor {gamma} Chain to Induce Innate Immune Responses
J. Biol. Chem., December 15, 2006; 281(50): 38854 - 38866.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. A. Noser, G. J. Towers, R. Sakuma, J.-M. Dumont, M. K. L. Collins, and Y. Ikeda
Cyclosporine increases human immunodeficiency virus type 1 vector transduction of primary mouse cells.
J. Virol., August 1, 2006; 80(15): 7769 - 7774.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. J. Palmowski, U. Gileadi, M. Salio, A. Gallimore, M. Millrain, E. James, C. Addey, D. Scott, J. Dyson, E. Simpson, et al.
Role of Immunoproteasomes in Cross-Presentation
J. Immunol., July 15, 2006; 177(2): 983 - 990.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Purbhoo, D. H. Sutton, J. E. Brewer, R. E. Mullings, M. E. Hill, T. M. Mahon, J. Karbach, E. Jager, B. J. Cameron, N. Lissin, et al.
Quantifying and Imaging NY-ESO-1/LAGE-1-Derived Epitopes on Tumor Cells Using High Affinity T Cell Receptors.
J. Immunol., June 15, 2006; 176(12): 7308 - 7316.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Buffa, D. R. M. Negri, P. Leone, R. Bona, M. Borghi, I. Bacigalupo, D. Carlei, C. Sgadari, B. Ensoli, and A. Cara
A single administration of lentiviral vectors expressing either full-length human immunodeficiency virus 1 (HIV-1)HXB2 Rev/Env or codon-optimized HIV-1JR-FL gp120 generates durable immune responses in mice
J. Gen. Virol., June 1, 2006; 87(6): 1625 - 1634.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Chapatte, S. Colombetti, J.-C. Cerottini, and F. Levy
Efficient Induction of Tumor Antigen-Specific CD8+ Memory T Cells by Recombinant Lentivectors
Cancer Res., January 15, 2006; 66(2): 1155 - 1160.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. L. Strang, Y. Takeuchi, T. Relander, J. Richter, R. Bailey, D. A. Sanders, M. K. L. Collins, and Y. Ikeda
Human Immunodeficiency Virus Type 1 Vectors with Alphavirus Envelope Glycoproteins Produced from Stable Packaging Cells
J. Virol., February 1, 2005; 79(3): 1765 - 1771.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palmowski, M. J.
Right arrow Articles by Collins, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palmowski, M. J.
Right arrow Articles by Collins, M. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS