The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, H.
Right arrow Articles by Ward, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, H.
Right arrow Articles by Ward, P. A.
The Journal of Immunology, 2004, 172: 7703-7712.
Copyright © 2004 by The American Association of Immunologists

Stat3 Activation in Acute Lung Injury1

Hongwei Gao*, Ren-Feng Guo*, Cecilia L. Speyer*, Jayne Reuben*, Thomas A. Neff*, L. Marco Hoesel*, Niels C. Riedemann*, Shannon D. McClintock*, J. Vidya Sarma*, Nico Van Rooijen{dagger}, Firas S. Zetoune* and Peter A. Ward2,*

* Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109; and {dagger} Department of Cell Biology and Immunology, Vrije Universiteit, Amsterdam, The Netherlands


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stat3 plays diverse roles in biological processes including cell proliferation, survival, apoptosis, and inflammation. Very little is known regarding its activation and function in the lung during acute inflammation. We now show that Stat3 activation was triggered in lungs and in alveolar macrophages after intrapulmonary deposition of IgG immune complexes in rats. Low levels of constitutive Stat3 were observed in normal rat lungs as determined by the EMSA. Stat3 activity in whole lung extracts increased 2 h after initiation of IgG immune complex deposition, reaching maximal levels by 4 h, whereas Stat3 activation was found in alveolar macrophages as early as 30 min after onset of injury. Expression and activation of Stat3 mRNA, protein, and protein phosphorylation was accompanied by increased gene expression of IL-6, IL-10, and suppressor of cytokine signaling-3 in whole lung tissues. Both Tyr705 and Ser727 phosphorylation were involved in Stat3 activation as assessed in whole lung extracts. C5a (complement 5, fragment a) per se can induce phosphorylation of Ser727 of Stat3. In vivo, Stat3 activation was dramatically suppressed by depletion of neutrophils or lung macrophages, resulting in reduced gene expression of IL-6 and IL-10 in whole lung tissues. Using blocking Abs to IL-6, IL-10, and C5a, Stat3 activation induced by IgG immune complexes was markedly diminished. These data suggest in the lung injury model used that activation of Stat3 in lungs is macrophage dependent and neutrophil dependent. IL-6, IL-10, and C5a contribute to Stat3 activation in inflamed rat lung.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Stat3 is a member of the cytoplasmic protein family that is activated by a large number of extracellular stimuli including IL-6, various cytokines, granulocyte CSF, epidermal growth factor, and IL-10 (1, 2, 3, 4). Typically, Stat3 is activated by tyrosine phosphorylation after stimulation by cytokines. Tyrosine phosphorylation is mediated by Janus kinases (Jaks)3 (5) and is required for Stat3 dimerization and subsequent nuclear translocation where it binds DNA and modulates gene expression. The function of Stat3 has been extensively studied in cell culture systems. Its activation has been implicated in the regulation of cell proliferation, differentiation, transformation, and apoptosis (6). In vivo, aberrant expression of Stat3 has been associated with immune tolerance (7), acute-phase response (8), and septic shock (9). Furthermore, constitutive activation of Stat3 has also been observed in chronic inflammation (10). These observations suggest that Stat3 may play an important role during inflammation. In contrast, Stat3 in macrophages may play a negative role in inflammation (11). Tissue-specific disruption of Stat3 during hematopoiesis is associated with a lethal inflammatory bowel syndrome (12), suggesting that Stat3 regulates the induction of a distinct set of target genes in different cell types. Although these studies indicate that Stat3 is important in expression of the inflammatory response, very little is known regarding its activation and function in the lung during acute inflammation.

The rat lung injury model triggered by the intrapulmonary deposition of IgG immune complexes (ICs) is known to induce extensive gene activation and has been used to study the roles of chemokines, cytokines, and complement in the process of acute inflammation (13, 14). In this model, a complex mediator cascade is triggered, resulting in recruitment of neutrophils into the inflammatory site and activation of lung macrophages. The early response cytokines, such as TNF-{alpha} and IL-1{beta}, are required for up-regulation of vascular adhesion molecules, ICAM-1, and E-selectin on pulmonary vascular endothelial cells (15, 16). These vascular adhesion molecules, together with neutrophil chemoattractants such as macrophage-inflammatory protein-2, cytokine-inducible neutrophil chemoattractant, and C5a (complement 5, fragment a), are required for the recruitment of neutrophils into the alveolar compartment (17, 18, 19, 20). All of these events involving cytokine and chemokine expression are regulated by a highly intricate network of transcription factors. Our previous work showed that both NF-{kappa}B and AP-1 transcriptional factors were activated during IgG IC-induced lung injury (21, 22, 23), suggesting that transcriptional factors may play a pivotal role in the development of lung inflammatory responses in this model. Although there is growing evidence that the regulation of gene expression is not mediated solely by a particular set of transcription factors, we sought to determine whether other transcription factors are also involved in acute lung inflammatory injury. Our results demonstrate that Stat3 is activated in lung during IgG IC-induced acute lung injury, with both Tyr705 and Ser727 phosphorylation being involved in Stat3 activation. Activation of Stat3 in lungs is macrophage dependent and neutrophil dependent. Furthermore, we show that IL-6, IL-10, and C5a are required for full activation of Stat3.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents

Rabbit anti-BSA IgG was purchased from ICN Biomedicals (Costa Mesa, CA). Goat IgG, anti-rat IL-6, and anti-rat IL-10 IgG were purchased from R&D Systems (Minneapolis, MN). Goat anti-rat C5a IgG was produced and purified as previously described (24). Recombinant rat C5a was produced in our laboratory, using the pET15b expression vector (Novagen, Madison, WI). Liposomes composed of egg phosphatidylcholine and cholesterol and containing either PBS (pH 7.4) or dichloromethylene diphosphonate (Cl2MDP; a gift from Roche Diagnostics, Mannheim, Germany) were synthesized as described previously (22). Rabbit anti-rat neutrophil antiserum was purchased from Accurate Chemical and Scientific (Westbury, NY).

IgG IC-induced alveolitis

Specific pathogen-free male Long-Evans rats (275–300 g; Charles River Breeding Laboratories, Portage, MI) were anesthetized with ketamine HCl (150 mg/kg, i.p.). Rabbit anti-BSA IgG (1.5 mg) in a volume of 0.3 ml in PBS (pH 7.4) was instilled intratracheally during inspiration. Immediately after intratracheal instillation of anti-BSA, 10 mg of BSA (in 0.5 ml of PBS) was injected i.v. Negative control rats received PBS (pH 7.4) intratracheally. Unless otherwise indicated, 4 h after IgG IC deposition, rats were exsanguinated, the pulmonary circulation was flushed via the pulmonary artery with 10 ml of PBS, and the lungs were surgically dissected. Lungs were immediately frozen in liquid nitrogen. Effects of in vivo blockade of IL-6, IL-10, and C5a in the lung injury model were assessed by the intratracheal instillation of 50 µg of anti-rat IL-6 or anti-rat IL-10 or 400 µg of anti-rat C5a or nonspecific goat IgG together with anti-BSA.

Alveolar macrophage and neutrophil depletion studies

Rats were anesthetized with ketamine HCl (150 mg/kg, i.p.). A suspension of Cl2MDP liposomes in PBS (100 µl of the liposome stock in a total volume of 500 µl) was administered intratracheally during inspiration. As a control, PBS liposomes were administered in a similar fashion. All subsequent interventions were performed 24 h after liposome instillation. Rats receiving Cl2MDP liposomes showed 74% depletion of alveolar macrophages compared with rats receiving PBS liposomes (22). Administration of PBS liposomes did not reduce the number of alveolar macrophages.

Neutropenia was induced by the i.p. injection of rabbit anti-rat neutrophil antiserum. A 1/10 dilution of Ab was i.p. injected (2 ml/100 g body weight). Rats received Ab 24 h before the experiments to achieve >96% reduction in peripheral blood neutrophil counts (data not shown).

Alveolar macrophages and NR8383

Alveolar macrophages were isolated by repeatedly lavaging lungs of control or IgG IC-injured rats at the time points indicated. Cells were collected by centrifugation of lavage fluids, and nuclear protein was extracted as described below. Cells retrieved from rats 0.5 or 1 h after pulmonary deposition of IgG ICs by bronchoalveolar lavage (BAL) were predominately alveolar macrophages (>95%), as determined by staining of BAL cells with Camco Quick Stain (Cambridge Diagnostic Products, Ft. Lauderdale, FL).

A rat alveolar macrophage cell line, NR8383, was obtained from American Type Culture Collection (Manassas, VA). Cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were grown in a humidified incubator at 37°C with 5% CO2.

Assessment of Stat3 and NF-{kappa}B activation by EMSA

Nuclear extracts of alveolar macrophages or NR8383 were prepared as follows. Cells were washed in PBS and lysed in 15 mM KCl, 10 mM HEPES (pH 7.6), 2 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 0.1% (v/v) Nonidet P-40, 0.5 mM PMSF, 2.5 µg/ml leupeptin, 5 µg/ml antipain, and 5 µg/ml aprotinin for 10 min on ice. Nuclei were pelletted by centrifugation at 14,000 x g for 20 s at 4°C. Proteins were extracted from nuclei by incubation at 4°C with vigorous vortexing in buffer C (420 mM NaCl, 20 mM HEPES (pH 7.9), 0.2 mM EDTA, 25% (v/v) glycerol, 1 mM DTT, 0.5 mM PMSF, 2.5 µg/ml leupeptin, 5 µg/ml antipain, and 5 µg/ml aprotinin). Nuclear extracts of whole lung tissues were prepared as described previously (21). Briefly, frozen lungs were homogenized in 0.6% (v/v) Nonidet P-40, 150 mM NaCl, 10 mM HEPES (pH 7.9), 1 mM EDTA, 0.5 mM PMSF, 2.5 µg/ml leupeptin, 5 µg/ml antipain, and 5 µg/ml aprotinin. The homogenate was incubated on ice for 5 min and then centrifuged for 5 min at 5000 x g at 4°C. Proteins were extracted from the pelletted nuclei by incubation at 4°C with 420 mM NaCl, 20 mM HEPES (pH 7.9), 1.2 mM MgCl2, 0.2 mM EDTA, 25% (v/v) glycerol, 0.5 mM DTT, 0.5 mM PMSF, 2.5 µg/ml leupeptin, 5 µg/ml antipain, and 5 µg/ml aprotinin. Nuclear debris was pelletted by centrifugation at 13,000 x g for 30 min at 4°C, and the supernatant extract was collected and stored at –80°C. Protein concentrations were determined by Bio-Rad protein assay (Hercules, CA) using BSA as a reference standard (Pierce, Rockford, IL). The EMSA probes were double-stranded oligonucleotides containing a Stat3 consensus oligonucleotide (GATCCTTCTGGGAATTCCTAGATC-3'; Santa Cruz Biotechnology, Santa Cruz, CA) and an NF-{kappa}B consensus oligonucleotide (AGTTGAGGGGACTTTCCCAGGC; Promega, Madison, WI). These probes were end-labeled with [{gamma}-32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Biosciences, Sunnyvale, CA). DNA binding reactions were performed at room temperature in a 25-µl reaction mixture containing 6 µl of nuclear extract (1 mg/ml in buffer C) and 5 µl of 5x binding buffer (20% (w/v) Ficoll, 50 mM HEPES (pH 7.9), 5 mM EDTA, 5 mM DTT). The remainder of the reaction mixture contained KCl at a final concentration of 50 mM, Nonidet P-40 at a final concentration of 0.1%, 1 µg of poly(dI-dC), 200 pg of probe (unless otherwise noted), bromphenol blue at a final concentration of 0.06% (w/v), and water to volume. Samples were electrophoresed through 5.5% polyacrylamide gels in 1x TBE (90 mM Tris base, 90 mM boric acid, 0.5 mM EDTA) at 160 V for ~2 h, dried under vacuum, and exposed to x-ray film. For competition binding assays, unlabeled Stat3 oligonucleotide or mutant Stat3 oligonucleotide 5'-GATCCTTCTGGGCCGTCCTAGATC-3' was added to the reaction in 30x and 100x molar excess and incubated at room temperature for 10 min before addition of the probes. For supershifts, nuclear extracts were preincubated with Abs (1–2 µg) for 1 h at 4°C before the binding reaction. The following Abs were purchased from Santa Cruz Biotechnology: Stat3 (C-20), p65 (C-20), p50 (19), c-Rel (C), RelB (C-19), p52 (K-27), and normal rabbit IgG (normal rabbit serum).

RNA isolation and detection of mRNA by semiquantitative RT-PCR

Lungs were obtained 0, 0.5, 1, 2, and 4 h after induction of IgG IC injury. RNAs were extracted from lung homogenates using TRIzol Reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol. Digestion of any contaminating DNA was achieved by treatment of samples with RQ1 RNase-Free DNase (Promega). Reverse transcription was performed with 2 µg of RNA using the Superscript II RNase H– Reverse Transcriptase (Life Technologies) according to the manufacturer’s protocol. PCR was then performed with primers for Stat3 (5' primer, 5'-TGGAAGAGGCGGCAGCAGATAGC-3'; and 3' primer, 5'-CACGGCCCCCATTCCCACAT-3'), SOCS3 (5' primer, 5'-CCCGCGGGCACCTTTCTTA-3'; and 3' primer, 5'-AGGCAGCTGGGTCACTTTCTCATA-3'), IL-6 (5' primer, 5'-CTTCTTGGGACTGAT GTTGTTGA-3'; and 3' primer, 5'-GGTCCTTAGCCACTCCTTCTG T-3'), and IL-10 (5' primer, 5'-CACTGCTATGTTGCCTGCTCTTAC-3'; and 3' primer, 5'-CACTGCCTT GCTTTTATTCTCACA-3'). The primers for the "housekeeping" gene GAPDH were as follows: 5' primer, 5'-GCCTCGTCTCATAGACAAGATG-3'; and 3' primer, 5'-CAGTAGACTCCACGACATAC-3'. After a "hot-start" for 5 min at 94°C, 26–30 cycles were used for amplification with a melting temperature of 94°C, an annealing temperature of 60°C, and an extending temperature of 72°C, each for 1 min, followed by a final extension at 72°C for 7 min. The RT-PCR product was confirmed by electrophoresis of samples in a 1.2% agarose gel. Control experiments were performed with the samples without adding reverse transcriptase, to rule out contaminating DNA being responsible for any product. PCR was performed using different cycle numbers for all primers, to assure that DNA was detected within the linear part of the amplifying curves for both primers. Results are presented in a semiquantitative manner.

Western blot analysis

Whole lung extracts were homogenized in cold radioimmunoprecipitation assay buffer, sonicated, and centrifuged at 10,000 rpm for 10 min at 4°C. Proteins were precleared with protein A/G beads overnight at 4°C with gentle rotation. Samples containing 50 µg of protein were electrophoresed in a denaturing 12% polyacrylamide gel and then transferred to a polyvinylidene difluoride (PVDF) membrane. To examine the ability of C5a to induce phosphorylation of Stat3, NR8383 cells were grown in medium containing 2% FBS overnight, then stimulated with rat C5a (100 nM) at 37°C for 15 min and 30 min. After stimulation, cells were lysed using Nonidet P-40 buffer (50 mmol/L Tris-HCl (pH 8.0), 1% Nonidet P-40). The cell lysates were subjected to a denaturing 12% polyacrylamide gel and then transferred to a PVDF membrane. Membranes were incubated with the following Abs at a 1/500 dilution: rabbit anti-Stat3, rabbit anti-phospho-Stat3 (Ser727), rabbit anti-phospho-Stat3 (Y705) (UpState Biotechnology, Lake Placid, NY), rabbit anti-SOCS3 (H103), and goat anti-Actin (C11) (Santa Cruz Biotechnology). After five washes in TBST, membranes were incubated with a 1/5000 dilution of HRP-conjugated donkey anti-rabbit IgG (Amersham Biosciences). The membrane was developed by ECL technique according to the manufacturer’s protocol (Amersham Biosciences).

Multiprobe RNase protection assay (RPA)

Total cellular RNAs from lung homogenates was isolated as described above. A cDNA template set rat cytokine-1 from BD Pharmingen (San Diego, CA) was used to synthesize anti-sense cRNA multiprobe with [{alpha}-32P]UTP (800 Ci/mmol, 10 mCi/ml; NEN-DuPont, Boston, MA) as a label using an in vitro transcription kit according to the manufacturer’s protocol (BD PharMingen). Briefly, 15 µg of RNA for each sample was hybridized with the anti-sense RNA probe at 56°C for 12 h. After hybridization, free probes and unprotected single-stranded RNA were digested with RNase solution (RNase A + RNase T1). The remaining double-stranded RNA was then extracted in chloroform/isoamyl alcohol (50:1), precipitated with ethanol, and separated on a 7 M urea/6% polyacrylamide gel. A lane with the undigested probe served as the sized markers. The gel was then dried and exposed to X-OMAT film (Eastman Kodak, Rochester, NY).

The rat cytokine-1 cDNA template set contains fragments corresponding to rat cytokine genes (IL-1{alpha}, IL-1{beta}, TNF-{beta}, IL-3, IL-4, IL-5, IL-6, IL-10, TNF-{alpha}, IL-2, and IFN-{gamma}) and two "housekeeping genes" (L32 and GAPDH). A standard curve plotted with the undigested probe markers was used to identify the bands of various genes in the experimental samples.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Lung Stat3 activation during IgG IC-induced alveolitis

The time course of activation of Stat3 during IgG IC-induced lung injury was evaluated by EMSA, using nuclear extracts from whole lung obtained at various time points after onset of lung injury. As shown in Fig. 1, at time 0 little constitutive Stat3 in whole lung nuclear extracts was observed. Increases in Stat3 activation were evident by 2 h and became very strong by 4 h (Fig. 1A). To determine the status of Stat3 activation in alveolar macrophages during IgG IC-induced lung injury, BAL alveolar macrophages were obtained 30 min and 1 h after initiation of the lung inflammatory reactions. As expected, no detectable constitutive Stat3 in macrophages was found at time 0. Macrophage Stat3 dramatically increased 30 min after IgG IC deposition, remaining elevated at 1 h (Fig. 1B). This pattern of activation involving BAL macrophages and whole lung nuclear extracts is similar to the pattern of NF-{kappa}B activation in the same model of lung injury (21). We examined whether Stat3 activation could also be induced in vitro in the alveolar macrophages cell line NR8383 using in vitro IgG IC stimulation. The intensity of Stat3 in nuclear extracts from IgG IC-treated NR8383 cells increased in a time pattern similar to that of the BAL macrophages obtained from IgG IC injured lung (Fig. 1, B and C). These results suggest that Stat3 is rather quickly activated in alveolar macrophages after contact with IgG ICs. Next, we evaluated the possible contribution of BAL cells to the activation of Stat3 in the IgG injured lung. Lungs were lavaged three times 4 h after onset of the lung injury to remove macrophages, and Stat3 activation in the lavaged lungs was compared with that in the unlavaged lung. Fig. 1D shows that lavage of the injured lung appeared to cause a modest reduction in Stat3 activation in whole lung homogenates. When EMSA blots were subjected to image analysis, lavage was found to reduce Stat3 activation by 20% (data not shown), suggesting that BAL cells may contribute to some extent to Stat3 activation in whole lung extracts from injured lungs. More definitive experiments to define the role of lung macrophages in Stat3 activation are described below.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 1. Lung Stat3 activation during IgG IC-induced alveolitis. A, Time course for Stat3 activation during IgG IC-induced alveolitis. Nuclear extracts from whole lung tissues were subjected to EMSA analysis. B, Activation of Stat3 in alveolar macrophages during IgG IC-induced alveolitis. Alveolar macrophages were obtained by BAL 30 min and 1 h after initiation of IgG IC deposition. C, Activation by IgG ICs of Stat3 in the macrophage cell line NR8383. D, EMSA analysis of whole lung nuclear extracts 4 h after deposition of ICs followed by repetitive BAL, as indicated. Results shown are representative of three separate experiments.

 
To confirm that the DNA binding proteins contain Stat3, supershift assays were conducted. Nuclear extracts from whole lung harvested 4 h after IC deposition yielded a supershifted protein-DNA complex after incubation with an Ab specific for Stat3 (Fig. 2, lanes 1 and 2). No supershift occurred in the presence of normal (N) IgG (lane 1), in contrast with the supershift occurring in the presence of Ab to Stat3 (lane 2). To determine whether the supershifted species specifically bound to the Stat3-binding site, competitive assays were performed with the addition of unlabeled Stat3-binding oligonucleotide (Stat3 oligo) and an unlabeled mutant Stat3-binding oligonucleotide (Stat3 oligo) to the supershifted samples, using 30- and 100-fold excess unlabeled oligonucleotides (Fig. 2). The supershifted protein-DNA complexes observed upon incubation with Stat3-specific Ab were effectively blocked by a 30- or 100-fold excess of unlabeled nucleotide for Stat3-binding site (Fig. 2, lanes 3 and 4), whereas a 30- or 100-fold excess of mutant Stat3-binding oligonucleotide had only partly inhibitory effects and did not prevent the supershifts (Fig. 2, lanes 5 and 6).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2. Supershift analysis of Stat3 in whole lung nuclear extracts. Nuclear extracts from whole lungs harvested 4 h after IgG IC deposition were incubated with 32P Stat3 oligonucleotide in the absence (lane 1) or presence (lanes 2, 5, and 6) of Abs to the Stat3. Some binding reactions, in addition to specific Ab, included 30- and 100-fold excess quantities of unlabeled Stat3 (lanes 3 and 4) or mutant Stat3 (lanes 5 and 6) oligonucleotides.

 
Time courses for Stat3 mRNA and protein expression during IgG IC-induced lung injury

To determine whether increased oligonucleotide binding to Stat3 was caused by increased transcriptional expression of Stat3, we conducted RT-PCR experiments. As shown in Fig. 3, A and B, constitutive levels of Stat3 mRNA expression in lung homogenates were observed at 0, 0.5, and 1 h after intrapulmonary deposition of IgG ICs, with modest increases at 2 and 4 h. Densitometric analysis showed that there were measurable increases in Stat3 mRNA in extracts from IgG injured lung. Similar levels of GAPDH mRNA were seen at all time points, suggesting equivalent sample loading.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 3. RT-PCR and Western blot analysis of Stat3 during IgG IC-induced lung injury. A, RNA was extracted from lung homogenates 0, 0.5, 1, 2, and 4 h after initiation of IgG IC reactions. Messenger RNA expression of rat Stat3 and GAPDH was assessed using semiquantitative RT-PCR as described in Materials and Methods. GAPDH was used as a control for equal RNA loading and reverse transcription efficiency in all experiments. B, Ethidium bromide-stained gels were digitized and analyzed. Stat3 mRNA expression was normalized to GAPDH expression and the data are presented as a ratio. C, Extracts were prepared from whole lung tissues of sham animals or from lungs of animals at 0, 1, 2, and 4 h after initiation of lung inflammatory responses. Fifty micrograms of proteins were electrophoresed in a denaturing polyacrylamide gel and then transferred to a PVDF membrane. Protein expression was evaluated by Western blot using the following Abs: polyclonal rabbit anti-Stat3, rabbit polyclonal anti-phospho-Stat3 (Tyr705), or rabbit polyclonal anti-phospho-Stat3 (Ser727). The graphs are representative of results from two separate experiments.

 
Because Stat3 is activated by phosphorylation and is then capable of binding to DNA (25), we analyzed tyrosine and serine phosphorylation in whole lung lysates by Western blotting. Fig. 3C shows that, although the total Stat3 protein level was not appreciably changed, in the inflamed lung (lower panel), phosphorylation of both Ser727 (upper panel) and Tyr705 (middle panel) could be detected 2 and 4 h after onset of the IgG lung injury. These results suggest that activation of Stat3 in the inflamed lung is associated with phosphorylation of Ser727 and Tyr705.

Requirement for IL-6, IL-10, and C5a in Stat3 activation after pulmonary deposition of IgG ICs

Both IL-6 and IL-10 engage receptors that recruit Jaks and activate Stat3 (26, 27). Our previous studies suggested that both IL-6 and IL-10 are important regulators of lung inflammatory injury after deposition of IgG ICs and contain the extent of injury (28, 29). Accordingly, we sought to evaluate requirements for IL-6 and IL-10 in Stat3 activation in the lung injury model. Using RT-PCR, we determined expression of mRNA for IL-6 and IL-10 in lung extracts from animals undergoing IgG IC-induced lung injury. As shown in Fig. 4, little or no IL-6 mRNA was detected in normal lung homogenates, but there was a rapid increase in IL-6 mRNA by 1 h and much greater expression at 2 and 4 h. IL-10 mRNA appeared to be constitutively expressed at 0 h, with appreciable increases at 2 and 4 h. Messenger RNA expression of IL-6 and IL-10 was found to be similar to protein expression pattern in BAL fluids and whole lung, as determined by ELISA (28, 29). We assessed whether anti-IL-6 or anti-IL-10 Abs administered intratracheally with IgG anti-BSA would attenuate Stat3 activation induced during lung inflammatory injury. As shown in Fig. 4, C and D, presence of both anti-IL-6 and anti-IL-10 greatly reduced activation of Stat3 in the lung during IgG IC-induced injury, suggesting that up-regulated IL-6 and IL-10 induced by IgG IC deposition in lung contribute to Stat3 activation.



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 4. Effects of anti-IL6 and anti-IL10 on IgG IC-induced lung Stat3 activation. A, RNA was extracted from lung homogenates 0, 0.5, 1, 2, and 4 h after initiation of IgG IC reactions. Messenger RNA expression of rat Stat3 and GAPDH was assessed using semiquantitative RT-PCR as described in Materials and Methods. Equal loading of RNA was demonstrated with DNA bands for GAPDH. B, Ethidium bromide-stained gels were digitized and analyzed. Stat3 mRNA expression was normalized to GAPDH expression and the data are presented as a ratio. Effects of Ab induced blockade of IL-6 (C) or IL-10 (D) on IgG IC-induced Stat3 activation. Fifty micrograms of anti-IL-6 or anti-IL-10 IgG or IgG control were administered intratracheally with the anti-BSA. Stat3 activation was evaluated in whole lung tissues harvested 4 h after IgG IC deposition. Data are representative of three independent experiments.

 
Because C5a has been shown to be required for the full production of TNF-{alpha} and the corresponding up-regulation of lung vascular ICAM-1 in the IgG IC-induced lung injury (20), we assessed the requirement for C5a in Stat3 activation after IgG IC deposition. Anti-C5a Ab was administrated intratracheally together with the anti-BSA. EMSA results showed that blockade of C5a in lung reduced Stat3 activation in lungs after IgG IC deposition (Fig. 5, A and B). These results suggest that C5a contributes to Stat3 activation during IgG IC-induced lung injury. To investigate the mechanism of anti-C5a in reduction of Stat3 activation, we examined whether anti-C5a treatment also affects the expression of IL-6 and IL-10 in the inflamed lung. RPAs were performed using total RNA from IgG IC-injured lung with or without anti-C5a treatment. The results demonstrate that lung from anti-C5a-treated animals showed significantly decreased gene transcription activity for IL-6 when compared with the effects of irrelevant IgG (Fig. 5C). Consistently, when a more sensitive RT-PCR assay was performed, we found that anti-C5a treatment caused decreased gene transcription for IL-6 but apparently not for IL-10 in the inflamed lung (Fig. 5D), suggesting that decreased Stat3 activation by anti-C5a treatment during lung injury was related to reduced IL-6 expression. To further investigate whether C5a can directly activate Stat3, we examined whether Stat3 phosphorylation can be stimulated by C5a in the NR8383 macrophage cell line. As shown in Fig. 6, C5a significantly stimulated the phosphorylation of Stat3 at Ser727 but not at Tyr705 (data not shown) when compared with the untreated cells. Taken together, these results suggest that C5a exerts both direct and indirect effects on Stat3 activation.



View larger version (55K):
[in this window]
[in a new window]
  		FIGURE 5. Effects of intrapulmonary C5a blockade on IgG IC-induced Stat3 activation and on expression of IL-6 and IL-10 in whole lung extracts. A, 400 µg of anti-C5a IgG or control IgG was administered intratracheally with the anti-BSA. Stat3 activation was evaluated in whole lung tissues harvested 4 h after IgG IC deposition. B, Quantitation of EMSA blots by image analysis. Values represent mean ± SEM; n = 4 for each group. C, RPA was performed with total RNA from 4-h IgG IC injured lung with or without anti-C5a treatment. D, mRNA expression of rat IL-6, IL-10, and GAPDH was assessed using semiquantitative RT-PCR. Results shown are representative of two separate experiments.

 


View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 6. Effects of C5a on Stat3 serine phosphorylation in NR8383 cells. Cells were grown in medium containing 2% FBS overnight and then were stimulated with rat C5a (100 nM) at 37°C for 15 min or 30 min. Cell lysates were immunoblotted with anti-phospho (Ser727) Stat3, anti-Stat3, and anti-actin Abs. Results shown are representative of two separate experiments.

 
Induction of SOCS3 expression during IgG IC-induced alveolitis

SOCS3 is a member of the SOCS family that has been shown to bind Jaks and to suppress cytokine signaling (30). Because it has recently been shown that both IL-6 and IL-10 induce SOCS3 mRNA expression and that SOCS3 can inhibit IL-6 signaling (30, 31), we evaluated evidence for expression of SOCS3 mRNA (using RT-PCR) and protein in whole lung extracts during IgG IC deposition. As shown in Fig. 7, A and B, some constitutively expressed mRNA for SOCS3 was found at 0 h. SOCS3 mRNA expression was clearly increased thereafter in lung. Consistent with mRNA expression (Fig. 7, A and B) SOCS3 protein expression was also increased (C). Thus, it appears that a negative feedback mechanism via SOCS3 expression may regulate signaling related to IL-6 during IgG IC-induced lung injury.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 7. RT-PCR and Western blot analysis of SOCS3 during IgG IC-induced lung injury. A, RNAs were extracted from lung homogenates 0, 0.5, 1, 2, and 4 h after initiation of IgG IC reactions. Messenger RNA expression of rat SOCS3 and GAPDH was assessed using semiquantitative RT-PCR as described in Materials and Methods. GAPDH was used as a control for equal RNA loading and reverse transcription efficiency in all experiments. B, Ethidium bromide-stained gels were digitized and analyzed. SOCS3 on mRNA expression was normalized to GAPDH expression and the data are presented as a ratio. C, Cell extracts were prepared from whole lung tissues of sham animals or from animals at 0.5, 1, 2, and 4 h after initiation of lung inflammatory responses. Protein expression was evaluated by Western blot using rabbit anti-SOCS3 and goat anti-actin. Data are representative of two independent experiments.

 
Effects of alveolar macrophage depletion on lung Stat3 activation and gene expression for lung cytokines

Because Stat3 activation in alveolar macrophages precedes Stat3 activation in whole lung tissues (Fig. 1), we sought to determine whether alveolar macrophage depletion would affect Stat3 activation in whole lung tissues. Nuclear extracts from whole lungs harvested 4 h after onset of injury were analyzed by EMSA. Lungs from rats pretreated with PBS-containing or Cl2MDP-containing liposomes and subsequently challenged intratracheally with PBS showed minimal evidence for Stat3 activation (Fig. 8A, lanes 1 and 2). Rats pretreated with PBS liposomes and challenged with IgG-IC showed the expected evidence for Stat3 activation (lanes 3 and 4). Depletion of alveolar macrophages with Cl2MDP liposomes markedly reduced the extent of lung Stat3 activation (lanes 5 and 6). These data suggest that lung alveolar macrophages play a vital role in IgG IC-induced activation of Stat3 in lung.



View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 8. Effects of alveolar macrophage depletion on Stat3 activation and cytokine gene expression during IgG IC-induced lung injury. Rats received PBS liposomes or Cl2MDP liposomes 24 h before receiving intratracheal challenge with either PBS or IgG ICs. Four hours after PBS or IgG IC challenge, lungs were harvested. A, Stat3 binding activity of whole-lung nuclear extracts was assessed by EMSA. B, Expression of cytokine genes in whole lung, including IL-1{alpha}, IL-1{beta}, TNF-{beta}, IL-3, IL-4, IL-5, IL-6, IL-10, TNF-{alpha}, IL-2, IFN-{gamma}, L32, and GAPDH, was evaluated by RPA. L32 and GAPDH were used to confirm the equality of in vitro transcription efficiency and sample loading. Results shown are representative of three separate experiments.

 
We further examined the effects of macrophage depletion on cytokine gene expression during IgG IC-induced lung injury using RPA. There were low levels of whole lung mRNA expression for IL-1{alpha} and IL-1{beta} in lungs from rats pretreated with PBS or Cl2MDP liposomes and subsequently challenged intratracheally with PBS (Fig. 8B). As expected, mRNA expression for IL-1{alpha}, IL-1{beta}, IL-4, IL-6, IL-10, and TNF-{alpha} was markedly up-regulated in lungs obtained from rats pretreated with PBS liposomes or PBS and challenged with IgG ICs. mRNA for other cytokines, TNF-{beta}, IL-3, IL-5, IL-2, and IFN-{gamma}, were not detectable in macrophage-depleted lungs after IC deposition (Fig. 8B). Pretreatment of lungs with PBS liposomes had no effect on cytokine gene expression induced by IgG ICs. In contrast, depletion of alveolar macrophages with Cl2MDP liposomes dramatically decreased the lung cytokine gene expression activated by IgG ICs (Fig. 8B). For loading conditions, similar levels of L32 and GAPDH mRNA were found in all groups, suggesting equivalent sample loading.

Requirement for neutrophils in Stat3 activation in lung

Stat3 has been shown to be activated by oxidative stress (32, 33). Because Stat3 activation in the IgG IC-injured lungs occurs during neutrophil recruitment, experiments were designed to determine whether Stat3 activation was neutrophil dependent. We examined the effects of neutrophil depletion on IgG IC-induced activation of Stat3 using whole lung extracts. Nuclear extracts were harvested 4 h after onset of injury and were analyzed by EMSA. As shown in Fig. 9A, lungs from rats pretreated with normal serum and then challenged with IgG-IC showed dramatically increased evidence of Stat3 activation. Depletion of neutrophils greatly reduced Stat3 activation induced by IgG IC deposition in lung, indicating that neutrophil presence is associated with full Stat3 activation. Interestingly, neutrophil depletion had a marginal effect on the intensity of NF-{kappa}B activation (Fig. 9B). These data suggest that, in the model studied, Stat3 activation is dependent on neutrophil presence.



View larger version (63K):
[in this window]
[in a new window]
  		FIGURE 9. Effects of neutrophil depletion on Stat3, NF-{kappa}B activation, and expression of IL-6 and IL-10 in whole lung extracts. Rats received normal serum or anti-rat neutrophil antiserum 24 h before receiving intratracheal challenge with either PBS or IgG ICs. Four hours after PBS or IgG IC challenge, lungs were harvested. Stat3 (A) and NF-{kappa}B (B) binding activity of whole-lung nuclear extracts were assessed by EMSA. C, Expression of IL-6 and IL-10 was evaluated by RPA. D, mRNA expression of rat IL-6, IL-10, and GAPDH was assessed using semiquantitative RT-PCR. Results are from duplicate experiments.

 
To investigate the mechanism of neutrophil depletion in reduction of Stat3 activation, we performed both RPA and RT-PCR to examine whether the expression of IL-6 and IL-10 changed after neutrophil depletion. As illustrated in Fig. 9, C and D, lungs from neutrophil-depleted animals showed significantly decreased mRNA for IL-6 and IL-10 when compared with animals treated with normal serum, suggesting that reduced expression of IL-6 and IL-10 may be a potential mechanism for reduced Stat3 activation after neutrophil depletion.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The IgG IC model of lung injury in rats serves as a useful model for analysis of the acute inflammatory response. In this model, IgG IC deposition triggers complement activation and activation of residential lung macrophages via engagement of FcRs. Lung macrophages generate and secrete a number of mediators that initiate a proinflammatory cascade. Pulmonary expression of these mediators, such as TNF-{alpha} and IL-1, has been linked to activation of the transcription factors, both NF-{kappa}B and AP-1 (21, 22). Little is known regarding the role of other transcription factors in this model, and it is tempting to speculate that development of acute lung injury depends upon the balance between pro- and anti-inflammatory transcription factors. Recently, Stat3 has emerged as a negative regulator of inflammatory responses. Mice with cell-specific disruption of the Stat3 gene in macrophages and neutrophils are highly susceptible to endotoxin shock (11). Deletion of Stat3 causes compromised NADPH oxidase activities in neutrophils, suggesting that Stat3 plays critical roles in the development and regulation of innate immunity (12). We now provide evidence that Stat3 is activated in lung during IgG IC-induced acute lung injury. Stat3 activity appears to be chiefly regulated at the posttranslational level (phosphorylation). Constitutive expression of both Stat3 mRNA and protein was found in lung. Activation of Stat3 in the inflamed lung was associated with induction of Stat3 phosphorylation. These findings suggest that diverse protein kinases, including mitogen-activated protein kinases (MAPKs), are activated in this lung injury model. Indeed, several MAPKs have been shown to mediate phosphorylation of serine residues in Stats (34). Therefore, it would be interesting to investigate which MAPKs mediate Ser727 phosphorylation of Stat3 during IgG IC-induced lung injury.

In our previous study, it was demonstrated that IgG IC-induced inflammatory response in the lung is endogenously regulated by IL-6 and IL-10 (28, 29). Blockade of endogenous IL-6 or IL-10 by Abs resulted in significantly intensified inflammatory injury in the IgG-IC model, suggesting that a common late event in these signaling events is Stat3 activation, which may be a regulator of cytokine and chemokine expression. Unfortunately, because Stat3 knockout mice do not survive, the obvious experiments involving such mice cannot be done. We now demonstrate that Ab-induced blockade of endogenous IL-6 or IL-10 prevents IgG IC-induced Stat3 activation in lung, indicating that IL-6 and IL-10 may exert their regulatory function in vivo during acute lung injury by activating Stat3, which then serves as a negative regulator of the acute inflammatory response. Indeed, macrophages deficient in Stat3 or Jak1 are unable to inhibit LPS-induced TNF-{alpha} production after treatment with murine IL-10, indicating that IL-10 suppresses production of TNF-{alpha} through a Stat3-dependent pathway (35). Very recently, it has been demonstrated that enhanced NF-{kappa}B activation induced by LPS is observed in the absence of Stat3 (12). Using the same lung injury model, we have previously reported that both IL-10 and IL-13 suppress NF-{kappa}B activation in alveolar macrophages and in whole lung tissue, whereas IL-10, IL-6, and IL-13 can inhibit pulmonary TNF-{alpha} production at the same time (29, 36, 37). Consistent with our data, activation of both NF-{kappa}B and Stat3 was observed in injured lung induced by hemorrhagic shock (38). Therefore, it may be that although Stat3 is a transcriptional mediator for IL-6 and IL-10, it also plays an important antagonistic role to down-regulate the IgG IC-induced NF-{kappa}B activation.

Very recently, SOCS proteins have been shown to behave as feedback inhibitors of Jak and Stat signaling pathways. SOCS3 is strongly induced by LPS, IL-6, and IL-10 in macrophages (39, 40, 41). In vivo, SOCS3 specifically prevents activation of Stat3 by IL-6 (42). In our model, expression of SOCS3 was induced 1 h after onset of the IgG lung injury and became more evident at 2 and 4 h. Thus, it is likely that a negative feedback mechanism exists for the IL-6 signaling during IgG IC-induced lung injury process, although details of this pathway are not known. Recently, it was shown that inflammatory agents such as TNF-{alpha} and LPS activate SOCS3 expression, probably via the p38 pathway (41). A crucial role of MAPK extracellular signal-regulated kinase-1 and -2 in response to PMA stimulation for blocking Stat3 activation was also established (43). Thus, it will be of great interest to investigate how SOCS3 is up-regulated by IgG ICs. Interestingly, a recent report shows that activation of Stat3 by IL-6 and IL-10 in macrophages is differentially modulated by SOCS3, demonstrating that IL-10 signaling is much less sensitive to the inhibitory activity of SOCS3 than is IL-6 (30). This may also explain that, although SOCS3 protein expression is increased at similar times as Stat3 activation, it will not prevent the potentially beneficial actions of Stat3 because of the availability of the IL-10 pathway.

Perhaps one of the most interesting results reported here is the neutralization of C5a in the alveolar compartment, profoundly reducing lung Stat3 activation induced by IgG IC deposition (Fig. 5). It is known that C5a is required for the full development of injury and neutrophil accumulation in IgG IC-induced lung injury (44). Our previous studies have shown that intrapulmonary C5a blockade had no effect on IgG IC-induced lung NF-{kappa}B activation (21), suggesting that C5a promotes lung inflammation independent of NF-{kappa}B. In contrast, the current study clearly demonstrates that C5a is required for Stat3 activation in IgG IC-injured lung. Several G-protein-coupled receptors have been linked to activation of Stats (45, 46). Most recently, it was reported that C5a induced Stat3 phosphorylation in a pentoxifylline-insensitive manner in human erythroleukemia cells, suggesting that pentoxifylline-insensitive G proteins, such as G{alpha}16, were involved (47). In human neutrophils stimulated with FMLP or C5a, Stat3 Ser727, but not Tyr705, is phosphorylated (48). Whereas Stat3 activity is absolutely dependent on tyrosine phosphorylation, serine phosphorylation appears to be associated with maximal activation (49). We found that anti-C5a treatment caused decreased gene transcription for IL-6 but not for IL-10 in the inflamed lung (Fig. 5D). C5a could significantly stimulate the phosphorylation of Stat3 at Ser727 in NR8383 cells (Fig. 6), suggesting that C5a-induced Stat3 activation occurs both directly and indirectly.

Products of lung alveolar macrophages play a major role in events leading to lung injury. IL-6, TNF-{alpha}, and other cytokines and chemokines secreted by alveolar macrophages have been shown to modulate the cell signaling cascade for the production of other inflammatory and anti-inflammatory mediators during lung inflammation (14). Data in the current study show that Stat3 activation in alveolar macrophages in vivo occurs before Stat3 activation in whole lung tissues, implying that a negative feedback mechanism exists at the early time of inflammation in activated alveolar macrophages. Indeed, it has been reported that Stat3, by binding to a single motif in the IL-10 promoter, controls expression of the human IL-10 gene (50). Furthermore, we have shown that Stat3 activation induced by IgG ICs is dramatically suppressed by depletion of alveolar macrophages in whole lung tissues (Fig. 8A). This suppressive effect was accompanied by reduced gene expression of pro- and anti-inflammatory cytokines, including IL-6 and IL-10 (Fig. 8B), suggesting that inflammatory response caused the up-regulation of anti-inflammatory cytokines such as IL-6 and IL-10 and activation of their downstream mediators, including Stat3. Stat3 has been shown to be activated by oxidative stress (33, 34). It appears that damage to lung tissues after IgG IC deposition is mediated primarily by neutrophil-derived oxidants (51). We now provide evidence that depletion of neutrophils dramatically reduces IgG IC-induced activation of Stat3 in lung. Thus, extracellular oxidants derived from neutrophils may be required for Stat3 activation in in vivo injured lung. Furthermore, we demonstrated that lungs from neutrophil-depleted animals showed significantly decreased gene transcription activity for IL-6 and IL-10 compared with those animals treated with control serum, suggesting that reduced expression of IL-6 and IL-10 may be a potential mechanism for reduced Stat3 activation after neutrophil depletion. Taken together, our studies indicate that Stat3 activation in IgG IC-induced acute lung injury occurs and is initiated by products of alveolar macrophage and neutrophils.

In summary, our data suggest that there is a positive feedback between IL-6 and IL-10 induction of Stat3 activation during acute lung injury. These data suggest an anti-inflammatory role of Stat3 activation, which is distinct from NF-{kappa}B and AP-1 activation. Understanding the underlying roles of various transcriptional factors in regulating the network of inflammatory systems may be a crucial step for the development of new therapeutic targets for treatment of acute lung injury.


   Acknowledgments
 
We thank Beverly Schumann for her clerical assistance in the preparation of this manuscript.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant NIH GM-29507. Back

2 Address correspondence and reprint requests to Dr. Peter A. Ward, Department of Pathology, University of Michigan Medical School, 1301 Catherine Road, Ann Arbor, MI 48109-0602. E-mail address: pward{at}umich.edu Back

3 Abbreviations used in this paper: Jak, Janus kinase; IC, immune complex; Cl2MDP, dichloromethylene diphosphonate; SOCS, suppressor of cytokine signaling; BAL, bronchoalveolar lavage; PVDF, polyvinylidene difluoride; RPA, RNase protection assay; MAPK, mitogen-activated protein kinase. Back

Received for publication January 26, 2004. Accepted for publication April 13, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zhong, Z., Z. Wen, J. E. Darnell, Jr. 1994. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science 264:95.[Abstract/Free Full Text]
  2. Darnell, J. E., Jr. 1997. STATs and gene regulation. Science 277:1630.[Abstract/Free Full Text]
  3. Leonard, W. J., J. J. O’Shea. 1998. Jaks and STATs: biological implications. Annu. Rev. Immunol. 16:293.[Medline]
  4. Akira, S.. 1997. IL-6-regulated transcription factors. Int. J. Biochem. Cell Biol. 29:1401.[Medline]
  5. Guschin, D., N. Rogers, J. Briscoe, B. Witthuhn, D. Watling, F. Horn, S. Pellegrini, K. Yasukawa, P. Heinrich, G. R. Stark, et al 1995. A major role for the protein tyrosine kinase JAK1 in the JAK/STAT signal transduction pathway in response to interleukin-6. EMBO J. 14:1421.[Medline]
  6. Bromberg, J., J. E. Darnell, Jr. 2000. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19:2468.[Medline]
  7. Cheng, F., H. W. Wang, A. Cuenca, M. Huang, T. Ghansah, J. Brayer, W. G. Kerr, K. Takeda, S. Akira, S. P. Schoenberger, et al 2003. A critical role for Stat3 signaling in immune tolerance. Immunity 19:425.[Medline]
  8. Alonzi, T., D. Maritano, B. Gorgoni, G. Rizzuto, C. Libert, V. Poli. 2001. Essential role of STAT3 in the control of the acute-phase response as revealed by inducible gene inactivation in the liver. Mol. Cell. Biol. 21:1621.[Abstract/Free Full Text]
  9. Andrejko, K. M., J. Chen, C. S. Deutschman. 1998. Intrahepatic STAT-3 activation and acute phase gene expression predict outcome after CLP sepsis in the rat. Am. J. Physiol. 275:G1423.
  10. Hanada, T., T. Yoshida, I. Kinjyo, S. Minoguchi, H. Yasukawa, S. Kato, H. Mimata, Y. Nomura, Y. Seki, M. Kubo, A. Yoshimura. 2001. A mutant form of JAB/SOCS1 augments the cytokine-induced JAK/STAT pathway by accelerating degradation of wild-type JAB/CIS family proteins through the SOCS-box. J. Biol. Chem. 276:40746.[Abstract/Free Full Text]
  11. Takeda, K., B. E. Clausen, T. Kaisho, T. Tsujimura, N. Terada, I. Forster, S. Akira. 1999. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10:39.[Medline]
  12. Welte, T., S. S. Zhang, T. Wang, Z. Zhang, D. G. Hesslein, Z. Yin, A. Kano, Y. Iwamoto, E. Li, J. E. Craft, et al 2003. STAT3 deletion during hematopoiesis causes Crohn’s disease-like pathogenesis and lethality: a critical role of STAT3 in innate immunity. Proc. Natl. Acad. Sci. USA 100:1879.[Abstract/Free Full Text]
  13. Johnson, K. J., P. A. Ward. 1974. Acute immunologic pulmonary alveolitis. J. Clin. Invest. 54:349.
  14. Ward, P. A.. 1996. Role of complement, chemokines, and regulatory cytokines in acute lung injury. Ann. NY Acad. Sci. 796:104.[Medline]
  15. Mulligan, M. S., J. Varani, M. K. Dame, C. L. Lane, C. W. Smith, D. C. Anderson, P. A. Ward. 1991. Role of endothelial-leukocyte adhesion molecule 1 (ELAM-1) in neutrophil-mediated lung injury in rats. J. Clin. Invest. 88:1396.
  16. Mulligan, M. S., A. A. Vaporciyan, M. Miyasaka, T. Tamatani, P. A. Ward. 1993. Tumor necrosis factor {alpha} regulates in vivo intrapulmonary expression of ICAM-1. Am. J. Pathol. 142:1739.[Abstract]
  17. Mulligan, M. S., M. L. Jones, M. A. Bolanowski, M. P. Baganoff, C. L. Deppeler, D. M. Meyers, U. S. Ryan, P. A. Ward. 1993. Inhibition of lung inflammatory reactions in rats by an anti-human IL-8 antibody. J. Immunol. 150:5585.[Abstract]
  18. Mulligan, M. S., A. A. Vaporciyan, R. L. Warner, M. L. Jones, K. E. Foreman, M. Miyasaka, R. F. Todd, 3rd, P. A. Ward. 1995. Compartmentalized roles for leukocytic adhesion molecules in lung inflammatory injury. J. Immunol. 154:1350.[Abstract]
  19. Shanley, T. P., H. Schmal, R. L. Warner, E. Schmid, H. P. Friedl, P. A. Ward. 1997. Requirement for C-X-C chemokines (macrophage inflammatory protein-2 and cytokine-induced neutrophil chemoattractant) in IgG immune complex-induced lung injury. J. Immunol. 158:3439.[Abstract]
  20. Mulligan, M. S., E. Schmid, B. Beck-Schimmer, G. O. Till, H. P. Friedl, R. B. Brauer, T. E. Hugli, M. Miyasaka, R. L. Warner, K. J. Johnson, P. A. Ward. 1996. Requirement and role of C5a in acute lung inflammatory injury in rats. J. Clin. Invest. 98:503.[Medline]
  21. Lentsch, A. B., B. J. Czermak, N. M. Bless, P. A. Ward. 1998. NF-{kappa}B activation during IgG immune complex-induced lung injury: requirements for TNF-{alpha} and IL-1{beta} but not complement. Am. J. Pathol. 152:1327.[Abstract]
  22. Guo, R. F., A. B. Lentsch, J. V. Sarma, L. Sun, N. C. Riedemann, S. D. McClintock, S. R. McGuire, N. Van Rooijen, P. A. Ward. 2002. Activator protein-1 activation in acute lung injury. Am. J. Pathol. 161:275.[Abstract/Free Full Text]
  23. Lentsch, A. B., P. A. Ward. 2000. The NF{kappa}Bb/I{kappa}B system in acute inflammation. Arch. Immunol. Ther. Exp. (Warsz) 48:59.[Medline]
  24. Czermak, B. J., V. Sarma, N. M. Bless, H. Schmal, H. P. Friedl, P. A. Ward. 1999. In vitro and in vivo dependency of chemokine generation on C5a and TNF-{alpha}. J. Immunol. 162:2321.[Abstract/Free Full Text]
  25. Calo, V., M. Migliavacca, V. Bazan, M. Macaluso, M. Buscemi, N. Gebbia, A. Russo. 2003. STAT proteins: from normal control of cellular events to tumorigenesis. J. Cell. Physiol. 197:157.[Medline]
  26. Wehinger, J., F. Gouilleux, B. Groner, J. Finke, R. Mertelsmann, R. M. Weber-Nordt. 1996. IL-10 induces DNA binding activity of three STAT proteins (Stat1, Stat3, and Stat5) and their distinct combinatorial assembly in the promoters of selected genes. FEBS Lett. 394:365.[Medline]
  27. Lai, C. F., J. Ripperger, K. K. Morella, J. Jurlander, T. S. Hawley, W. E. Carson, T. Kordula, M. A. Caligiuri, R. G. Hawley, G. H. Fey, H. Baumann. 1996. Receptors for interleukin (IL)-10 and IL-6-type cytokines use similar signaling mechanisms for inducing transcription through IL-6 response elements. J. Biol. Chem. 271:13968.[Abstract/Free Full Text]
  28. Shanley, T. P., J. L. Foreback, D. G. Remick, T. R. Ulich, S. L. Kunkel, P. A. Ward. 1997. Regulatory effects of interleukin-6 in immunoglobulin G immune-complex-induced lung injury. Am. J. Pathol. 151:193.[Abstract]
  29. Shanley, T. P., H. Schmal, H. P. Friedl, M. L. Jones, P. A. Ward. 1995. Regulatory effects of intrinsic IL-10 in IgG immune complex-induced lung injury. J. Immunol. 154:3454.[Abstract]
  30. Niemand, C., A. Nimmesgern, S. Haan, P. Fischer, F. Schaper, R. Rossaint, P. C. Heinrich, G. Muller-Newen. 2003. Activation of STAT3 by IL-6 and IL-10 in primary human macrophages is differentially modulated by suppressor of cytokine signaling 3. J. Immunol. 170:3263.[Abstract/Free Full Text]
  31. Berlato, C., M. A. Cassatella, I. Kinjyo, L. Gatto, A. Yoshimura, F. Bazzoni. 2002. Involvement of suppressor of cytokine signaling-3 as a mediator of the inhibitory effects of IL-10 on lipopolysaccharide-induced macrophage activation. J. Immunol. 168:6404.[Abstract/Free Full Text]
  32. Simon, A. R., U. Rai, B. L. Fanburg, B. H. Cochran. 1998. Activation of the JAK-STAT pathway by reactive oxygen species. Am. J. Physiol. 275:C1640.
  33. Pelletier, S., F. Duhamel, P. Coulombe, M. R. Popoff, S. Meloche. 2003. Rho family GTPases are required for activation of Jak/STAT signaling by G protein-coupled receptors. Mol. Cell. Biol. 23:1316.[Abstract/Free Full Text]
  34. Decker, T., P. Kovarik. 2000. Serine phosphorylation of STATs. Oncogene 19:2628.[Medline]
  35. Riley, J. K., K. Takeda, S. Akira, R. D. Schreiber. 1999. Interleukin-10 receptor signaling through the JAK-STAT pathway: requirement for two distinct receptor-derived signals for anti-inflammatory action. J. Biol. Chem. 274:16513.[Abstract/Free Full Text]
  36. Lentsch, A. B., T. P. Shanley, V. Sarma, P. A. Ward. 1997. In vivo suppression of NF-{kappa}B and preservation of I{kappa}B{alpha} by interleukin-10 and interleukin-13. J. Clin. Invest. 100:2443.[Medline]
  37. Mulligan, M. S., R. L. Warner, J. L. Foreback, T. P. Shanley, P. A. Ward. 1997. Protective effects of IL-4, IL-10, IL-12, and IL-13 in IgG immune complex-induced lung injury: role of endogenous IL-12. J. Immunol. 159:3483.[Abstract]
  38. Meng, Z. H., K. Dyer, T. R. Billiar, D. J. Tweardy. 2000. Distinct effects of systemic infusion of G-CSF vs. IL-6 on lung and liver inflammation and injury in hemorrhagic shock. Shock 14:41.[Medline]
  39. Stoiber, D., P. Kovarik, S. Cohney, J. A. Johnston, P. Steinlein, T. Decker. 1999. Lipopolysaccharide induces in macrophages the synthesis of the suppressor of cytokine signaling 3 and suppresses signal transduction in response to the activating factor IFN-{gamma}. J. Immunol. 163:2640.[Abstract/Free Full Text]
  40. Cassatella, M. A., S. Gasperini, C. Bovolenta, F. Calzetti, M. Vollebregt, P. Scapini, M. Marchi, R. Suzuki, A. Suzuki, A. Yoshimura. 1999. Interleukin-10 (IL-10) selectively enhances CIS3/SOCS3 mRNA expression in human neutrophils: evidence for an IL-10-induced pathway that is independent of STAT protein activation. Blood 94:2880.[Abstract/Free Full Text]
  41. Bode, J. G., A. Nimmesgern, J. Schmitz, F. Schaper, M. Schmitt, W. Frisch, D. Haussinger, P. C. Heinrich, L. Graeve. 1999. LPS and TNF{alpha} induce SOCS3 mRNA and inhibit IL-6-induced activation of STAT3 in macrophages. FEBS Lett. 463:365.[Medline]
  42. Yasukawa, H., M. Ohishi, H. Mori, M. Murakami, T. Chinen, D. Aki, T. Hanada, K. Takeda, S. Akira, M. Hoshijima, et al 2003. IL-6 induces an anti-inflammatory response in the absence of SOCS3 in macrophages. Nat. Immunol. 4:551.[Medline]
  43. Sengupta, T. K., E. S. Talbot, P. A. Scherle, L. B. Ivashkiv. 1998. Rapid inhibition of interleukin-6 signaling and Stat3 activation mediated by mitogen-activated protein kinases. Proc. Natl. Acad. Sci. USA 95:11107.[Abstract/Free Full Text]
  44. Czermak, B. J., A. B. Lentsch, N. M. Bless, H. Schmal, H. P. Friedl, P. A. Ward. 1998. Role of complement in in vitro and in vivo lung inflammatory reactions. J. Leukocyte Biol. 64:40.[Abstract]
  45. Marrero, M. B., B. Schieffer, W. G. Paxton, L. Heerdt, B. C. Berk, P. Delafontaine, K. E. Bernstein. 1995. Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor. Nature 375:247.[Medline]
  46. Wong, M., E. N. Fish. 1998. RANTES and MIP-1{alpha} activate Stats in T cells. J. Biol. Chem. 273:309.[Abstract/Free Full Text]
  47. Lo, R. K., H. Cheung, Y. H. Wong. 2003. Constitutively active G{alpha}16 stimulates STAT3 via a c-Src/JAK- and ERK-dependent mechanism. J. Biol. Chem. 278:5215.
  48. Kuroki, M., J. T. O’Flaherty. 1999. Extracellular signal-regulated protein kinase (ERK)-dependent and ERK-independent pathways target STAT3 on serine-727 in human neutrophils stimulated by chemotactic factors and cytokines. Biochem. J. 341:691.
  49. Wen, Z., Z. Zhong, J. E. Darnell, Jr. 1995. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241.[Medline]
  50. Benkhart, E. M., M. Siedlar, A. Wedel, T. Werner, H. W. Ziegler-Heitbrock. 2000. Role of Stat3 in lipopolysaccharide-induced IL-10 gene expression. J. Immunol. 165:1612.[Abstract/Free Full Text]
  51. Johnson, K. J., P. A. Ward. 1981. Role of oxygen metabolites in immune complex injury of lung. J. Immunol. 126:2365.[Medline]



This article has been cited by other articles:


Home page
 J. Appl. Physiol.Home page
M. Ikegami, A. Falcone, and J. A. Whitsett
STAT-3 regulates surfactant phospholipid homeostasis in normal lung and during endotoxin-mediated lung injury
J Appl Physiol, June 1, 2008; 104(6): 1753 - 1760.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
A. Chatterjee, C. Dimitropoulou, F. Drakopanayiotakis, G. Antonova, C. Snead, J. Cannon, R. C. Venema, and J. D. Catravas
Heat Shock Protein 90 Inhibitors Prolong Survival, Attenuate Inflammation, and Reduce Lung Injury in Murine Sepsis
Am. J. Respir. Crit. Care Med., October 1, 2007; 176(7): 667 - 675.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
V. Contreras-Shannon, O. Ochoa, S. M. Reyes-Reyna, D. Sun, J. E. Michalek, W. A. Kuziel, L. M. McManus, and P. K. Shireman
Fat accumulation with altered inflammation and regeneration in skeletal muscle of CCR2-/- mice following ischemic injury
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C953 - C967.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. Cao, T. L. Tal, L. M. Graves, I. Gilmour, W. Linak, W. Reed, P. A. Bromberg, and J. M. Samet
Diesel exhaust particulate-induced activation of Stat3 requires activities of EGFR and Src in airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L422 - L429.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
A. S. Farivar, H. E. Merry, M. J. Fica-Delgado, A. S. McCourtie, B. C. Mackinnon-Patterson, and M. S. Mulligan
Interleukin-6 Regulation of Direct Lung Ischemia Reperfusion Injury
Ann. Thorac. Surg., August 1, 2006; 82(2): 472 - 478.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Matsuzaki, Y. Xu, M. Ikegami, V. Besnard, K.-S. Park, W. M. Hull, S. E. Wert, and J. A. Whitsett
Stat3 Is Required for Cytoprotection of the Respiratory Epithelium during Adenoviral Infection
J. Immunol., July 1, 2006; 177(1): 527 - 537.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Gao, L. M. Hoesel, R.-F. Guo, N. J. Rancilio, J. V. Sarma, and P. A. Ward
Adenoviral-Mediated Overexpression of SOCS3 Enhances IgG Immune Complex-Induced Acute Lung Injury
J. Immunol., July 1, 2006; 177(1): 612 - 620.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. A. R. Rahimi, K. Gee, S. Mishra, W. Lim, and A. Kumar
STAT-1 Mediates the Stimulatory Effect of IL-10 on CD14 Expression in Human Monocytic Cells
J. Immunol., June 15, 2005; 174(12): 7823 - 7832.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
M. Severgnini, S. Takahashi, P. Tu, G. Perides, R. J. Homer, J. W. Jhung, D. Bhavsar, B. H. Cochran, and A. R. Simon
Inhibition of the Src and Jak Kinases Protects against Lipopolysaccharide-induced Acute Lung Injury
Am. J. Respir. Crit. Care Med., April 15, 2005; 171(8): 858 - 867.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gao, H.
Right arrow Articles by Ward, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gao, H.
Right arrow Articles by Ward, P. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS