|
|
||||||||







,
* Interdepartmental Program in Vascular Biology and Transplantation, Boyer Center for Molecular Medicine and Departments of
Pathology and
Dermatology, Yale University School of Medicine, New Haven CT 06510; and
ISIS Pharmaceuticals, Carlsbad, CA 92008
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
IL-11 is a pleiotropic cytokine that shows anti-inflammatory, immunomodulatory, and cytoprotective effects (7). IL-11 decreases injury in a number of animal models of acute and chronic inflammation (8, 9, 10, 11, 12). Daily intradermal (i.d.) injections of IL-11 also reduce injury and inflammation in human psoriatic skin lesions (13). We have previously demonstrated that low-dose IL-11 can inhibit T cell-mediated injury in cultured EC but had no effects on EC inflammatory responses such as TNF-induced adhesion molecule expression (14). The protective effect is dependent on new protein synthesis, consistent with the idea that IL-11 induces expression of a cytoprotective protein, and we have demonstrated that IL-11 causes induction of survivin, an inhibitor of apoptosis (IAP) family member, in cultured EC (15). There are no observations linking survivin expression to resistance to T cell-mediated injury. It has proven difficult to link any candidate protective proteins induced in cultured EC to cytoprotection because these cells depend upon the presence of growth factors for survival in vitro, and growth factors act, in part, by up-regulating multiple antiapoptotic genes, including survivin. Thus, we could only examine the response to IL-11 in cultured cells about to undergo apoptosis due to growth factor withdrawal. For this reason, it is actually easier to dissect the cytoprotective mechanism of action of IL-11 in vivo using our SCID mouse skin graft model. Our previous studies have shown that in human skin xenografts, i.d. injected IL-11 induces survivin expression in both keratinocytes and dermal microvascular EC (15). The objectives of the current study were to determine whether IL-11 could protect endothelium from T cell-mediated damage in vivo and, if so, could we attribute this effect to induction of survivin. These studies confirm that IL-11 provides significant but incomplete protection of the microvasculature from T cell-mediated allograft rejection without reduction in inflammation or evidence of immunomodulation. Moreover, down-regulation of survivin expression by means of topical antisense oligonucleotide confirms a role for survivin in IL-11-induced cytoprotection.
| Materials and Methods |
|---|
|
|
|---|
C.B-17 SCID/beige mice (Taconic Farms, Germantown, NY) were used at 58 wk of age. The animals were housed individually in microisolator cages and were fed autoclaved food and water. Serum IgG levels were determined by sandwich ELISA using reagents from Cappel (Durham, NC) as previously described (16). SCID/beige animals were considered "leaky" at IgG levels >1 µg/ml and excluded from experimental use.
Skin grafting
Human skin was obtained from cadaver donors through the Yale University Skin Bank under a protocol approved by the Yale Human Investigations Committee. Human skin was orthotopically transplanted to SCID/beige mice as previously described (16, 17). This and all subsequent experiments were performed under a protocol approved by the Yale Animal Care and Use Committee. In brief, 0.5-mm-thick sheets were divided into 1-cm2 pieces and fixed onto similar sized defects on the dorsum of recipients using staples. The resultant surface area of healed grafts was kept constant between animals when possible. The skin reproducibly grafted with a >95% success rate and was allowed to heal for 45 wk before injection of allogeneic (to the skin) human PBMC or graft treatment. Rare animals that did not successfully engraft were excluded from the experimental groups before treatments.
PBMC isolation and administration
Human leukocytes were collected by leukapheresis of adult volunteer donors under a protocol approved by the Yale Human Investigations Committee. The PBMC were isolated using Lymphocyte Separation Medium (Cappel) according to the manufacturers instructions. The cells were stored in 10% DMSO/90% FBS at -196°C and were thawed and washed before use. Thawed leukocytes typically contain
73% CD3+ T cells, 5% CD16+ macrophages, 9% CD19+ B cells, 14% CD56+ NK cells, and equally divided between CD45RA+ and CD45RO+ cells (18). SCID/beige mice were reconstituted with 3 x 108 human PBMC by i.p. inoculation 4 wk after skin engraftment. The number of circulating human T cells was evaluated by flow cytometry as previously described (16). In brief, heparinized retro-orbital venous samples were obtained 14 days after reconstitution, and the erythrocytes were lysed. The leukocytes were incubated with FITC-conjugated mouse anti-human CD3 (Immunotech, Westbrook, ME) and PE-conjugated rat anti-mouse CD45 (Sigma-Aldrich, St. Louis, MO) mAbs and were analyzed using a FACSort (BD Biosciences, Mountain View, CA). A discrete population of circulating human T cells, with a frequency of >0.5% of mouse leukocytes, was detected in >95% of recipients. The average reconstitution percentage was 5.28 ± 0.195. Animals demonstrated no signs of graft-vs-host disease. Rare animals that failed to reconstitute with human T cells were, by prior design, excluded from analysis. None of the treatments used in this study influenced the frequency or extent of T cell engraftment.
Graft treatments
Recombinant human IL-11 (gift from Wyeth, Cambridge, MA) was diluted in pyrogen-free saline to a dose of 500 ng in 20 µl and administered directly into the grafts by i.d. injection using a 29-gauge tuberculin syringe. Daily IL-11 or pyrogen-free saline treatment was initiated 45 wk after skin grafting and 1 day before PBMC injection. Skin was harvested at the specified time points.
Antisense oligonucleotide (ASO) creams, prepared by ISIS Pharmaceuticals (Carlsbad, CA), were used to down-regulate survivin expression in skin grafts. Irrelevant and survivin ASO (ISIS 23722 and ISIS 28599, respectively) creams were applied topically (100 µl three times/day) to skin grafts between days 5 and 10 after BMC inoculation. Efficacy and specificity of creams on survivin expression was assessed by immunohistochemistry using paraffin-embedded sections or by real-time quantitative RT-PCR (see below).
Histology and immunohistochemistry
Human skin grafts, harvested at indicated times, were processed for paraffin-embedded or frozen sections as previously described (17). Immunostaining was performed (17) using isotype-matched, nonbinding control Abs or the following Abs: mouse anti-human CD3 (UCHT1, IgG1), mouse anti-human ICAM-1 (2D5), or mouse anti-human CD31 (platelet-endothelial cell adhesion molecule-1 (PECAM-1); DAKO, Carpinteria, CA). Survivin immunostaining was performed on paraffin-embedded sections as previously described (15) using rabbit anti-survivin (Novus Biologicals, Littleton, CO) or rabbit IgG control.
The degree of graft microvascular damage was evaluated from H&E-stained sections by a dermatopathologist (J.M.M.) blinded to treatment protocols as previously described (6). In brief, the percentage of dermal vessels showing injury, defined as EC loss or sloughing, was assessed from an average of three high-power (x200) fields using the following semiquantitative grading scale: grade 0, all vessels patent and uninvolved; grade 1, <25% of vessels show injury; grade 2,
50% of vessels show injury; and grade 3, >75% of vessels show injury. The number of human microvessels in the dermis of human skin grafts was quantified by counting vessels whose EC stained positively for human CD31. A minimum of three fields was counted for each graft. The staining intensity and distribution of human ICAM-1 on EC was evaluated in a blinded fashion (by N.C.K.-S. and K.M.) as previously described (17). In brief, Ag immunostaining from an average of three high-power (x200) microscopic fields was assessed using the following semiquantitative grading scale: grade 0, absent or faint staining of an occasional vessel only; grade 1, faint staining of several vessels: grade 2, moderate staining of most vessels; and grade 3, intense staining of most vessels. The staining intensity and distribution of human CD3+ T cell infiltrates were similarly scored using the following semiquantitative grading scale: grade 0, none or occasional positive cells only; grade 1, sparse infiltration of positive cells; grade 2, moderate infiltration of positive cells; and 3, intense positive staining infiltrates. Where indicated, the actual numbers of CD3+ T cells per five high-powered fields were enumerated by two independent observers (N.C.K.-S. and K.M.) blinded to the treatment protocol.
Quantitative real-time PCR
Quantitative real-time PCR were performed as previously described (19, 20) on skin grafts harvested 15 days after PBMC inoculation. Briefly, cDNA was amplified by AmpliTaq Gold DNA polymerase using specific primers which were synthesized by Yale Howard Hughes Medical Institute/Keck oligonucleotide synthetic facility (Yale University School of Medicine, New Haven, CT): CD3
(5'-GGCAAAGGGGACAAAACAAG-3' and 5'-CTTTCCGGATGGGCTCATAG-3'), Fas ligand (5'-GGCCCATTTAACAGGCAAGT-3' and 5'-CAGGACATTTCCATAGGTGTCTTC-3'), granzyme B (5'-TGCAACCAATCCTGCTTCTG-3' and 5'-CCGATGATCTCCCCTGCAT-3'), perforin (5'-TGGAGTGCCGCTTCTACAGTT-3' and 5'-GTGGGTGCCGTAGTTGGAGAT-3'), HLA-DR (5'-AGCCCAACGTCCTCATCTGT-3' and 5'TCGAAGCCACGTGACATTGA-3'), GAPDH (5'GAAGGTGAAGGTCGGAGTC3' and 5' GAAGATGGTGATGGGATTTC3'), suppressor of cytokine signaling-3 (SOCS-3) (5'GGCCACTCTTCAGCATCTC3' and 5'ATCGTACTGGTCCAGGAACTC3'), and survivin (5'GCACCACTTCCAGGGTTTAT-3' and 5'CTCTGGTGCCACTTTCAAGA3'). IL-5, IFN-
, ICAM-1, and ICAM-2 were purchased as a primer/probe set from Applied Biosystems (Applied Biosystems of Perkin-Elmer; Foster City, CA). The reaction was amplified with an iCycler iQ Multicolor Real-Time Detection System (Bio-Rad, Hercules, CA).
Changes in the levels of mRNA were determined by measuring the cycle threshold (CT), i.e., the PCR cycle at which an increase in reporterfluorescence can be first detected above a baseline signal. CT values for GAPDH, ICAM-2, or CD3e cDNA were subtracted from CT values for appropriate cDNA for each well to calculate
-CT. The triplicate
-CT values for each sample were averaged. The averaged
-CT values calculated for control grafts was subtracted from
-CT values calculated for IL-11-treated grafts to calculate 
-CT. Then, the fold induction for each well was calculated by using the 2-(
-CT) formula. The fold induction value for triplicate wells was averaged and data are presented as the mean ± SEM of triplicate wells.
Data analysis
Scores of histologic data, quantities of EC or T cells, or normalized mRNA levels were pooled from several experiments. For each parameter, results are expressed as the mean ± SD. Experiments only using grafts receiving PBMC were compared using a paired t test. The effects of IL-11 vs saline and the effects of survivin ASO vs control oligonucleotide were analyzed using a one-way ANOVA followed by a Bonferroni correction. Differences between groups are considered as significant when p < 0.05.
| Results |
|---|
|
|
|---|
To investigate the effects of IL-11 on immune-mediated alterations in human skin grafts, daily i.d. injections of IL-11 or saline vehicle were administered to groups of animals with healed human skin grafts starting on the day before i.p. inoculation with PBMC. Within each experiment, all skin grafts were obtained from a single donor and all PBMC came from a second donor allogeneic to the skin graft donor. In each experiment, additional control animals bearing skin grafts were injected with IL-11 or saline but were not inoculated with PBMC.
First, we examined the time course of IL-11 effects. Since destruction of human microvessels is not seen before 7 days and is usually complete by 21 days after PBMC inoculation, we examined grafts on days 10, 15, and 21. The number of human CD31+ vessel profiles was unchanged in animals not receiving PBMC at all time points examined. There were no discernable effects of i.d. IL-11 on the numbers of circulating human T cells (data not shown). Consistent with previous experiments, PBMC caused progressive human vessel loss (Fig. 1). Injection of IL-11 slowed the rate of human vessel loss. Maximal protective effects compared with saline injection were observed at 15 days postreconstitution, at which time human microvessels in IL-11-treated skin were not statistically different from those of animals not receiving PBMC. In contrast, saline-injected grafts had already lost
50% of their human microvessels (Fig. 1A). By day 21, vessel loss had occurred in the IL-11-treated group, although it was still less pronounced than in the saline-injected controls.
|
IL-11 does not exert an anti-inflammatory or immunomodulatory effect at day 15 after PBMC inoculation
To further investigate the mechanisms of IL-11 actions, we focused our subsequent experiments on day 15 specimens, i.e., the time when the effect of IL-11 was most clearly evident. Consistent with the time course experiments, IL-11 did not change T cell numbers in the grafts (Table I). It also did not affect the level of transcripts encoding IFN-
, IL-5, perforin, granzyme B, CD69, or CD25 (Table II).
|
|
|
Because previous studies have shown that IL-11 causes induction of survivin in both microvascular EC and keratinocytes of human skin grafts, we focused on this protein. In the current studies, IL-11 induced survivin expression in both the control (no PBMC) and PBMC-infiltrated human skin grafts (Fig. 2, G and I). In grafts receiving PBMC alone but not IL-11, there was no induction of survivin expression over baseline (Fig. 2, F and H). Data pooled from multiple experiments are summarized in Fig. 2J.
Topical administration of survivin ASO cream down-regulates survivin expression and abrogates the IL-11-induced cytoprotection in human skin grafts
To examine whether survivin plays a role in IL-11-mediated protection, we inhibited survivin expression through the use of topical application of survivin ASO creams. To confirm that the survivin ASO cream was effective and specific in down-regulating survivin expression, we quantified the effects of IL-11 on survivin and SOCS-3 mRNA expression in skin grafts receiving either control or survivin ASO cream. SOCS-3 was examined because it is also induced by IL-11 in cultured EC (18). Survivin ASO cream appears specific for survivin as topical application of survivin ASO cream abrogated survivin expression (Fig. 3A) but not SOCS-3 induction (Fig. 3B) in response to i.d. inoculation of 500 ng IL-11.
|
| Discussion |
|---|
|
|
|---|
IL-11 has previously been shown to reduce tissue damage in several animal models (9, 10, 11, 12, 21) as well as in human psoriatic skin (13). The mechanism(s) of these effects is not known. One hypothesis has been that IL-11 exerts anti-inflammatory effects. In support of this role, it has been shown that IL-11 can inhibit NF-
B expression in a murine macrophage cell line (22). Another idea has been that IL-11 is immunomodulatory, causing harmful Th1-type responses to change into less injurious Th2-type responses (23, 24, 25). In our human skin graft model, we failed to observe either a reduction in T cell infiltration or a change in cytokines, effector molecules, or T cell activation markers. Thus, our data tend to favor a third idea, namely, that IL-11 can increase the capacity of EC and other cell types to resist injury. We first noted this effect in cultured EC (12, 14) and, based on the results of our ASO experiments, attributes this effect largely to the enhanced expression of survivin.
Survivin is the simplest member of the apoptosis protein (IAP) family, containing a single baculovirus inhibitory repeat domain (26). IAP family members, including survivin, are believed to act as caspase inhibitors (27). Survivin also appears to associate with the mitotic spindle and influence cytokinesis. Survivin is widely expressed in development but is largely shut off in the adult. It is re-expressed in most common tumors and angiogenic endothelium (28, 29, 30). Knockdown of survivin expression sensitizes cells to apoptosis (31, 32, 33, 34). Our model is the first example of survivin protecting target cells from T cell-mediated injury.
The factors that regulate survivin appearance in adult tissues are not well known. In cultured EC, survivin can be up-regulated by growth factors and related agents (e.g., vascular endothelial growth factor or angiopoietin) through activation of phosphatidylinositol 3-kinase and Akt (30, 35). IL-11 does not activate this pathway yet effectively induces survivin expression (15). Previous cultured cell experiments in our laboratory have linked both survivin expression and resistance to injury to STAT3 signaling (15).
The cytoprotective effects of IL-11 in vivo are reminiscent of the phenomenon of accommodation. Originally described as an explanation for the survival of ABO incompatible allografts in the face of circulating alloantibodies (36, 37, 38), Bach and colleagues (39, 40) have extended this concept to describe the capacity of both allografts and xenografts to survive in nontolerant hosts capable of cell-mediated as well as humoral rejection. The accommodated state is associated with increased expression of several antiapoptotic genes in graft EC, including A20, Bcl-2 family members (Bcl-2, Bcl-xL, A1), and heme oxygenase-1 (HO-1) (38). HO-1, in particular, has been shown to be important in the accommodation of mouse cardiac allografts by comparing organs from wild-type and HO-1 knockout animals (41). We have not observed a consistent effect of IL-11 on HO-1 expression, nor have we seen effects of IL-11 on A20 or Bcl-2 family members (K.M. and J.S.P., unpublished observations). Survivin has not previously been linked to accommodation, but nor has it been specifically excluded.
In summary, the in vivo experiments in human tissue reported here extend and confirm previous in vitro studies examining the role of IL-11 in protecting the vascular endothelium from T cell-mediated injury. Although IL-11 does not completely prevent allograft rejection, it reproducibly delays the time course of vessel loss. The mechanism by which IL-11 protects EC can be explained in large part by graft accommodation mediated by the induction of survivin expression and not via an anti-inflammatory or immunomodulatory effect. Indeed, there appears to be no effect of IL-11 on the number of T cells, their activation state, their pattern of cytokine synthesis, or effector molecule synthesis in our model. These findings do not exclude the possibility that additional cytoprotective genes induced by IL-11 also contribute to reduced injury. However, this study provides the first evidence that survivin can protect cells from T cell-mediated injury. Our findings may be valuable in optimizing the applications of IL-11 as a protective agent in human patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Cancer Biology, University of Massachusetts School of Medicine, Worcester MA 01605. ![]()
3 Address correspondence and reprint requests to Dr. Jordan S. Pober, Yale School of Medicine, 295 Congress Avenue, BCMM 454, New Haven, CT 06510. E-mail address: jordan.pober{at}yale.edu ![]()
4 Abbreviations used in this paper: EC, endothelial cell; IAP, inhibitor of apoptosis; i.d., intradermal(ly); ASO, antisense oligonucleotide; PECAM-1, platelet-derived endothelial cell adhesion molecule-1; SOCS-3, suppressor of cytokine signaling-3; CT, common threshold; HO-1, heme oxygenase-1. ![]()
Received for publication July 16, 2003. Accepted for publication November 13, 2003.
| References |
|---|
|
|
|---|
B. J. Immunol. 159:5661.[Abstract]
This article has been cited by other articles:
![]() |
F. Li, Y. S. Devi, L. Bao, J. Mao, and G. Gibori Involvement of Cyclin D3, CDKN1A (p21), and BIRC5 (Survivin) in Interleukin 11 Stimulation of Decidualization in Mice Biol Reprod, January 1, 2008; 78(1): 127 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Suarez, B. R. Shepherd, D. A. Rao, and J. S. Pober Alloimmunity to Human Endothelial Cells Derived from Cord Blood Progenitors J. Immunol., December 1, 2007; 179(11): 7488 - 7496. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Shiao, N. C. Kirkiles-Smith, B. R. Shepherd, J. M. McNiff, E. J. Carr, and J. S. Pober Human Effector Memory CD4+ T Cells Directly Recognize Allogeneic Endothelial Cells In Vitro and In Vivo J. Immunol., October 1, 2007; 179(7): 4397 - 4404. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fukuda and L. M. Pelus Survivin, a cancer target with an emerging role in normal adult tissues Mol. Cancer Ther., May 1, 2006; 5(5): 1087 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Shiao, J. M. McNiff, and J. S. Pober Memory T Cells and Their Costimulators in Human Allograft Injury J. Immunol., October 15, 2005; 175(8): 4886 - 4896. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Raines and N. Ferri Thematic Review Series: The Immune System and Atherogenesis. Cytokines affecting endothelial and smooth muscle cells in vascular disease J. Lipid Res., June 1, 2005; 46(6): 1081 - 1092. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |