| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Comparative and Experimental Medicine, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our results show clear differences in the outcome of ocular HSV infection in CXCR2-/- compared with control BALB/c mice. Thus, CXCR2-/- animals had minimal PMN influx during the first 7 days postinfection (p.i.), and this correlated with a longer duration of virus infection in the eye compared with BALB/c mice. The CXCR2-/- mice were also more susceptible to HSV-induced lesions and developed HSK upon exposure to a dose of HSV that was minimally pathogenic to BALB/c mice. The basis for the greater HSK lesion susceptibility of CXCR2-/- mice was associated with an elevated IL-6 response, which appeared in turn to induce the angiogenic factor, vascular endothelial growth factor (VEGF). Our results serve to further demonstrate the critical role of angiogenesis in the pathogenesis of ocular lesions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female BALB/c-Cmkar2tm1Mwm (CXCR2-/-) (The Jackson Laboratory, Bar Harbor, ME) and BALB/c (Harlan Sprague-Dawley, Indianapolis, IN), 6–8 wk old, were used for the studies. Mice were housed in sterile microisolator cages, and all food, bedding, and instruments were autoclaved or disinfected. Manipulations were done under a laminar flow hood. To prevent bacterial superinfection, mice received prophylactic treatment of sulfamethoxazole/trimethoprim (Alpharma, Baltimore, MD) at the rate of 5 ml/200 ml of drinking water. Antibiotic treatment was started 1 day before the beginning of experiments. All experimental procedures were in complete agreement with the Association for Research in Vision and Ophthalmology resolution on the use of animals in research.
Virus
HSV-1 RE strain (obtained from the laboratory of R. Hendricks, University of Illinois, Chicago, IL) was propagated and assayed on Vero cells for the measurement of PFU by standard protocols (23).
Corneal HSV infection, clinical observation, and angiogenesis measurement
Corneas of mice, deeply anesthetized by Avertin (Pittman Moore, Mondelein, IL), were scarified with a 27-gauge needle. A 4-µl drop containing the required dose of virus was applied to the scarified cornea and gently massaged with the eyelids. Animals were examined at different days p.i. with a slit lamp biomicroscope (Kowa, Nagoya, Japan), and the severity of clinical keratitis of individually marked mice was recorded. Briefly, the clinical lesion score of HSK was described as 0, normal cornea; 1, mild haze; 2, moderate haze, iris visible; 3, severe haze, iris not visible; 4, severe haze and corneal ulcer; 5, corneal rupture. Angiogenesis scoring was done as previously described (24). To quantify the degree of neovessel formation, two primary parameters were used: 1) the circumferential extent of neovessels (as the angiogenic response is not uniformly circumferential in all cases); 2) the centripetal growth of the longest vessels in each quadrant of the circle. The longest neovessel in each quadrant was identified and graded between 0 (no neovessel) and 4 (neovessel in the corneal center) in increments of 
0.4 mm (radius of the cornea is 1.5 mm). According to this system, a grade of 4 for a given quadrant of the circle represents a centripetal growth of 1.5 mm toward the corneal center. The score of the four quadrants of the eye was then summated to derive the neovessel index (range, 0–16) for each eye at a given time point.
Virus recovery and titration
Eye swabs were taken from infected corneas (four animals/group) using sterile swabs soaked in DMEM containing 10 IU/ml penicillin and 100 µg/ml streptomycin. Swabs were put in sterile tubes containing DMEM and stored at -80°C. For detection of virus, samples were thawed and vortexed. Duplicate 200-µl aliquots of dilutions of each sample were plated on Vero cells grown to confluence in 24-well plates at 37°C in 5% CO2 for 90 min. Medium was aspirated, and 500 µl of 2x DMEM containing 1% low melting point agarose was added to each well. Titers were calculated as log10 PFU/ml as per standard protocol (23).
Corneal intrastromal injection assay
Corneal intrastromal injection was performed, as described before (25). Under direct stereomicroscopic observation, a nick in the epithelium and anterior stroma of mouse cornea was made with a half-inch 30-gauge needle with a 30° bevel, in the midperiphery. For each cytokine to be tested, eight eyes were injected. The needle was introduced into the corneal stroma and advanced 1.5 mm to the corneal center. Two microliters of solution containing the required concentration of cytokine was forcibly injected into the stroma to separate the corneal lamellae and disperse the solution. Murine rIL-6 (endotoxin level <1.0 EU/1 µg of protein) and VEGF (endotoxin level <0.1 ng/1 µg of protein) were purchased from R&D Systems (Minneapolis, MN). PBS was used as a control. For VEGF neutralization experiments, anti-murine VEGF-neutralizing Ab (2 µg) (R&D Systems) was mixed with 200 ng of IL-6 and injected intrastromally. The length of the neovessels generated from the limbal vessel ring toward the center of the cornea was measured on days 2, 4, and 7. The length and width of the neovessels were calculated in clock hours (each clock hour equal to 30° at the circumference). The angiogenic area was calculated according to the formula A = (clock hours x 0.4 x vessel length (mm) x 
}/2 and expressed as mm2.
Quantitative RT-PCR
Total RNA from four corneas/time point was extracted by using RNeasy protect mini kit (Qiagen, Valencia, CA). Briefly, tissues were lysed in RLT buffer (Qiagen, catalog no. 79216) and RNA was purified according to manufacturer’s instructions. RNase-free DNase set (Qiagen) was used to remove any contaminating genomic DNA. To generate cDNA, 1 µg total RNA was reverse transcribed by Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI). All cDNA samples were aliquoted and stored at -20°C till further use.
Real-time PCR was performed using a DNA Engine Opticon (MJ Research, Cambridge, MA). Quantitect SYBR green PCR kit (Qiagen) was used according to manufacturer’s protocol. PCR amplification of housekeeping gene, murine GAPDH, was done for each sample as a control for sample loading and normalization between samples. A standard curve was constructed with PCR-II Topo cloning vector (Invitrogen, San Diego, CA) with the inserted fragment amplified by the SYBR green I system. PCR was conducted for three dilutions of each sample (in duplicate). To confirm amplification specificity, the PCR products were subjected to a melting curve analysis and subsequent agarose gel electrophoresis. Copy number for the target gene was then normalized to 106 copies of GAPDH control, and data were represented as copy numbers/cornea. The primers used were murine IL-6 primer, forward, TTCCATCCAGTTGCCTTCTT, and reverse, CAGAATTGCCATTGCACAAC, and murine GAPDH primer, forward, CATCCTGCACCACCAACTGCTTAG, and reverse, GCCTGCTTCACCACCTTCTTGATG.
Histopathology, immunohistochemistry, and immunofluorescence
For histopathological analysis, eyes were extirpated and fixed in 10% buffered neutral Formalin and embedded in paraffin. Sections (5 µm thick) were cut, deparaffinized, and stained with H&E. PMN were identified based on their morphology under x1000 magnification. Cell counts were done on three eyes/group, two sections/eye scanning the limbus, paracentral, and central areas of the cornea. The number of PMN per section was averaged, and the SD between the three eyes was computed.
For immunohistochemistry and immunofluorescence analysis, eyes were enucleated at the indicated time points and snap frozen in OCT compound (Miles, Elkart, IN). Six-micron-thick sections were cut, air dried, and fixed in acetone:methanol (1:1) at -20°C for 10 min. Endogenous peroxidase activity was blocked using a 50% alcohol solution containing 0.3% hydrogen peroxide for 15 min, and sections were blocked with 3% BSA-PBS. Ab dilutions were made in 1% BSA-PBS. For detection of neutrophils, biotinylated anti-Gr1 mAb (clone RB6-8C5; BD PharMingen, San Diego, CA) was diluted 1/100 and incubated overnight at 4°C. For detection of HSV Ags, sections were treated with rabbit anti-HSV antiserum (10 min) (DAKO, Carpenteria, CA), followed by biotinylated anti-rabbit Ab (20 min) (Biogenex, San Ramon, CA). Sections were then treated with HRP-conjugated streptavidin for 45 min (1/1000 dilution; Jackson ImmunoResearch Laboratories, West Grove, PA), followed by 3, 3'-diaminobenzidine substrate (Biogenex), and counterstained with hematoxylin (Richard Allen Scientific, Kalamazoo, MI). Irrelevant biotinylated rat Abs and normal rabbit serum were used as negative controls. For immunofluorescence counting of neutrophils, acetone:methanol-fixed sections were blocked with 5% BSA/PBS/0.05% Tween 20 containing 1/200 dilution of Fc block (clone 2.4G2; BD PharMingen) for 2 h, followed by overnight incubation with 1/500 dilution of FITC anti-Gr1 (BD PharMingen) in 1% BSA/PBS/0.05% Tween 20. Slides were mounted with Vecta-Shield reagent (Vector Laboratories, Burlingame, CA). Gr-1 + cells were counted from two sections/eye and three eyes/time point using a fluorescence microscope. For this purpose, the corneal section was divided into the limbal regions (roughly the part of the cornea marked by area of origin of the iris) and the central region (paracentral and central).
Cytokine ELISA of corneal lysates
For preparation of corneal lysates, five to six corneas/time point were pooled and minced. All procedures were done on an ice bath. Minced pieces were collected in 1 ml of DMEM without FCS and homogenized using a tissue homogenizer (PRO Scientific, Monroe, CT) four times, 15 s each, with a gap of 1 min between homogenization to allow the sample to cool on ice. The lysate was then clarified by centrifugation at 14,000 rpm for 5 min at 4°C. The supernatant was collected and used immediately or stored at -80°C till further use. Lysates were assayed using a standard sandwich ELISA protocol. Anti-IL-6 capture and biotinylated detection Abs were from BD PharMingen (clone MP5-20F3), and standard murine rIL-6 was from R&D Systems. Anti-MIP-2 and anti-VEGF capture and biotinylated detection Abs and recombinant standards for MIP-2 and VEGF were from R&D Systems. The color reaction was developed using ABTS (Sigma-Aldrich, St. Louis, MO) and measured with an ELISA reader (Spectramax 340; Molecular Devices, Sunnyvale, CA) at 405 nm. The detection limit was 2 pg/ml. Quantification was performed with Spectramax ELISA reader software version 1.2.
Statistics
Statistical analysis was performed using standard Student’s t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A prompt consequence of HSV infection of the cornea in BALB/c mice is PMN influx (6). This, as shown in Fig. 1, is evident as early as 12 h p.i., peaks at 2 days p.i., and subsides greatly by day 5. This is the preclinical phase of HSK. Clinically evident lesions start at day 8 p.i. and are at their peak at 15–21 days p.i. (3). The pattern of PMN influx in CXCR2-/- mice differed from that in BALB/c animals both in terms of the level of response and location of the cells in the corneal stroma (Fig. 2A). Thus, whereas in BALB/c mice PMN were abundantly present in the paracentral and central cornea, in CXCR2-/- mice PMN were mainly confined to the limbal area (the vascular part of the cornea) (Fig. 2A). In terms of total PMN numbers in the cornea at the 2-day peak, the response of CXCR2-/- mice was 30% that of BALB/c mice (Fig. 1). However, PMN numbers in the limbal areas were approximately equal (Fig. 2A). Thus, as noted in some other systems, PMN appeared not to migrate beyond the vascular release site (16, 26). In addition, as revealed by H&E staining, the total number of inflammatory cells infiltrating the corneas of CXCR2-/- mice, at day 2 p.i., was lower compared with BALB/c mice (Fig. 2B and Table I). Neutrophils comprise the majority of cells infiltrating the corneas of BALB/c mice at this time point, being almost 2 times that of monocytes (Table I). In contrast, neutrophil counts were far lower in CXCR2-/- corneas, and, interestingly, a majority of cells in such corneas were monocytes (Table I). However, there was no significant difference in the numbers of infiltrating monocytes in corneas of CXCR2-/- mice compared with BALB/c mice (Table I). Neutrophil counts in BALB/c and CXCR2-/- mice were also compared at day 15 during the clinical phase of HSK. Surprisingly, PMN were well represented in the central cornea in CXCR2-/- mice, and accounted for approximately the same percentage of the inflammatory cells, as was the case with BALB/c mice (Table I).
|
|
|
Previous reports had noted that PMN depletion in BALB/c mice resulted in prolonged viral presence, and animals often succumbed to HSV-induced encephalitis (6, 9). Thus, it was anticipated that viral clearance might be impaired in CXCR2-/- mice because of the diminished PMN response. To measure such an effect, groups of CXCR2-/- and BALB/c mice were infected at either a high (5 x 105 PFU) or low (5 x 104 PFU) dose of virus, and eye swabs were collected daily for viral titration. Although virus was detectable in swabs from CXCR2-/- mice, until at least day 7, even after infection with the low dose, BALB/c mice had cleared virus by this time point (Table II). Conceivably, in the corneal tissues themselves virus could have been present several days beyond day 7. Thus, upon analysis of frozen sections for the presence of viral Ags on day 7, abundant Ag was present in CXCR2-/- eyes (Fig. 3), but Ag was absent by day 6 in BALB/c mice (data not shown) (6). Even more of interest, whereas in BALB/c mice viral Ag was evident only in the epithelium (data not shown) (6), in CXCR2-/- mice Ag found after day 5 p.i., including the day 7 samples, was present in the stroma itself (Fig. 3). Such a pattern of Ag expression was noted previously in B cell K/O (27) and transgenic SCID/RAG-/- mice (28, 29).
|
|
Stromal keratitis in CXCR2-/- and BALB/c mice
Groups of CXCR2-/- and BALB/c mice of the same age (6–8 wk) were infected ocularly with either 5 x 105 or 5 x 104 PFU HSV-1 RE, and animals were followed at intervals over a 20-day observation period to measure: 1) the extent of corneal angiogenesis, and 2) the clinical severity of HSK. At the high dose level of infection, the pattern of events in the two strains was similar (Figs. 4 and 5). Thus, cumulative results from two separate experiments revealed that 17 of 20 eyes from CXCR2-/- mice develop significant lesions compared with 19 of 20 eyes from infected BALB/c mice. The average severity score and time of peak lesions did not differ significantly between the two groups (Fig. 4, A, C, and D). In addition, the extent of corneal neovascularization in both groups of mice was of similar magnitude (Fig. 5, A and B). Representative eyes from CXCR2-/- and BALB/c mice showing equal clinical severity (score of 4) were examined histologically following H&E staining. Both showed similar inflammatory changes and influx of a large number of inflammatory cells, which included Gr-1 + cells (data not shown).
|
|
As with lesion incidence and severity, significant differences were apparent in the average extent of angiogenesis in CXCR2-/- and BALB/c mice following infection with low dose virus (Fig. 5). By day 10 p.i., extensive angiogenesis was evident in the CXCR2-/- group (Fig. 5A), and at day 20 p.i., 12 of 20 eyes from CXCR2-/- mice had developed an angiogenesis score greater than 10 (Fig. 5B). In marked contrast, only 4 of the 20 eyes of BALB/c mice developed equivalent scores (Fig. 5B). When the overall angiogenesis was compared in the groups of CXCR2-/- and BALB/c mice, the average angiogenesis score was 3 times (day 20 p.i.) that observed in BALB/c mice (Fig. 5, A and B). Thus, despite a diminished neutrophil migration response to HSV infection in CXCR2-/- mice, angiogenesis appeared to be enhanced.
Cytokines and chemokine production in infected corneas
To date, our experiments indicate that CXCR2-/- mice show greater susceptibility to HSV infection than BALB/c animals, and that this response reflects as more neovascularization in CXCR2-/- mice. Previous reports had demonstrated that IL-6 was one of the few cytokines produced by susceptible corneal cells following HSV infection (30). Moreover, IL-6 was implicated as a critically important molecule during pathogenesis of corneal disease following HSV-1 infection (31). Furthermore, CXCR2-/- mice express high circulating levels of IL-6 (15). Finally, IL-6 could be involved in angiogenesis because it was shown to induce the potent angiogenesis factor VEGF (32, 33). To determine whether levels of corneal IL-6 were elevated in CXCR2-/- mice compared with BALB/c controls, groups of mice were infected with a low dose of HSV and sacrificed at intervals during the first week p.i. Corneal tissues were processed to measure both IL-6 mRNA and protein levels. As is evident in Fig. 6, both mRNA and protein levels for IL-6 were significantly higher in the CXCR2-/- mice. The greatest differences were noted between days 2 and 5, in which protein levels were up to 50-fold and mRNA levels 100-fold increased in CXCR2-/- compared with BALB/c mice.
|
|
To avoid the complication of virus infection and to determine the potential for IL-6 to induce VEGF production in the eye, experiments were done in BALB/c mice in which the IL-6 was injected directly into the corneal stroma. Measurements were then made of VEGF production (in corneal extracts) and levels of angiogenesis. Comparisons were made with rVEGF164 protein injected into the stroma as well as with negative PBS control injections.
The results show that IL-6 injection led to both angiogenesis and VEGF production (Fig. 8). With regard to angiogenesis, IL-6 induced significant responses evident at 48 h, but these had declined by day 4 postinjection (Fig. 8A). The response to VEGF-positive control protein was greater than that of IL-6, and in this case the peak response was evident at 4 days postinjection (Fig. 8A). In addition, the quality of the IL-6 and VEGF responses appeared to differ. Thus, the blood vessels evident after IL-6 injection were finer and less dense that those induced by VEGF (Fig. 8B). This may mean that additional factors are involved in IL-6-induced angiogenesis. However, the results shown in Fig. 8 do indicate that VEGF was part of the IL-6-induced angiogenic response. Thus, the angiogenesis induced by the injection of IL-6 could be blocked by administration of anti-murine VEGF (Fig. 8, A and B). In addition, corneal lysates at 48 h post-IL-6 injection contained significant levels of VEGF as measured by ELISA (Fig. 8C). In contrast, VEGF was not present in PBS-injected corneas.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A prominent early event after virus infection of the cornea is influx into the avascular stroma of inflammatory cells, primarily PMN (6). This influx occurs promptly after infection and most likely serves several functions. These include antiviral effects (6, 9) and an involvement in neovascularization (10). The signals responsible for the PMN influx are most likely multiple and nonviral derived. Several CXC chemokines are up-regulated following HSV infection (11, 30), and one of them, MIP-2, was indicated to be a major mediator in both HSV- and other pathogen-induced PMN corneal infiltrates (12, 13, 34, 35). These reports await confirmation. Moreover, with HSV, the source of MIP-2 remains undefined and would not seem to be the infected cells themselves (our unpublished results). Because in the mouse a single receptor, CXCR2, is used by all CXC PMN-attracting ligands (14, 15), the absence of this molecule should result in changes in PMN recruitment and help reveal the role of such cells in pathogenesis. Our results clearly showed that only minimal PMN invasion occurred into the stroma following HSV infection of CXCR2-/- mice. The effects were most evident in the avascular paracentral and central corneal locations. Thus, at the limbal region, which is close to blood vessels, PMN were abundant in both CXCR2-/- and BALB/c mice, indicating that vascular escape still occurred in CXCR2-/- mice, but PMN migration was compromised.
A major consequence of the diminished PMN influx was that CXCR2-/- mice were more susceptible to infection. Thus, virus persisted for longer periods in the eye. In addition, the virus gained access to the stromal tissue site, a situation noted previously only in immunocompromised animals (27, 28, 29). This circumstance most likely reflects movement to the stroma via zosteriform spread from infected nerve ganglia, an event normally contained by the immune system (36, 37). How PMN contribute to such immune control remains unknown, but IFN-
and TNF-
have been suggested to be participants in the antiviral effect (38, 39).
Previous reports had indicated that PMN contributes to corneal angiogenesis following HSV infection (10). Thus, we expected to observe that this process might be diminished in CXCR2 mice that have minimal PMN responses to HSV. In fact, the contrary result was observed with the extent of angiogenesis being enhanced in CXCR2-/- mice compared with BALB/c mice. This was particularly noticeable when low virus doses were used for infection. The heightened angiogenesis noted in CXCR2-/- mice correlated with the increased severity of HSK lesions, supporting the concept that angiogenesis plays a crucial role in the pathogenesis of such lesions (40). Curiously, in the clinical phase, once extensive angiogenesis had occurred, the PMN representation in the central cornea of CXCR2-/- mice was comparable to that of BALB/c animals. However, the PMN in CXCR2-/- vs the BALB/c mice did appear to occupy different locations in the two strains. Thus, many of the PMN counted were seen to be within blood vessels in the CXCR2-/- corneas, while in the BALB/c mice these were mostly extravascular. In addition, the fact that PMN numbers were approximately equal in both strains, late in disease, might reflect the operation of additional PMN chemotactic factors. MIP-1 represents a possible candidate based on previous reports (41). This issue is under investigation.
An explanation for the greater neovascular response to HSV of CXCR2-/- mice could lie with their differential IL-6 production. Thus, for unknown reasons, CXCR2-/- mice have elevated serum IL-6 levels compared with BALB/c mice (15). In our studies too, we observed that levels of both mRNA and IL-6 protein levels in the cornea of HSV-infected CXCR2-/- mice were higher (up to 100-fold) than those in control infected mice. The cellular source of the increased IL-6 response was not defined, but it could include virus-infected cells themselves. Thus, IL-6 is known to be produced by virus-infected cells, whereas most host proteins are rapidly switched off by HSV (42). It is known that HSV infection does result in the up-regulation of several host proteins, but these mainly derive from infected cells. Examples of this phenomenon include IL-12 and VEGF (8, 24). Our results indicate that IL-6 was involved in angiogenesis as a consequence of inducing VEGF. In support of this notion, VEGF protein levels were increased in the corneas of HSV-infected CXCR2-/- mice over those in comparably infected BALB/c animals. In addition, we demonstrated that injection of IL-6 into the corneal stroma of mice resulted in angiogenesis, an effect inhibited by anti-VEGF administration.
Taken together, our results support the hypothesis that PMN play an important role in HSV-induced ocular lesions. Their normal function is required to help minimize the development of HSV-induced lesions. This is in part the consequence of PMN-mediated antiviral effects. Another effect may involve the regulation of angiogenesis. This idea was supported by the observation that when PMN influxes into the cornea were minimal because of faulty responses to chemokines, angiogenesis was increased and animals developed more severe HSK lesions. This regulation is indirectly linked to antiviral effects and the proinflammatory environment. An important component of this environment, defined in the current study, is the cytokine IL-6. Apart from its role in the induction of angiogenesis, the recent observations that IL-6 inhibits regulatory T cells (43) may provide an additional explanation for the heightened HSK seen in CXCR2-/- mice. This issue is currently under investigation. It will be important to define whether the scenario that emerges from studies of the CXCR2-/- mouse can be confirmed in other models. Studies on double knockout CXCR2 and IL-6 mice would be of particular interest.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Barry T. Rouse, M409 Walters Life Sciences Building, University of Tennessee, Knoxville, TN 37996-0845. E-mail address: btr{at}utk.edu
3 Abbreviations used in this paper: HSK, herpetic stromal keratitis; MIP, macrophage-inflammatory protein; p.i., postinfection; PMN, polymorphonuclear leukocyte; VEGF, vascular endothelial growth factor.
Received for publication July 16, 2003. Accepted for publication November 14, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
prevents the development of blinding herpes stromal keratitis. J. Virol. 72:3705.This article has been cited by other articles:
|
|
 |
|
  S. J. Divito and R. L. Hendricks Activated Inflammatory Infiltrate in HSV-1-Infected Corneas without Herpes Stromal Keratitis Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1488 - 1495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. P. Sarangi, B. Kim, E. Kurt-Jones, and B. T. Rouse Innate Recognition Network Driving Herpes Simplex Virus-Induced Corneal Immunopathology: Role of the Toll Pathway in Early Inflammatory Events in Stromal Keratitis J. Virol., October 15, 2007; 81(20): 11128 - 11138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Khan, N. Cole, E. B. Hume, L. Garthwaite, T. C. R. Conibear, D. H. Miles, Y. Aliwaga, M. B. Krockenberger, and M. D. P. Willcox The role of CXC chemokine receptor 2 in Pseudomonas aeruginosa corneal infection J. Leukoc. Biol., January 1, 2007; 81(1): 315 - 318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kim, P. P. Sarangi, Y. Lee, S. Deshpande Kaistha, S. Lee, and B. T. Rouse Depletion of MCP-1 increases development of herpetic stromal keratitis by innate immune modulation J. Leukoc. Biol., December 1, 2006; 80(6): 1405 - 1415. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Ebrahem, A. Minamoto, G. Hoppe, B. Anand-Apte, and J. E. Sears Triamcinolone Acetonide Inhibits IL-6- and VEGF-Induced Angiogenesis Downstream of the IL-6 and VEGF Receptors Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4935 - 4941. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Galioto, J. A. Hess, T. J. Nolan, G. A. Schad, J. J. Lee, and D. Abraham Role of Eosinophils and Neutrophils in Innate and Adaptive Protective Immunity to Larval Strongyloides stercoralis in Mice. Infect. Immun., October 1, 2006; 74(10): 5730 - 5738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kim, S. Suvas, P. P. Sarangi, S. Lee, R. A. Reisfeld, and B. T. Rouse Vascular Endothelial Growth Factor Receptor 2-Based DNA Immunization Delays Development of Herpetic Stromal Keratitis by Antiangiogenic Effects J. Immunol., September 15, 2006; 177(6): 4122 - 4131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. J. Carr, J. Ash, T. E. Lane, and W. A. Kuziel Abnormal immune response of CCR5-deficient mice to ocular infection with herpes simplex virus type 1. J. Gen. Virol., March 1, 2006; 87(Pt 3): 489 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Y. McClintock and E. M. Wagner Role of IL-6 in systemic angiogenesis of the lung J Appl Physiol, September 1, 2005; 99(3): 861 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Biswas, K. Banerjee, B. Kim, P. R. Kinchington, and B. T. Rouse Role of Inflammatory Cytokine-Induced Cycloxygenase 2 in the Ocular Immunopathologic Disease Herpetic Stromal Keratitis J. Virol., August 15, 2005; 79(16): 10589 - 10600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kim, S. Lee, S. Suvas, and B. T. Rouse Application of Plasmid DNA Encoding IL-18 Diminishes Development of Herpetic Stromal Keratitis by Antiangiogenic Effects J. Immunol., July 1, 2005; 175(1): 509 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Banerjee, P. S. Biswas, and B. T. Rouse Elucidating the protective and pathologic T cell species in the virus-induced corneal immunoinflammatory condition herpetic stromal keratitis J. Leukoc. Biol., January 1, 2005; 77(1): 24 - 32. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kim, Q. Tang, P. S. Biswas, J. Xu, R. M. Schiffelers, F. Y. Xie, A. M. Ansari, P. V. Scaria, M. C. Woodle, P. Lu, et al. Inhibition of Ocular Angiogenesis by siRNA Targeting Vascular Endothelial Growth Factor Pathway Genes: Therapeutic Strategy for Herpetic Stromal Keratitis Am. J. Pathol., December 1, 2004; 165(6): 2177 - 2185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Biswas, K. Banerjee, M. Zheng, and B. T. Rouse Counteracting corneal immunoinflammatory lesion with interleukin-1 receptor antagonist protein J. Leukoc. Biol., October 1, 2004; 76(4): 868 - 875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Biswas, K. Banerjee, B. Kim, and B. T. Rouse Mice Transgenic for IL-1 Receptor Antagonist Protein Are Resistant to Herpetic Stromal Keratitis: Possible Role for IL-1 in Herpetic Stromal Keratitis Pathogenesis J. Immunol., March 15, 2004; 172(6): 3736 - 3744. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
