|
|
||||||||



* Tumour Immunology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom; and
Department of Immunology and Molecular Pathology, Windeyer Institute, University College, London, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The development of recombinant viral vector systems for gene therapy has prompted examination of their efficacy in gene delivery to DC and in direct immunization. Adenovirus vectors were shown to deliver Ag genes to human (10) or mouse (11) DC in vitro. The endogenously synthesized Ag was efficiently presented to CD8+ T cells; however pre-existing immunity to viral proteins expressed by the vector prevented effective immunization (11). Retroviral vectors based on murine leukemia virus (MLV) have also been used to express Ags in human DC, which could be efficiently presented to CD8+ T cells (12, 13, 14). However, MLV-based vectors only infect dividing cells, so the human DC had to be generated from CD34+ hemopoietic progenitor cells. Injection of MLV-based vector into mice could stimulate immunity (15) and resulted in some transduction of DC, but at low efficiency (16).
Like retroviral vectors, lentiviral vectors based on HIV-1 do not encode any viral proteins. This eliminates problems of pre-existing immunity and avoids competition in the generation of anti-vector vs anti-transgene CTL. Lentiviral vectors can infect nondividing, human peripheral blood-derived DC, and transduced human DC expressing antigenic peptides can stimulate specific CTL responses in vitro (17, 18). An advantage of lentiviral vectors is that they do not activate DC constitutively, like adenoviral vectors (19), or block their activation, like herpes simplex viral vectors (20). Previous studies have used lentiviral vectors expressing a tumor Ag to infect mouse DC in vitro before injection, and CTL responses (18) and tumor protection were established in the mice (21). Direct injection of lentiviruses in mice has been reported to transduce APCs and B cells in spleen (22) and DC in a draining lymph node (23). Direct injection of lentiviral vectors expressing peptide epitopes or a HLA-Cw3 transgene in HLA-A2 transgenic mice has been shown to induce lytic activity against peptide-pulsed targets (24) and peptide or transgene-specific CTL responses (23).
Our aim was to develop HIV-1-based vectors that efficiently expressed a tumor Ag in mouse DC. As an Ag we chose NY-ESO-1 (25), a cytoplasmic protein (26) expressed in melanoma and other tumors. NY-ESO-1 is highly immunogenic, eliciting a spontaneous immune response in 50% of patients with NY-ESO-1-expressing cancers (reviewed in Ref.27). NY-ESO-1 elicits a combined Ab and T cell response (28). Several epitopes of NY-ESO-1 presented by HLA class II molecules (29, 30, 31, 32) and HLA class I molecules (28, 33, 34) have been identified. Previous work from our group has shown that priming of HLA-A2 (A2) transgenic mice with plasmid DNA and recombinant vaccinia virus encoding the A2-restricted epitope NY-ESO-1157165 elicits a strong NY-ESO-1157165-specific CTL response (35).
| Materials and Methods |
|---|
|
|
|---|
The green fluorescence protein (GFP)-expressing HIV vector pHRSIN-CSGW was provided by A. Thrasher (Institute of Child Health, London, U.K.) (36). In pHRSIN-NY, an NY-ESO-1 cDNA replaces GFP. To make virus, 293T cells were cotransfected with pHRSIN-NY, pCMVR8.91, and pMDG plasmids (37) as previously described (38). Unenveloped NY-ESO-1-lentivirus was produced by transfection without pMDG. Culture supernatants were concentrated by ultracentrifugation. Titers were determined on 293T cells by measurement of GFP or NY-ESO-1-expression, using a FACScan and CellQuest software (BD Biosciences, Mountain View, CA). NY-ESO-1 was detected in cells fixed with 4% paraformaldehyde and permeabilized in 0.1% saponin using an anti-NY-ESO-1 Ab (gift from Dr. G. Spagnoli, University Hospital, Basel, Switzerland) (26) and goat anti-mouse Texas Red conjugate (Molecular Probes, Eugene, OR).
Infection of .45 cells and immunoblotting analysis
Cells from the EBV-transformed, HLA-A2+ B cell line .45 were infected with GFP- or NY-ESO-1-expressing vector at MOI 20. Two weeks later, when >90% of the cells were positive for NY-ESO-1 expression, total protein was separated on a 12% denaturing SDS-polyacrylamide gel. Expression of NY-ESO-1 was detected with the anti-NY-ESO-1 Ab and goat anti-mouse HRP (Harlan, Indianapolis, IN).
Transduction of DC
Mouse DC were prepared from bone marrow as previously described (39). Human monocytes were isolated with CD14 beads (Miltenyi Biotec, Auburn, CA) and differentiated into DC in RPMI 1640 with 10% FCS, IL-4 (50 ng/ml), and GM-CSF (1000 U/ml). Day 45 immature human or murine DCs were transduced with GFP-, NY-ESO-1-, or NY-ESO-1-noEnv lentiviruses at MOI 40. DCs were analyzed for GFP, NY-ESO-1, CD11c (BD PharMingen, San Diego, CA), and CD1a (eBioscience, San Diego, CA) expression after 5 days by fluorescence microscopy (Axiovert 100 (Zeiss, Oberkocken, Germany) with a MRC 1024 Confocal (Bio-Rad, Hercules, CA)) or FACScan. Mouse DC were cultured for 4 days after transduction and incubated with 20 µg/ml CpG, to induce maturation before injection. Human DC were cultured for 4 days after transduction, then matured by cultivation with CD40 ligand-expressing J558L cells (gift from Dr. P. Lane, Birmingham, U.K.) before use in an ELISPOT assay. In some experiments mouse DC were purified from splenocytes using CD11c microbeads (Miltenyi Biotec). DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). Detection of the enhanced GFP sequence was conducted by nested PCR using enhanced GFP-specific primers and Ex-Taq (Takara, Ohtsu, Japan). Primer pair F1 and R1 was used for the first reaction with 0.4 µg of the total cellular DNA as a template. Primer pair F2 and R2 was used for the second reaction with 4 µl of the first PCR reactions as template: F1, atggtgagcaagggcgaggagctg; R1, tagtggttgtcgggcagcagcacg; F2, ggtggtgcccatcctggtcgag; and R2, tgctggtagtggtcggcgagctgc.
Mice and immunization
HHD mice (40) were immunized by injecting lentiviral vectors or bone marrow-derived DC transduced with lentiviral vectors suspended in PBS into the tail vein. Blood samples were taken 8 days after immunization. Some mice were primed with plasmid DNA encoding full-length NY-ESO-1 or boosted by injecting 106 PFU recombinant vaccinia virus encoding full-length NY-ESO-1 into the tail vein. PBL were prepared from blood samples using RBC lysis buffer (Invitrogen, Carlsbad, CA). Cells were resuspended in RPMI 1640 (Sigma-Aldrich, St. Louis, MO) supplemented with 10% FCS. PBL samples were stained with NY-ESO-1 tetramer for 20 min at 37°C, then cells were costained with anti-CD8-
(Caltag Laboratories, Burlingame, CA), washed, and analyzed on a FACSCalibur using CellQuest software (BD Biosciences).
CTL killing, ELISPOT assay
The human HLA-A2.01 (A2)-positive B cell line .45 transduced with lentiviruses (see above) was labeled with 51Cr and incubated with a CTL clone specific for the A2-restricted NY-ESO-1 epitope 157165 (41). Specific lysis was determined according to this formula: ((experimental release - spontaneous release)/(total release - spontaneous release)) x 100. Transduced human DC (104; see above) were incubated with 102 NY-ESO-1157165-specific CTL clone in anti-IFN-
(MabTech, Nacka, Sweden)-coated ELISPOT plates (Millipore, Watford, U.K.). Plates were developed according to the manufacturers directions.
In vivo killing assay
Freshly isolated splenocytes from HHD mice were incubated in RPMI 1640 medium with 1 µM peptide for 2 h and labeled with CFSE (Molecular Probes, Eugene, OR). Labeled cells were injected at 107 cells/mouse into the tail vein with a control population without peptide that had been labeled with a different concentration of CFSE. Disappearance of peptide/fluorochrome-labeled cells was tracked using FACS analysis of freshly isolated PBL 5 h after the injection. The level of specific cytotoxicity was calculated relative to the labeled unpulsed population using the following calculation: 100 x (100 - (percentage pulsed/percentage unpulsed)). WinMDI 2.8 software (J. Trotter, The Scripps Institute, La Jolla, CA; http://facs.scripps.edu) and CellQuest 3.3 software (BD Biosciences) were used to analyze the FACS data.
| Results |
|---|
|
|
|---|
The HIV-1-based vector pHRSIN-CSGW was developed for high level, sustained transgene expression in human hemopoietic stem cells and their progeny (36). Fig. 1A shows that this vector transduced mouse bone marrow-derived DC cultures. Preferential GFP expression in the CD11c+ cells was seen, with up to 50% of CD11c+ cells expressing GFP. Transduction in vivo was then examined by injection of 5 x 107 293T infectious units (i.u.) in the tail vein, followed by analysis of GFP expression in spleen cells. Fig. 1B demonstrates that CD11c+ GFP+ cells were also detected in vivo (a typical mouse is shown); 0.3 and 0.4% of CD11c+ cells purified from spleen expressed GFP after 9 days in duplicate experiments. A similar percentage of GFP+/CD11c+ cells was detected in spleen between 5 and 12 days after GFP lentiviral vector injection (data not shown). The CD11c+ cells were transduced by the lentiviral vector, as demonstrated by the detection of GFP DNA in these cells (Fig. 1C). Injection of a control vector preparation without viral envelope did not result in GFP DNA detection (Fig. 1C). A previous study injected a higher dose of an essentially identical lentiviral vector in the tail vein of mice and demonstrated long term transduction of both APCs and B cells in spleen (22). It is therefore likely that CD11c- B cells are also transduced in our experiments. Injection of a lentiviral vector in the footpad transduced DC in the draining lymph node (23).
|
To address whether in vivo transduction resulted in the induction of Ag-specific CTL, HLA-A2 transgenic (HHD) mice were injected with escalating doses of lentiviral vector encoding the tumor testis Ag NY-ESO-1. CTL responses were monitored in the blood by staining of PBL with a chimeric A2Kb/peptide tetramer (35, 42) (Fig. 2). At the highest dose, NY-ESO-1157165-specific CD8+ cells could be detected in peripheral blood after injection; typical mice and a summary are shown in Fig. 2A. When the same group of animals was boosted with NY-ESO-1 recombinant vaccinia virus, NY-ESO-1157165-specific CD8+ cells could be detected in all three groups of mice (Fig. 2A). Control mice injected with NY-ESO-1 vaccinia alone or mice boosted with irrelevant vaccinia virus showed only a weak NY-ESO-1157165-specific response (mean responses, 0.025% CD8+ cells after NY-ESO-1 vaccinia alone, 0.25% CD8+ cells after NY-ESO-1 lentivirus, followed by irrelevant vaccinia virus). The NY-ESO-1157165-specific CD8+ cells induced by lentiviral vector priming were effective CTL, as demonstrated by their ability to kill NY-ESO-1157165 peptide-pulsed target cells in vivo (Fig. 2B).
|
Direct injection of 5 x 105 (293T i.u.) lentiviruses was able to prime an effective response. We therefore examined the efficiency of NY-ESO-1 lentiviral vector-transduced DC as immunogens. Because human and mouse DC are relatively refractory to lentiviral vector transduction, 4 x 107 i.u. were required to infect
50% of 106 mouse DC. As a control, unenveloped virus was also used in a mock infection of DC, as phagocytic DC can ingest and present proteins from lentiviral vector preparations. Fig. 3 shows that NY-ESO-1157165-specific CD8+ cells could be detected in peripheral blood of mice that received NY-ESO-1-transduced DC. This response could also be boosted with NY-ESO-1 vaccinia virus (Fig. 3). The boosted response after priming by transduced DC was not substantially higher than boosted responses after direct vector injection.
|
To show that this approach might ultimately be used in clinical settings, we wanted to demonstrate that the NY-ESO-1 lentivirus could induce NY-ESO-1157165 peptide presentation in human APC. The human EBV-transformed B cell line .45 was transduced with NY-ESO-1 lentivirus. Expression of NY-ESO-1 was detected by Western blot (Fig. 4A), and FACS analysis showed that
90% of cells were NY-ESO-1-positive by intracellular staining (data not shown). NY-ESO-1157165 peptide presentation by the B cells was demonstrated in a 51Cr release assay using an NY-ESO-1157165-specific, HLA-A2-restricted CTL clone (Fig. 4A). We then used the NY-ESO-1 lentiviral vector to transduce human HLA-A2+, monocyte-derived DC, using a protocol that we previously reported can transduce up to 30% of DC without affecting their viability or ability to mature (38). Fig. 4B shows cytoplasmic expression of NY-ESO-1 in
30% of the transduced CD1a+ DC. To demonstrate that the transduced DC could present an epitope from the cytoplasmic NY-ESO-1 protein, we used an NY-ESO-1157165-specific CTL clone isolated by tetramer sorting from peripheral blood of a melanoma patient. Fig. 4C shows that the transduced DC could stimulate IFN-
secretion by this NY-ESO-1157165-specific CTL clone in an ELISPOT assay. These data show that both immature and mature DC stably modified to express a cytoplasmic protein can present an epitope from that protein to CD8+ T cells. Previous reports using lentiviral vectors (17) or varicella-zoster virus (VSV)-G-pseudotyped HIV-1 (43, 44) to modify human DC have examined presentation of CTL epitopes engineered for secretion into the endoplasmic reticulum (17, 18) or HIV-1 Gag that buds from the cell (43, 44).
|
| Discussion |
|---|
|
|
|---|
Lentiviral vectors are attractive for prime/boost protocols because there are no pre-existing neutralizing Abs to heterologous envelopes, such as VSV-G, that might inhibit CTL priming (45). Furthermore, as the vector encodes only the immunizing Ag, transduced APC will not express viral proteins that might inhibit priming due to competition by CTL at the APC (46). Heterologous prime/boost may be more efficient than homologous boost with lentivirus, as pre-existing anti lentiviral vector responses have been shown to inhibit immunization (22). Clearly, lentiviral vector safety will require rigorous testing before clinical trials, as there is potential for similar insertional mutagenesis to that seen with retroviral vectors (47). However, transduction of nondividing DCs is likely to be less oncogenic than transduction of rapidly proliferating hemopoietic stem cells; targeting vector to DCs may also enhance its safety. Although it is clear from our data that DC transduced ex vivo can prime an immune response, we cannot be sure that the CD11c+ cells transduced after i.v. injection are the cells responsible for immune stimulation. Again, surface or transcriptional targeting of NY-ESO-1 expression to DC will resolve this question.
HIV-1 itself infects DC in vitro and in patients, which may serve as a reservoir of infected cells (48), and also traffics to lymphoid tissue bound to the DC surface (49). To evade the immune response, wild-type HIV-1 has been reported to modulate DC function by a number of strategies, including Nef and Tat induction of cytokine and chemokine production in the absence of maturation (50, 51). It has been proposed that this serves to attract T cells, permitting HIV-1 transmission from DC without stimulating an immune response. HIV-1 viruses deleted in envelope (44) or envelope Nef, Vif, Vpr, and Vpu (43) and pseudotyped with VSV-G have been shown to infect DC in vitro and stimulate Gag-specific T cells. The lentiviral vectors we used in this study are further deleted for Tat, Rev, and HIV-1 Gag and Pol proteins, which will increase their immune stimulatory potential and focus the immune response on the NY-ESO-1 transgene. Indeed, the coding capacity of the lentiviral vectors will allow us to express potentially immunostimulatory molecules together with the Ag gene in future studies.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mary K. Collins, Department of Immunology and Molecular Pathology, Windeyer Institute, 46 Cleveland Street, London, U.K. W1T 4JF. E-mail address: mary.collins{at}ucl.ac.uk ![]()
3 Abbreviations used in this paper: DC, dendritic cell; GFP, green fluorescence protein; i.u., infectious unit; MLV, murine leukemia virus; VSV, varicella-zoster virus. ![]()
Received for publication June 18, 2003. Accepted for publication November 13, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Escors, L. Lopes, R. Lin, J. Hiscott, S. Akira, R. J. Davis, and M. K. Collins Targeting dendritic cell signaling to regulate the response to immunization Blood, March 15, 2008; 111(6): 3050 - 3061. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lopes, M. Dewannieux, U. Gileadi, R. Bailey, Y. Ikeda, C. Whittaker, M. P. Collin, V. Cerundolo, M. Tomihari, K. Ariizumi, et al. Immunization with a Lentivector That Targets Tumor Antigen Expression to Dendritic Cells Induces Potent CD8+ and CD4+ T-Cell Responses J. Virol., January 1, 2008; 82(1): 86 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Chung, I. Dougherty, P. D. Cruz Jr., and K. Ariizumi Syndecan-4 Mediates the Coinhibitory Function of DC-HIL on T Cell Activation J. Immunol., November 1, 2007; 179(9): 5778 - 5784. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pichlmair, S. S. Diebold, S. Gschmeissner, Y. Takeuchi, Y. Ikeda, M. K. Collins, and C. Reis e Sousa Tubulovesicular Structures within Vesicular Stomatitis Virus G Protein-Pseudotyped Lentiviral Vector Preparations Carry DNA and Stimulate Antiviral Responses via Toll-Like Receptor 9 J. Virol., January 15, 2007; 81(2): 539 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato, X.-l. Yang, T. Yudate, J.-S. Chung, J. Wu, K. Luby-Phelps, R. P. Kimberly, D. Underhill, P. D. Cruz Jr., and K. Ariizumi Dectin-2 Is a Pattern Recognition Receptor for Fungi That Couples with the Fc Receptor {gamma} Chain to Induce Innate Immune Responses J. Biol. Chem., December 15, 2006; 281(50): 38854 - 38866. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Noser, G. J. Towers, R. Sakuma, J.-M. Dumont, M. K. L. Collins, and Y. Ikeda Cyclosporine increases human immunodeficiency virus type 1 vector transduction of primary mouse cells. J. Virol., August 1, 2006; 80(15): 7769 - 7774. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Palmowski, U. Gileadi, M. Salio, A. Gallimore, M. Millrain, E. James, C. Addey, D. Scott, J. Dyson, E. Simpson, et al. Role of Immunoproteasomes in Cross-Presentation J. Immunol., July 15, 2006; 177(2): 983 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Purbhoo, D. H. Sutton, J. E. Brewer, R. E. Mullings, M. E. Hill, T. M. Mahon, J. Karbach, E. Jager, B. J. Cameron, N. Lissin, et al. Quantifying and Imaging NY-ESO-1/LAGE-1-Derived Epitopes on Tumor Cells Using High Affinity T Cell Receptors. J. Immunol., June 15, 2006; 176(12): 7308 - 7316. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Buffa, D. R. M. Negri, P. Leone, R. Bona, M. Borghi, I. Bacigalupo, D. Carlei, C. Sgadari, B. Ensoli, and A. Cara A single administration of lentiviral vectors expressing either full-length human immunodeficiency virus 1 (HIV-1)HXB2 Rev/Env or codon-optimized HIV-1JR-FL gp120 generates durable immune responses in mice J. Gen. Virol., June 1, 2006; 87(6): 1625 - 1634. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chapatte, S. Colombetti, J.-C. Cerottini, and F. Levy Efficient Induction of Tumor Antigen-Specific CD8+ Memory T Cells by Recombinant Lentivectors Cancer Res., January 15, 2006; 66(2): 1155 - 1160. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Strang, Y. Takeuchi, T. Relander, J. Richter, R. Bailey, D. A. Sanders, M. K. L. Collins, and Y. Ikeda Human Immunodeficiency Virus Type 1 Vectors with Alphavirus Envelope Glycoproteins Produced from Stable Packaging Cells J. Virol., February 1, 2005; 79(3): 1765 - 1771. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |