|
|
||||||||



Departments of
*
Immunology and
Biochemistry, University of Toronto, Toronto, Ontario, Canada; and
Department of Biochemistry, McGill University, Montréal, Québec, Canada
| Abstract |
|---|
|
|
|---|
2-microglobulin and maintained until the class I molecule has left the ER. We also show that Bap31 is part of the peptide-loading complex, although is not required for its formation. Bap31 binds not only to class I molecules, but can bind to tapasin in the absence of class I. Consistent with an important role in recruiting class I molecules to transport vesicles, we show that in the absence of Bap29/31, there is a loss of class I colocalization with mSec31 (p137), a component of mammalian coat protein complex II coats. This observation is also associated with a delay in class I traffic from ER to Golgi. Our results are consistent with the view that class I molecules are largely recruited to ER exit sites by Bap29/31, and that Bap29/31 is a cargo receptor for MHC class I molecules. | Introduction |
|---|
|
|
|---|
2-microglobulin (
2m), 3 and peptide) in the endoplasmic reticulum (ER) and later transport to the cell surface are crucial for successful presentation of Ags. Numerous studies have focused on identifying the proteins regulating MHC class I synthesis, as well as defining the requirements for high surface expression. It is now clear that the efficiency of peptide loading and class I cell surface expression are highly dependent on a series of events leading to the formation of the ER peptide-loading complex (reviewed in Refs. 1 and 2).
During its biogenesis, mouse class I H chain first associates with the ER chaperone calnexin (CNX) that promotes its folding and subsequent assembly with
2m (3, 4). The H chain-
2m heterodimer then forms the peptide-loading complex with the chaperones calreticulin (CRT) and/or CNX, the thiol oxidoreductase ERp57, tapasin, and the transporter associated with Ag processing (TAP). The role of each of these molecules is relatively well established: CNX promotes assembly and mediates retention of empty class I in the ER (3, 5); CRT increases class I stability by promoting peptide loading (6); ERp57 is involved in the formation of disulfide bonds at both the early and late stages of class I folding (7, 8); TAP transports peptides generated in the cytosol by the proteasome into the ER lumen (9); and tapasin promotes TAP stability and peptide transport, as well as class I peptide binding and thermostability (10, 11, 12).
The mechanisms by which class I molecules are targeted to ER exit sites and exported to the Golgi apparatus, and ultimately to the cell surface, are much less understood. Most secreted and membrane proteins are thought to be transported from the ER to Golgi in coat protein complex II (COPII)-coated vesicles that bud out of ER exit sites and fuse with the Golgi membrane. The packaging of cargo proteins into these vesicles can be accomplished randomly by bulk flow or by a much more regulated mechanism involving specialized signals and receptors (13). Class I molecules do not appear to possess any identifiable export signal, but their export out of the ER seems to be regulated by more than dissociation from the peptide-loading complex. Indeed, it is known that addition of exogenous peptide to cells triggers dissociation from TAP but does not affect the rate of transport to the Golgi. Also, fully peptide-loaded class I molecules can be found in the ER and accumulate at ER exit sites, from which TAP is excluded (14, 15, 16). Recently, class I molecules have also been found to associate with B cell-associated protein (Bap)31, an ER molecule previously identified as a putative cargo receptor (16).
Bap31 is a polytopic membrane protein of the ER and ER-trafficking vesicles (17, 18). It is recognized as a member of the B cell receptor-associated family of proteins, which also include Bap29. The two proteins are 43% identical in amino acid sequence and have been shown to form homo- or heterodimers. They were first identified as copurifying with membrane Igs (19) and have recently been shown to be involved in the ER retention of these molecules in the absence of Ig
/Ig
(20). Bap31 has also been shown to control the traffic and function of the cystic fibrosis transmembrane conductance regulator (CFTR). Antisense inhibition of full-length Bap31 or mutation of its KKXX ER retrieval motif increases the expression of both wild-type (WT) and mutant forms of CFTR while expression of Bap31 with CFTR in Xenopus oocytes reduces the expression and function of the transporter. Importantly, this effect is enhanced upon cotransfection of Bap29, suggesting a functional relevance to the heterodimer (21). Bap31 is also involved in the anterograde transport of the endosomal membrane protein cellubrevin, which is retained in the ER when expressed with a truncated form of Bap31 (18). In addition to being a regulator of protein trafficking, Bap31 also contains a death effector domain in its cytoplasmic tail. As a preferred caspase-8 substrate, Bap31 regulates ER-mediated apoptosis, possibly through the promotion of membrane fragmentation and release of cytochrome c from mitochondria (22, 23).
Our investigation of Bap29/31 in connection with the biogenesis of class I molecules revealed significant and prolonged binding to class I and class I-associated molecules. We also found that Bap29/31 is required for optimal targeting of class I molecules to ER exit sites, as well as for proper traffic from ER to Golgi. These results are consistent with a model in which class I molecules are largely recruited to ER exit sites by Bap29/31 and suggest that Bap29/31 is a cargo receptor for MHC class I.
| Materials and Methods |
|---|
|
|
|---|
Bap29/31 double-knockout (DKO) differentiated embryonic stem (ES) cells were generated as described (22) and were maintained in knockout DMEM supplemented with 15% FBS, 1x MEM nonessential amino acids, glutamine, antibiotics, and 0.1 mM 2-ME. Mouse L cells expressing H-2Dd were maintained in high glucose-DMEM supplemented with 10% FBS, glutamine, and antibiotics. RMA/RMA-S cells (24), K41/K42 (6), and R1E cells stably transfected with the Db H chain alone or Db H chain and
2m (25) were all maintained in RPMI 1640 supplemented with 10% FBS, glutamine, and antibiotics.
The following Abs to MHC class I molecules were used in this study: mAb 34-2-12S, which recognizes the
3 domain of Dd molecules independently of
2m association; mAb 34-5-8S, specific for
2m-associated Dd (26); mAb 20-8-4S, which recognizes
2m-associated Kb (27), and mAb 28-14-8S, specific for Db independently of
2m association (28). Rabbit antiserum specific for denatured mouse H chain was kindly provided by Dr. H. Ploegh (Harvard University, Cambridge, MA) (29). mAb MKD6 was used as an isotype control. Rabbit anti-mouse TAP2 antiserum was provided by Drs. Y. Yang and P. Peterson (R.W. Johnson, La Jolla, CA). Anti-tapasin antiserum was raised in rabbits against the C-terminal 20 aa of murine tapasin (30). Rabbit anti-CNX antiserum directed against the ER luminal domain of CNX has been described previously (31). Anti-CRT antiserum, SPA-600, was purchased from StressGen Biotechnologies (Victoria, British Columbia, Canada). Rabbit anti-human Bap29 and Bap31 are described in Ref. 22 . Anti-p137 directed against mSec31 was a generous gift of Dr. A. Hubbard (Johns Hopkins University School of Medicine, Baltimore, MD) (32).
RNA interference and transfections
Double-stranded small interfering RNA (siRNA) targeting Bap31 (AACCTCCAGAACAATCCAGGT), Bap29 (AACCTGAAAACCGAGCTGAAG), and nontargeting controls were purchased from Xeragon (Germantown, MD). siRNAs were transfected into mouse L cells expressing H-2Dd using oligofectamine (Invitrogen, San Diego, CA) according to the manufacturers protocol. The interference was allowed to proceed for 5 days posttransfection before the assays were performed. For each experiment,
1 x 106 Bap29/31 or control siRNA-transfected cells were used to assess the efficiency of the interference by Western blot. Equivalent cell numbers were loaded and separated by SDS-PAGE, transferred onto an Immobilon membrane (Millipore, Bedford, MA), and blotted with either anti-Bap29 or anti-Bap31 antiserum. Detection was performed by ECL (Amersham, Little Chalfont, U.K.).
Metabolic labeling and immunoisolation
For pulse-chase experiments with the Bap29/31 DKO cells, 2 x 106 cells were plated onto 100-mm dishes, and the expression of MHC class I was induced by incubation in the presence of 800 U/ml IFN-
for 48 h before radiolabeling. Cells were then starved for 30 min with methionine (Met)-free RPMI 1640, and pulse-labeled for 10 min with 2 ml of medium containing 0.2 mCi of [35S]Met (>1000 Ci/mmol; Amersham). Complete DMEM containing 1 mM Met was then used to wash and chase for various times. Lysis was conducted in PBS containing 1% Nonidet P-40, 10 mM iodoacetamide, and protease inhibitors (10 µg/ml each: leupeptin, antipain, and pepstatin), and H-2Kb molecules were immunoprecipitated with mAb 20-8-4S as described before (33). Recovered material was digested with endo-
-N-acetylglucosaminidase H (Endo H; New England Biolabs, Beverly, MA) before analysis by SDS-PAGE (10% gel). The same procedure was used for the pulse-chase experiment on siRNA-treated H-2Dd L cells, but without the IFN-
incubation period. H-2Dd molecules were isolated with mAb 34-2-12S.
For sequential immunoprecipitations (IPs), 4 x 106 H-2Dd-expressing L cells were plated on 100-mm dishes 16 h before radiolabeling. Cells were then starved as described above and labeled with 2 ml of Met-free RPMI 1640 containing 0.4 mCi of [35S]Met for either 10 min (pulse-chase), 30 min (Fig. 1A), or 1.5 h (Figs. 2 and 3). Cells were lysed for 30 min in 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in PBS containing 10 mM iodoacetamide and protease inhibitors (10 µg/ml each: leupeptin, antipain, and pepstatin), and centrifuged 10 min at 10,000 RPM. To isolate Bap31 molecules associated with class I molecules or the peptide-loading complex (Fig. 2A), the lysates were subjected to a first round of IP with mAb 34-2-12S or antisera to free H chains, tapasin, TAP, CRT, or CNX. Immune complexes were recovered by protein-A beads, washed 23 times, and disrupted by incubation with 50 µl of 0.2% SDS in PBS containing 2 mM DTT at 95 °C for 5 min. Eluted material was recovered and adjusted with 1.5 ml of 1% Nonidet P-40. A second round of IP was performed using either 10 µl of affinity-purified anti-Bap31 serum or 20 µl of crude antiserum. For Fig. 2B, the peptide-loading complex was immunoisolated using the anti-tapasin antiserum and multiple rounds of sequential IPs, with the indicated Abs followed on the same lysate to isolate each component of the peptide-loading complex individually. To isolate Dd molecules complexed with Bap31 (Fig. 1), the anti-Bap31 serum was used in the first round of IP, the disruption was performed at 40°C for 1 h in the absence of DTT (33), and mAb 34-2-12S was used in the second round of IP.
|
|
|
To determine the cell surface levels of H-2Dd in the presence or absence of Bap29/31, Dd-expressing L cells (3.5 x 105) transfected with control or Bap29/31 siRNA were removed from plates by trypsinization and incubated on ice for 1520 min in 0.1 ml of FACS buffer (HBSS with 1% BSA and 0.01% NaN3) containing 1.5 µg of either mAb 34-5-8S or mAb 34-2-12S. Cells were washed once and incubated 1520 min on ice with 0.4 µg of fluorescein-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) in 0.1 ml of FACS buffer. Cells were washed twice and resuspended in 0.3 ml of PBS containing 0.5% paraformaldehyde. Analysis followed using an Epics Elite Flow cytometer (Beckman Coulter, Fullerton, CA). For experiments measuring the turnover of cell surface Dd molecules, cells were trypsinized the day before the experiment, replated onto fresh dishes, and incubated overnight at 26°C in serum-free DMEM supplemented with 10 µg/ml exogenous human
2m (Sigma-Aldrich, St. Louis, MO). Cells were then washed with cold medium, transferred to 37°C, and incubated in prewarmed DMEM containing 10 µg/ml brefeldin A (Sigma-Aldrich) for various times. At each time point, cells were dislodged by pipetting and immediately transferred to a tube containing 2 ml of FACS buffer. Aliquots collected at the indicated time points were analyzed by FACS as described above, using the conformation-dependent H-2Dd mAb 34-5-8S.
Confocal fluorescence microscopy
Dd L cells transfected with control or Bap29/31 siRNA for 4 days were trypsinized and replated on 10-well multitest slides (ICN Biomedicals, Aurora, Ohio) at a density of 0.51 x 104 cells/well. Cells were allowed to spread out on the glass slide overnight. The next day, cells were fixed by cross-linking with 4% formaldehyde for 1015 min and washed twice with PBS. Cells were then incubated with 50 mM NH4Cl for 5 min, washed, permeabilized for 2 min with 0.2% Triton X-100, and blocked with 1% BSA for 45 min. Cells were stained for 1 h with rabbit anti-p137/mSec31 (1:500) and mouse mAb 34-5-8S (1:100). The FITC-conjugated donkey anti-rabbit secondary Ab and the rhodamine-conjugated goat anti-mouse Ab (Jackson ImmunoResearch Laboratories) were used at a 1/100 dilution. Negative control wells were stained with secondary Abs only. Coverslips were mounted on the multiwell slides in 1% p-phenylenediamine (Sigma-Aldrich) to minimize bleaching. Imaging was performed on a confocal Zeiss Axioplan 2 microscope with LSM 510 scanning module (Zeiss, Oberkochen, Germany) using x40 and x100 objectives. The colocalization scatter diagrams were generated using the colocalization function of the Zeiss LSM 510 software. As required for this function to be valid, there was no cross-talk between the red and green dyes. The entire areas were analyzed for colocalization without arbitrary background threshold being set. No quantitative colocalization coefficients were derived from this analysis, and it is thus a qualitative graphical representation of the confocal images.
| Results |
|---|
|
|
|---|
2m-associated H-2Dd and dissociates at the time of ER to Golgi transport
Spiliotis and colleagues (16) previously showed that Bap31 binds to H-2Kb in FT1+ cells and H-2Ld in Ld-transfected L cells. To further investigate the association between mouse MHC class I molecules and Bap31, we used L cells stably transfected with H-2Dd. Fig. 1A (lane 1) shows that Bap31 binds to a multitude of proteins when purified by immunoisolation and mild washing. To specifically look at the interaction with H-2Dd, we thus performed metabolic labeling, followed by sequential IPs. In lanes 2 and 3, labeled lysates were subjected to a first round of IP with anti H-2Dd/
2m mAb 34-5-8S, followed by a second round of IP with anti-Bap31 antiserum (lane 3) or a control Ab (lane 2). A band corresponding to Bap31 is detected in lane 3 but not lane 2. The sequential IP was also performed using the anti-Bap31 antiserum first, followed by H-2Dd mAb in the second round, in which case we detected a signal corresponding to Dd in lane 7. No band was detected when a control Ab was used in the second IP (lane 6). These results show that Bap31 associates with H-2Dd, in addition to H-2Kb and H-2Ld.
A similar experiment was performed in Fig. 1B to assess the kinetics of interaction between Dd and Bap31. Dd L cells were pulse-labeled for 10 min and chased for up to 3 h, and a sequential IP was performed at each time point to detect the Bap31-associated Dd pool. A faint band corresponding to Dd was detected at chase time 0 min, which peaked at 30 min and almost completely disappeared at 180 min. As shown in the middle part of the gel, this loss of interaction correlates with the acquisition of Endo H resistant (Endo Hr) glycans, which indicates that Dd molecules are released from Bap31 before reaching the medial Golgi. This was substantiated by the observation that the Bap31-associated form of Dd detected in the left part of the gel appears to be completely Endo H sensitive (Endo Hs). A straight Dd IP using a
2m-dependent mAb was also conducted in parallel (Fig. 1B, right panel) to show the kinetics of
2m assembly. The amount of
2m-associated H chain dramatically increased from time 0 to 30 min, which paralleled Dd association with Bap31. This may suggest that the pool of class I molecules that binds to Bap31 is
2m associated.
Bap31 is present in the peptide-loading complex but does not affect its formation or the steady-state levels of class I at the cell surface
Results shown in Fig. 1B demonstrate that the amount of Dd molecules associated with Bap31 peaked after 10 min of pulse and 1530 min of chase. Under these conditions, Dd H chains were largely Endo Hs and would be expected to be part of the peptide-loading complex, implying that Bap31 should also be present in this complex. To verify this assumption, we performed metabolic labeling and sequential IP using a series of Abs to different members of the peptide-loading complex, followed by an Ab to Bap31. Fig. 2A shows that as suspected from the kinetics data (Fig. 1B), the Dd/
2m dimer bound to Bap31, whereas the free Dd H chain did not. This indicates a preference of Bap31 for the
2m-associated species. We also found that Bap31 was associated with tapasin, TAP2, and CNX, but not with CRT. This lack of Bap31 detection in the CRT IP is surprising because CRT is part of the peptide-loading complex. However, this may be due to the fact that contrary to the other molecules examined, CRT is soluble and its association with the peptide-loading complex might be less stable during immunoisolation.
These results prompted us to analyze the role of Bap29/31 in the formation of the peptide-loading complex. In Fig. 2B, the peptide-loading complex from control or Bap29/31 siRNA-transfected Dd L cells was immunoisolated with anti-tapasin antiserum, and the presence of associated proteins was assessed by sequential IP. The presence of bands of similar intensities in the Bap29/31-positive and -depleted cells suggest that the peptide-loading complex is formed properly regardless of the presence of Bap29/31. We also investigated the effect of Bap29/31 on the steady-state levels of Dd at the cell surface and on peptide occupancy, using thermostability of those surface Dd molecules as a readout. Whether
2m-independent (Fig. 2C, left) or -dependent (Fig. 2C, right) Abs were used, the removal of Bap29/31 by siRNA had no effect on the amount of Dd detected at the cell surface by flow cytometry. It also had no effect on the thermostability of surface Dd, as its level over time was similar in the presence or absence of Bap29/31 (Fig. 2C, bottom). We have previously shown that class I molecules devoid of peptide or loaded with low affinity peptides disappear from the cell surface over the course of 4 h (33). The presence of a steady cell surface Dd signal over that period of time, as shown in Fig. 2C, suggests that Dd molecules are loaded with high affinity peptides regardless of the presence of Bap29/31. A Western blot analysis indicated that Bap29/31 proteins were
90% depleted from the cells by siRNA treatment, whereas a control protein, CNX, was not affected by this treatment (Fig. 2D). These results suggest that Bap31 is found in the peptide-loading complex but does not affect the steady-state levels of class I molecules at the cell surface and is likely not required for peptide binding.
Bap31 associates independently with both class I molecules and tapasin
Sequential IP is a useful technique to determine whether two proteins are found in the same complex, but does not provide information regarding the nature of the interaction. Because we found Bap31 bound to several proteins of the peptide-loading complex, it was important to establish whether these interactions were direct or not. To make these assessments, we made use of several mouse cell lines, each lacking one component of the peptide-loading complex (i.e., R1E cells lacking
2m, RMA-S lacking TAP2, K42 lacking CRT, tpn/ cells, and a Dd mutant unable to bind to tapasin). Sequential IP was performed in each component negative cell line and its WT equivalent (Fig. 3), ensuring that the total levels of class I and Bap31 expressed in the mutant vs WT cells were similar. A loss of Bap31 interaction signal indicates a dependence on the missing component. In
2m-negative R1E cells (Fig. 3A), we found that free Db H chains do not interact with Bap31, which was expected as Fig. 2A shows that only
2m-assembled class I molecules bind to Bap31. However, tapasin remained associated with Bap31 in the same cell line, indicating that this interaction is independent of MHC class I. The absence of TAP2 (Fig. 3B) or CRT (Fig. 3C) did not influence either Db or tapasin association with Bap31. Tapasin-deficient cells (Fig. 3D), which were pretreated with IFN-
to enhance their level of class I to that of their WT equivalent, show an interaction between H-2Db and Bap31. To confirm the validity of this result, the association between Dd mutant N127A/E128A (33), which does not bind tapasin, and Bap31 was examined and detected (Fig. 3E). We thus found that under two different conditions of tapasin depletion, class I still associates with Bap31. However, it is worth mentioning that depending on the experiment, the absence of tapasin sometimes had a minor impact on the association between class I and Bap31. This suggests that tapasin, although not required for class I binding to Bap31, might facilitate or stabilize the interaction. We also found that the absence of tapasin prevents the binding of TAP2 to Bap31 (Fig. 3F), suggesting that the TAP/Bap31 interaction is indirect and depends on tapasin. The lack of appropriate mouse cell lines prevented us from expanding the scope of this analysis to include CNX and ERp57, and thus we cannot exclude the possibility that these molecules may bridge the Bap31 association with class I or tapasin. Nonetheless, these results indicate that class I molecules and tapasin both bind to Bap31 independently of each other, whereas the association of TAP with Bap31 is indirect and mediated by tapasin.
Transport of MHC class I is delayed in the absence of Bap29/31
To determine whether Bap29/31 is involved in the regulation of class I transport from ER to Golgi, we made use of Bap29/31-deficient differentiated ES cells (22). DKO cells and their WT equivalent were treated with IFN-
to induce MHC class I expression, and the rate of ER to Golgi transport of H-2Kb was assessed by pulse-chase radiolabeling (Fig. 4A). The maturation of the Kb H chain from an ER-localized Endo Hs to a Golgi-localized Endo Hr form was monitored over 3 h. In WT cells, Kb appears in the Golgi with a t1/2 of 50 min, whereas the t1/2 is 105 min in the DKO cells. To confirm that this delay in transport was also valid for H-2Dd, we performed RNA interference on Bap29 and Bap31 in Dd L cells. The transfection of siRNA targeting both genes led to a near complete suppression of Bap29 and Bap31 protein expression (data not shown). The transport rate of Dd in these cells was assessed by pulse-chase and Endo H digestion. Fig. 4B shows that the conversion of Dd from Endo Hs to Endo Hr was delayed in the Bap29/31 siRNA-transfected cells, with an ER to Golgi transport t1/2 of 110 min compared with 60 min for the control siRNA-treated cells (Fig. 4C). A reduction of signal intensity was observed after 3 h of chase for both control and siRNA-treated cells. This phenomenon, which seemed to affect primarily Endo HS species, was noticeable in multiple experiments and appeared to be independent of the presence of Bap29/31. In Fig. 1B, which used the same cells and a similar methodology but two different Abs, we observed a slight loss of total H chain signal (mAb 34-2-12S) but not of assembled H chain (mAb 34-5-8S) at time 3 h. This suggests that the assembly of Dd molecules is not complete in these cells and that there is a loss of incompletely assembled molecules over time. Because similar losses were observed in control and siRNA-treated cells, this does not affect a comparison of the ER to Golgi transport kinetics. A similar impaired transport phenotype was obtained with cells transfected with siRNA to Bap31 alone (data not shown), but for consistency with the DKO cells, the double transfection was performed. These results confirm the observations made in the DKO cells, and suggest that Bap29/31 is a common regulator of mouse MHC class I transport.
|
It is known that upon release from the peptide-loading complex, MHC class I molecules are targeted to ER exit sites where they accumulate, waiting to be packaged into COPII transport vesicles (16). To determine whether Bap29/31 is involved in this process, we examined the intracellular localization of Dd in L cells rendered deficient in Bap29/31 by siRNA treatment. The distribution of
2m-assembled Dd molecules was compared with that of endogenous mSec31, a component of the mammalian COPII coat that is localized at ER exit sites (32). Fig. 5 shows a rather vesicular distribution of Dd/
2m concentrated around the nucleus with some signal at the cell surface. In cells transfected with control siRNA, the vast majority of Dd/
2m molecules colocalized with mSec31-containing structures, whereas in Bap29/31-deficient cells, the overlap between the two molecules was reduced. The inset and x100 magnification (Fig. 5, top two rows) allow for the observation of fine structures, while the x40 magnification (Fig. 5, bottom two rows) shows a larger number of cells all exhibiting a similar staining pattern. A graphic representation of the colocalization levels is shown on the bottom right panel (Fig. 5) for each cell type and magnification. Each dot on this graph represents a pixel in the red- (Dd) and green-stained (mSec31) panels. If colocalization is observed, the dot is placed on the diagonal of the graph, and if a signal at a certain location is detected in only one of the two staining conditions, the dot is placed outside of the diagonal. This analysis shows that colocalization between Dd/
2m and mSec31 is reduced in the absence of Bap29/31, suggesting that a number of Dd H chain/
2m dimers are excluded from ER exit sites under these conditions. These results imply that Bap29/31 are important for an optimal targeting of MHC class I to ER exit sites and subsequent packaging into COPII-coated vesicles.
|
| Discussion |
|---|
|
|
|---|
Bap31 had previously been shown to bind H-2Ld and H-2Kb (16) but we extended this observation to two more class I molecules, namely, H-2Dd (Fig. 1) and H-2Db (Fig. 3), suggesting that Bap31 is a common class I-binding molecule. The kinetics of this interaction, investigated by pulse-chase and sequential IP, indicate that Bap31 binds to class I very early on during its biogenesis, at the time of H chain-
2m association, and is released at a time corresponding to class I exit from the ER and entry into the Golgi apparatus (Fig. 1B). In view of the putative role of Bap31 as a cargo receptor for class I, it is possible that Bap31 is already recruiting class I molecules for export during their time in the peptide-loading complex. This observation is substantiated by results from Fig. 2 showing that Bap31 is associated with several members of the peptide-loading complex. The kinetics of association between Bap31 and class I molecules (Fig. 1) showing a strong binding after 1530 min of chase time also supports this hypothesis. This early binding could conceivably facilitate the rapid relocalization of class I molecules to ER exit sites upon their release from the peptide-loading complex. This view is consistent with the findings by Pentcheva et al. (15) that class I molecules undergo clustering upon their release from TAP, whereas tapasin and TAP appear to be excluded from ER exit sites.
Interestingly, the same group found that HLA-A2 mutant T134K, which does not bind tapasin/TAP, still clusters in the ER, but apparently at locations different from the WT HLA-A2 molecule. In our study of a similar mutant, we found that the H-2Dd N127A/E128A, which does not bind tapasin or TAP, is still capable of binding Bap31 (Fig. 3). Although we did not demonstrate clustering of mutant N127A/E128A, we would expect it, and suggest that the differential clustering observed between TAP-binding and nonbinding class I molecules is the result of their distinct ER localization at the time of binding to Bap31, rather than an unequal interaction with the putative cargo receptor Bap31.
We observed binding between Bap31 and several members of the peptide-loading complex, namely class I, tapasin, TAP, and CNX (Fig. 2A). The absence of CRT binding, although surprising, has previously been reported under similar experimental conditions (34). These authors were also unable to detect the presence of ERp57 in Bap31 immunoprecipitates. The undetectable binding between these two soluble ER proteins and Bap31 support the current model that Bap31 binds other proteins via its transmembrane domains (35). It is thus unlikely that Bap31 is recruited to the peptide-loading complex by CRT or ERp57, but rather that within that complex, Bap31 binds primarily to other transmembrane proteins.
Using component negative cells, we established that Bap31 does not bind directly to TAP but rather associates independently with either class I molecules or tapasin (Fig. 3). These interactions could be direct, but in the absence of CNX-negative mouse cells, we cannot exclude the possibility that the tapasin/Bap31 and class I/Bap31 interactions may be mediated by CNX. As for the significance of the tapasin/Bap31 interaction, it is possible that Bap31 functions as a cargo receptor for tapasin, which has been found (36), although not consistently (37), in the Golgi. However, another suitable possibility would be that Bap31 is part of the preloading complex reportedly composed of TAP, tapasin, CNX, and ERp57 (38). A third possibility is that Bap31 associates with both class I molecules and tapasin in the complete peptide-loading complex. In this case, two Bap31 molecules might be present in the peptide-loading complex, one bound to tapasin and one bound to class I. A single Bap31 molecule could also bind both tapasin and class I at the same time. Indeed, Bap31 is composed of three transmembrane domains that have been shown to be used in the binding to other proteins (35).
Our investigation of Bap29/31 DKO cells and Bap29/31 RNA interference-treated cells strongly suggest that these molecules are, in fact, escorting class I from ER to Golgi. In the absence of Bap29/31, we observed a delay in the acquisition of Endo Hr glycans, likely due to late entry into the medial Golgi (Fig. 4). This phenotype was observed for H-2Dd and H-2Kb, which both bind Bap31, thus connecting physical association with functional relevance. However, we found that some class I molecules are still being exported from the ER, but this is not inconsistent with a model of cargo receptor-mediated transport. Although the primary mechanism of incorporation of MHC class I into COPII vesicles might be receptor mediated, some random "bulk flow" incorporation is still expected. Moreover, Bap29/31 appear to be required for efficient targeting of MHC class I molecules to ER exit sites, which represent areas within the ER where COPII coat proteins such as mSec31 assemble for budding. The significantly reduced but detectable colocalization between class I and mSec31 in the absence of Bap29/31 indicate that these molecules facilitate the recruitment of class I to exit sites but are not absolutely required for this process. This continued slow transport is the likely reason why we did not observe any reduction in the steady-state surface levels of peptide-loaded, stable, class I molecules upon removal of Bap29/31 (Fig. 2).
At this point, it is unknown whether Bap29/31 associate directly with components of the COPII coat or whether they require an intermediate. However, our kinetic data suggest that Bap29/31 could be incorporated in trafficking vesicles together with class I. Although the results presented in this study do not allow us to identify the precise time of dissociation between class I and Bap31, it clearly occurs in conjunction with departure from the ER and arrival in the Golgi. Because Bap31 is known to partially reside in trafficking vesicles (18), we favor a model in which both molecules are packaged together into vesicles and dissociate at the time of entry in the Golgi.
It is unclear whether functional cargo receptors consist of homodimers of Bap29/29 and Bap31/31 or a heterodimer of Bap29/31. However, our observation that trafficking of class I is impaired to the same extent when Bap31 alone is deleted compared with deletion of both Bap29 and Bap31 suggest that the functional receptor is either Bap29/31 or a Bap31 homodimer. Homo- or heterodimerization appear to be a characteristic of most cargo receptors and Bap29 has previously been shown to enhance the quality control function of Bap31 (21). This indicates that the two proteins can function together physiologically, but whether it is the case for the transport of MHC class I remains to be determined.
Collectively, our results allow us to suggest a model by which Bap31, and perhaps Bap29, are recruited to the peptide-loading complex in which they interact directly with MHC class I and possibly with tapasin. This association clearly promotes the targeting and possibly the clustering of class I at ER exit sites. At the time of packaging into COPII vesicles in the ER or upon arrival at the Golgi, stably assembled class I molecules are released from Bap31 whereas empty class I or class I loaded with suboptimal peptides could be retrotranslocated to the ER. Although not investigated in this study, such a retrotranslocation mechanism could involve tapasin, as previously suggested by Paulsson et al. (36). The regulation of cargo release from the receptor is largely undefined but changes in luminal pH, Ca2+ concentration, or membrane composition are possible contributing factors. A receptor-mediated transport mechanism allows for the possibility of up-regulation during periods of high class I demand at the cell surface as well as a means to optimize peptide cargo through multiple cycles of ER to Golgi traffic. These are important issues for future investigation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David B. Williams, Department of Biochemistry, Medical Sciences Building, University of Toronto, Toronto, Ontario M5S 1A8, Canada. E-mail address: david.williams{at}utoronto.ca ![]()
3 Abbreviations used in this paper:
2m,
2-microglobulin; Bap, B cell-associated protein; CFTR, cystic fibrosis transmembrane conductance regulator; CNX, calnexin; COPII, coat protein complex II; CRT, calreticulin; DKO, double knockout; Endo H, endo-
-N-acetylglucosaminidase H; Endo Hr, Endo H resistant; Endo Hs, Endo H sensitive; ER, endoplasmic reticulum; ES, embryonic stem; IP, immunoprecipitation; Met, methionine; siRNA, small interfering RNA; TAP, transporter associated with Ag processing; WT, wild type. ![]()
Received for publication February 3, 2004. Accepted for publication April 7, 2004.
| References |
|---|
|
|
|---|
2-microglobulin. J. Biol. Chem. 270:19638.
2-microglobulin is not required for cell surface expression of the murine class I histocompatibility antigen H-2Db or of a truncated H-2Db. Proc. Natl. Acad. Sci. USA 83:7447.
3 domain. J. Immunol. 162:1530.Related articles in The JI:
This article has been cited by other articles:
![]() |
J. A. Regan and L. A. Laimins Bap31 Is a Novel Target of the Human Papillomavirus E5 Protein J. Virol., October 15, 2008; 82(20): 10042 - 10051. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tuli, M. Sharma, M. M. McIlhaney, J. E. Talmadge, N. Naslavsky, S. Caplan, and J. C. Solheim Amyloid Precursor-Like Protein 2 Increases the Endocytosis, Instability, and Turnover of the H2-Kd MHC Class I Molecule J. Immunol., August 1, 2008; 181(3): 1978 - 1987. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wakana, S. Takai, K.-i. Nakajima, K. Tani, A. Yamamoto, P. Watson, D. J. Stephens, H.-P. Hauri, and M. Tagaya Bap31 Is an Itinerant Protein That Moves between the Peripheral Endoplasmic Reticulum (ER) and a Juxtanuclear Compartment Related to ER-associated Degradation Mol. Biol. Cell, May 1, 2008; 19(5): 1825 - 1836. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Everett and M. Edidin Tapasin Increases Efficiency of MHC I Assembly in the Endoplasmic Reticulum but Does Not Affect MHC I Stability at the Cell Surface J. Immunol., December 1, 2007; 179(11): 7646 - 7652. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Ladasky, S. Boyle, M. Seth, H. Li, T. Pentcheva, F. Abe, S. J. Steinberg, and M. Edidin Bap31 Enhances the Endoplasmic Reticulum Export and Quality Control of Human Class I MHC Molecules J. Immunol., November 1, 2006; 177(9): 6172 - 6181. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Paulsson, M. Jevon, J. W. Wang, S. Li, and P. Wang The double lysine motif of tapasin is a retrieval signal for retention of unstable MHC class I molecules in the endoplasmic reticulum. J. Immunol., June 15, 2006; 176(12): 7482 - 7488. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Boyle, A. K. Gillingham, S. Munro, and J. Trowsdale Selective Export of HLA-F by Its Cytoplasmic Tail. J. Immunol., June 1, 2006; 176(11): 6464 - 6472. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, E. Baig, and D. B. Williams Functions of ERp57 in the Folding and Assembly of Major Histocompatibility Complex Class I Molecules J. Biol. Chem., May 26, 2006; 281(21): 14622 - 14631. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Szczesna-Skorupa and B. Kemper BAP31 Is Involved in the Retention of Cytochrome P450 2C2 in the Endoplasmic Reticulum J. Biol. Chem., February 17, 2006; 281(7): 4142 - 4148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stojanovic, M. Germain, M. Nguyen, and G. C. Shore BAP31 and Its Caspase Cleavage Product Regulate Cell Surface Expression of Tetraspanins and Integrin-mediated Cell Survival J. Biol. Chem., August 26, 2005; 280(34): 30018 - 30024. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zen, M. Utech, Y. Liu, I. Soto, A. Nusrat, and C. A. Parkos Association of BAP31 with CD11b/CD18: POTENTIAL ROLE IN INTRACELLULAR TRAFFICKING OF CD11b/CD18 IN NEUTROPHILS J. Biol. Chem., October 22, 2004; 279(43): 44924 - 44930. [Abstract] [Full Text] [PDF] |
||||
| |||||||