| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institut National de la Santé et de la Recherche Médicale, Unité 437, and Institut de Transplantation et de Recherche en Transplantation, Nantes, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1
, or IL-10 using these stimulation conditions. Correlating with their strong responsiveness to virus and CpG ODN, rat pDC specifically expressed Toll-like receptor 7 and 9 mRNA. Fresh spleen pDC were poor stimulators of allogenic CD4+ and CD8+ T cells, but became potent inducers of allogenic T cell proliferation as well as Th1 differentiation after stimulation by type B CpG. Therefore, rat pDC appear very similar to human pDC, indicating that the specific phenotype and functions of pDC have been highly conserved between species. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmacytoid DC were first described in humans and more recently in mice (11, 12, 13). In both species, pDC appear to be the main producers of type I IFN and to be able to secrete bioactive IL-12 (14). Human and mouse pDC present some degree of phenotypic similarity. Indeed, they express CD4 and relatively high levels of MHC class II molecules, but they lack surface expression of the T cell-related Ags CD3 and TCR; the B cell-related Ags CD19, CD20, and surface Abs; as well as the myeloid-related Ags CD14 and CD11b (15). However, some differences have been observed. Human pDC, but not their mouse counterparts (12, 13), exhibit a high expression of CD123 (4) and an absence of CD11c and CD8. Plasmacytoid DC differ from classical myeloid DC in a restricted pattern of expression of Toll-like receptors (TLR). Blood human pDC (16) as well murine spleen pDC (17) were shown to express high levels of TLR7 and TLR9 mRNA and low levels of TLR1 and TLR6. In contrast to myeloid DC, TLR2 and TLR4 were almost undetectable in human pDC, but were expressed at low levels in mouse pDC. This restricted pattern of TLR expression on pDC is thought to be responsible for their specific responsiveness to virus and bacterial DNA (18, 19). As for myeloid DC, pDC exhibited an intrinsic functional plasticity, and the nature of T cell response they induced strongly depended on their stage of maturation, the nature of the stimulatory signal, and the Ag dose (20). Beyond their important role in innate responses to pathogens such as viruses, a role for pDC and type I IFN has recently been proposed in the pathogenesis of lupus (21), a non-organ-specific autoimmune disease characterized by the presence of high titers of autoantibodies.
Rats are widely used to study immune responses to pathogens, tumors, self-Ags, or allografts; however, their DC have not been as well characterized as in mice. Interestingly, the rat immune system exhibits striking analogies with that of humans, for instance, the expression of MHC class II by activated T cells (22, 23), that could make the rat model more relevant than the mouse model for some specific immunological studies. We and others have described the existence of different DC subsets in rats (24, 25). For instance, spleen DC expressing the rat DC-specific integrin CD103 recognized by the OX62 mAb (26) can be separated in CD4+/signal regulatory protein + (SIRP+)/CD5+ and CD4–/SIRP–/CD5– subsets (25). We recently showed that CD4– DC were the main producers of IL-12p70 in vitro and induced strong Th1 responses (25). In contrast, CD4+ DC did not produce bioactive IL-12, but promoted Th1/Th0 responses. CD4– DC are also endowed with two specialized functions. Firstly, McPherson’s group (27) showed that CD4–/SIRP– DC were able to capture apoptotic cells in peripheral tissues such as the gut and to transport these cell fragments to draining lymph nodes. Secondly, we found that splenic as well as lymph node CD4–/SIRP– DC exhibited a potent antitumoral direct cytotoxic activity in vitro (28). Our previous work suggested that none of the described subsets of rat DC corresponds to pDC (25). In this study we have characterized a new subset of immune cells in the rat that exhibit phenotypic and functional features of pDC.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Sprague-Dawley and Lewis rats were obtained from Centre d’Elevage Janvier (Le Genest Saint-Isles, France) and were used at 6–10 wk of age.
Reagents
The murine CD40 ligand (CD40L)-human CD8 fusion molecule (supernatant of Sf9 insect cells transfected using a recombinant baculovirus) was provided by Prof. Y. Choi (University of Pennsylvania School of Medicine, Philadelphia, PA). Polyinosinic-polycytidylic acid (poly I:C), LPS, monensin, and brefeldin A were obtained from Sigma-Aldrich (St. Louis, MO). Recombinant rat IL-3 was purchased from PeproTech (Rocky Hill, NJ), and Staphylococcus aureus Cowan I (SAC)4 strain Pansorbin cells were purchased from Calbiochem (San Diego, CA). The phosphodiester oligonucleotide containing the CpG motif (CpG ODN) 1668 (TCCATGACGTTCCTGATGCT) and the mixed phosphodiester/phosphorothioate ODN 2216 (ggGGGACGATCGTCgggggG) were synthesized by Sigma-Genosys (Saint Quentin Fallavier, France).
Antibodies
The mAbs used in cytofluorometric studies are indicated in Table I. A number of hybridomas were obtained from European Collection of Cell Culture (Salisbury, U.K.), and mAbs were purified from supernatants in our laboratory, followed by coupling to FITC or biotin (Bioatlantic, Nantes, France). Alternatively, mAbs were obtained from BD PharMingen (San Diego, CA), Serotec (Oxford, U.K.), or BioSource International (Nivelles, Belgium; see Table I for details). The FITC anti-rat IFN-
mAb (clone DB-1) was provided by Dr. A. Saoudi (Institut National de la Santé et de la Recherche Médicale, Unité 563, Toulouse, France).
|
Cells were stained as previously described (25) and were analyzed using a FACSCalibur cytofluorometer (BD Biosciences, Mountain View, CA).
Cells and cell sorting
Plasmacytoid DC and other DC.
Lymphoid organs were minced and digested in 2 mg/ml collagenase D (Roche, Meylan, France) in RPMI 1640/1% FCS for 15 min at 37°C. EDTA (10 mM) was added for the last 5 min, and the cell suspension was then pipetted up and down several times and filtered. Cells were washed once in PBS/2 mM EDTA/1% FCS, and mononuclear cells were isolated by centrifugation over Ficoll-Hypaque (Amersham, Les Ulis, France). T and partial B cell depletion was then performed by incubating cells with the anti-TCR and 
mAbs R7.3 and V65, respectively, followed by a mixture of anti-mouse and anti-rat IgG-coated magnetic beads (Dynal Biotech, Oslo, Norway). T cell depletion was systematically assessed by CD3 staining, and efficacy was routinely 
97%. Cells were then stained with CD11b-FITC (clone WT5) and CD4-PE (clone OX35) mAbs, and CD11b–/CD4+ and CD11b+/CD4+ cells were sorted using a FACSVantage (BD Biosciences) or a FACS Aria (BD Biosciences). Purity was >98%. Alternatively, highly enriched populations of pDC were obtained by MACS bead selection. In this case an mAb against CD11b/c (clone OX42) was added to the mixture of mAbs used for depletion to eliminate monocyte/macrophages and CD11b+ DC. CD4+ cells were then purified by positive selection using OX35-conjugated MACS microbeads according to the manufacturer’s instructions with a MiniMACS magnet or AUTOMACS instrument (Miltenyi Biotec, Paris, France). Purity was routinely 85%, as assessed by quantification of CD4+/CD11b–/CD45R+ cells.
Classical OX62+/CD11b+/CD4+ and OX62+/CD11b+/CD4– subsets of spleen DC were isolated as previously described (25). Briefly, after digestion in collagenase, low density spleen cells were selected on a 14.5% Nycodenz (Nycomed, Oslo, Norway) gradient. OX62+ cells were then selected using OX62-MACS microbeads (Miltenyi Biotec) and stained with MHC class II-FITC (clone OX6) and CD4-PE (clone OX35) mAbs, and MHC class II +/CD4+ and MHC class II+/CD4– cells were sorted using a FACSVantage or a FACS Aria.
T cells.
lymph node T cells were prepared using nylon wool columns. CD4+ and CD8+ T cells were then obtained by negative selection of MHC class II+ (clone OX6) and CD4+ (clone W3/25) or CD8+ (clone OX8) cells, respectively, with specific mAbs, followed by anti-mouse IgG-coated magnetic beads (Dynal Biotech). Purity was routinely 98 and 90% for CD4+ and CD8+ T cells, respectively.
Blood monocytes. PBMC were cultured for 90 min at 3 x 106/ml in petri culture dishes in RPMI 1640 (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 1 mM HEPES, 5 x 10–5 M 2-ME, and 10% FCS (referred as to complete RPMI). Nonadherent cells were removed by extensive washing with prewarmed medium. Adherent monocytes were then directly lysed in TRIzol solution for mRNA extraction.
Mixed leukocyte reaction
Increasing numbers of allogeneic pDC or other DC were cultured with 1 x 105 purified CD4+ or CD8+ T cells in round-bottom, 96-well plates in a final volume of 200 µl of complete RPMI. After 4 days at 37°C in 5% CO2, cultures were pulsed for the last 8 h with 0.5 µCi of [3H]TdR (Amersham). The cells were then harvested onto glass-fiber filters, and [3H]TdR incorporation was measured using standard scintillation procedures (Packard Institute, Meriden, CT).
Cytokine production
Stimulation of spleen cells and isolated DC subsets for cytokine production.
Total spleen cells were cultured in the presence or the absence of influenza virus at 1 x 106/ml. Sorted splenic OX62+CD4+, OX62+CD4–, and pDC were stimulated at 1 x 105/ml (2 x 104 cells in 200 µl) in complete RPMI in 96-well plates. After 24 h, supernatants were collected and stored at –20°C until analysis. Stimuli were used at the following concentrations: soluble CD40L, 1/300 dilution of the supernatant; LPS, 0.5 µg/ml; polyI:C, 50 µg/ml; SAC, 20 µg/ml; CpG ODN1668 and ODN2216, 50 µg/ml; IL-3, 33 ng/ml; and formaldehyde-inactivated human influenza virus (strain A/New Caledonia/20/99/NOI:75; provided by Dr. F. Brière, Schering-Plough, Dardilly, France). For cytokine production, including type I IFN, the results are expressed as the amount of cytokine for 1 x 105 cells/ml. For PCR analyses, cells were stimulated under the same conditions for 5 h.
T cell cytokine production. A total of 2 x 104 allogeneic sorted pDC were cultured with 1 x 105 purified CD4+ or CD8+ T cells in a final volume of 200 µl of complete RPMI in round-bottom, 96-well plates. After 5 days of stimulation, cells were washed, and viable T cells were immediately restimulated in an anti-CD3 (5 µg/ml)-coated plate in the presence of anti-CD28 mAbs (2.5 µg/ml) at a concentration of 1 x 106 cells/ml for 7 h. Monensin (2 µg/ml) and brefeldin A (5 µg/ml) were added for the last 4 h of stimulation.
IFN- bioassay.
C6 cells (a rat glioma tumor cell line; 1 x 105) were cultured overnight in 100 µl of DMEM (Sigma-Aldrich) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in flat-bottom, 96-well plates in the presence or the absence of rat IFN- reference standard (R&D Systems, Minneapolis, MN) or supernatants. The supernatants were then removed, and the cells were infected with vesicular stomatitis virus (provided by Dr. A. Rufffault, Centre Hospitalier Régional Universitaire Pontchaillou, Rennes, France) in a final volume of 100 µl of complete DMEM for 18 h at 37°C. The wells were then washed with 100 µl of Earle’s balanced salts (Sigma-Aldrich) and incubated with 100 µl of 5% formalin for 10 min at room temperature, followed by 100 µl of Crystal Violet solution. Plates were examined visually and reciprocal titers of IFN- (expressed as units per milliliter) were deduced by comparison with the reference standard.
ELISA test.
The levels of IL-10 and TNF- in the supernatants were measured using ELISA kits (OptEIA set; BD PharMingen) according to the manufacturer’s instructions. Rat IL-12p40 and IL-12p70 were detected using ELISA kits from BioSource International according to the manufacturer’s instructions, and IL-1 and IL-6 were detected using ELISA kits from R&D Systems.
Intracellular cytokine staining.
T cells were fixed in 2% paraformaldehyde and incubated with PBS/0.2% FCS/0.5% saponin for 10 min. After two washes in PBS/0.2% FCS/0.1% saponin, cells were incubated with isotype controls or cytokine-specific mAbs (IFN--FITC, IL-13-PE, and IL-10-PE) at 5 µg/ml for 30 min. After two washes with PBS/0.2% FCS/0.1% saponin and one wash with PBS/2% FCS/0.2% azide, cells were fixed with 2% paraformaldehyde. Cells were then analyzed using a FACSCalibur cytofluorometer (BD Biosciences).
Quantitative RT-PCR
The oligonucleotide sequences used in this study are given in Table II. For IFN-, oligonucleotides were designed to amplify all IFN- species.
|
For TLR and hypoxanthine phosphoribosyltransferase (HPRT) genes, the target sequence was amplified by PCR from a spleen cDNA library, then electrophoresed and purified by phenol-chloroform extraction and ethanol precipitation. Subsequent dilutions of this standard DNA were performed to obtain 107, 106, 105, 104, 103, and 102 copies/well.
Real-time quantitative PCR
Total RNA from 3 x 105 to 2 x 106 resting or stimulated spleen cells, OX62+CD4–, OX62+CD4+, pDC, and blood monocytes were prepared by TRIzol extraction (Invitrogen, Cergy Ponbía, France). Genomic DNA was removed by DNase treatment (Roche, Indianapolis, IN), and RNAs was reverse transcribed as previously described (25). Real-time quantitative PCR was performed using an GenAmp 7700 Sequence Detection System with SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, CA). Total cDNA was amplified in 25 µl of PCR mix containing 300 nM of each primer; 200 µM dATP, dGTP, and dCTP; 400 µM dUTP; 3 mM MgCl2; 0.25 U of uracil-N-glycosylase; 0.625 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), and 2.5 µl of the 10x SYBR Green buffer (Applied Biosystems). The reaction started with a step of 2 min at 55°C to allow the uracil-N-glycosylase to eliminate putative PCR contaminants, followed by 10 min at 95°C to activate the AmpliTaq Gold DNA polymerase, and then 40 cycles, each consisting of 15 s at 95°C and 1 min at 60°C.
Analysis
Direct detection of PCR products was monitored by measuring the increase in fluorescence. The exact number of copies was deduced by comparison of the measured fluorescence with the standard curve. For IFN- and IFN- mRNA, relative expression (arbitrary units) was calculated with the 2–
Ct method as previously described (29).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In preliminary experiments we defined the phenotype of natural IFN-producing cells in rats by analyzing the capacity of spleen cells to produce type I IFN following viral challenge after selective depletion using different markers. According to the phenotype previously described in humans (5), we found that rat IFN-producing cells (IPC) express MHC class II and CD4, but not CD11b/c, TCR, or surface Ig (data not shown). We then searched for a cell subset with such a phenotype in spleen mononuclear cell suspensions prepared after collagenase digestion. Complete T and incomplete B cell depletions were performed using magnetic beads, and cells were analyzed by four-color flow cytometry. After gating on MHC class II-positive cells, we identified several cell populations based on the expression of CD4 and CD11b (Fig. 1A). The expressions of T (CD3), B (CD45R, His24 mAb), and DC (OX62) markers were then assessed on these different cell subsets (Fig. 1B). All cell subsets stained negatively for CD3, confirming the virtual absence of T cells in our cell suspensions. In addition to the CD4+CD11b+OX62+ (Fig. 1, gate R2) and CD4–CD11b+OX62+ (Fig. 1, gate R3) subsets of cells that corresponded to the CD4+ and CD4– subset of spleen DC we previously described (25), we identified among CD3– MHC class II + spleen cells a subset of CD4+CD11b– cells that lacked expression of OX62 (Fig. 1A, gate R1). Unlike CD4+CD11b+OX62+ and CD4–CD11b+OX62+ DC, CD4+CD11b– cells expressed the B cell marker CD45R (Fig. 1B). The cells located between the R2 and R3 (CD4lowCD11b+OX62–) gates corresponded to monocytes/macrophages (data not shown) that could not be eliminated from our cell suspension because of the current lack of an exclusive marker for these cells in rats. Interestingly, CD4+CD11b–OX62– cells were slightly more abundant in spleen cell suspensions than the CD4+CD11b+OX62+ and CD4–CD11b+OX62+ subsets of DC (Fig. 1A). Although in Fig. 1 we first gated on MHC class II-positive cells to clearly identify all DC subsets and especially CD4–CD11b+OX62+ cells, this was not necessary to discriminate CD4+CD11b–OX62– and CD4+CD11b+OX62+ cells. Therefore, in all the following FACS analyses and for sorting of CD4+CD11b–OX62– cells, we did not gate on MHC class II+ cells. It should be noted that CD4+CD11b–OX62– and CD4+CD11b+OX62+cells express higher levels of CD4 than T cells and that this difference was very useful to discriminate these cells in spleen from unmanipulated animals.
|
|
, we could not assess the precise specificity of our bioassay. To determine the type of IFN produced, we performed real-time PCR measurement of IFN- mRNA in different DC subsets. As shown in Fig. 2, upon influenza virus stimulation, both IFN- (Fig. 2B) and IFN- (Fig. 2C) mRNA were strongly up-regulated in CD4+CD11b–OX62– cells, but not, or very slightly, in CD4–CD11b+OX62+ and CD4+CD11b+OX62+ DC. Moderate up-regulation of IFN- mRNA was also observed in total spleen cells.
As described below, CD4+CD11b–OX62– cells exhibited enormous IFN- mRNA induction as well as potent type I IFN production upon stimulation by the pDC-specific inducer CpG ODN 2216 (see Figs. 6 and 7). In contrast, this stimulus induced very little, if any, IFN- mRNA expression and type I IFN production in CD4+CD11b+OX62+ and CD4–CD11b+OX62+ DC, respectively (data not shown).
|
|
Phenotype of rat pDC
The phenotype of rat pDC was analyzed by three-color flow cytometry (Fig. 3) of T and B cell-depleted spleen cells as described in Fig. 1 (gate R1), but without gating on MCH class II+ cells; analyzed cells are therefore equivalent to the sorted populations used in Fig. 2. Similar to other classical CD4+CD11b+ and CD4–CD11b+ spleen DC subsets, fresh rat pDC expressed high levels of MHC class II molecules. Rat pDC strongly expressed CD5 and CD90, but weakly expressed CD2 and were negative for the T cell markers CD3, TCR, as well as CD8. More than 80% of CD4+CD3–CD11b– cells also expressed a high m.w. restricted isoform of CD45 that is found on B cells (recognized by the HIS24 mAb), but stained negatively for the OX33 mAb. Interestingly, rat pDC also expressed the CD45RC isoform (OX22 mAb). Similarly to the other spleen DC subsets we described previously (25), pDC expressed the NK marker NKR-P1A (CD161A). They did not express CD11b, CD11c, or the integrin recognized by the OX62 mAb that has been identified as CD103 (30). Among other adhesion and costimulation molecules, we found that rat pDC expressed low levels of CD44 and CD62L and low levels of CD86, but not CD80. The macrophage-specific mAbs ED1 (CD68-like), ED2 (CD163), and ED3 (sialoadhesin) did not stain CD4+CD11b– DC. Finally, >80% of CD4+CD3–CD11b– expressed CD172a (SIRP), CD200, and CD32.
|
, CD200, and MHC class II, but positively for CD25 (data not shown). This cell subset was not observed in Fig. 1 because of gating on MHC class II+ cells. The fact that type I IFN-producing cells were within the MHC class II+ cells strongly suggests that these cells are not a subset of pDC, but, rather, are a contaminating population. Fresh pDC exhibit an undifferentiated morphology and an immature phenotype, but can rapidly differentiate into mature DC-like cells upon in vitro stimulation with TLR9 ligands
Freshly extracted spleen pDC exhibited an undifferentiated morphology upon microscopic examination after Giemsa staining (Fig. 4a), but exhibited plasmacytoid morphology with an excentered nucleus and large cytoplasm upon influenza virus (Fig. 4b) or CD40 (Fig. 4c) stimulation. Spleen pDC also showed extensive dendrite formation upon overnight culture in the presence of type B CpG ODN (Fig. 4d) and, to a lesser extent, influenza virus (Fig. 4b) or CD40L (Fig. 4c). Spontaneous survival of rat pDC was extremely low, but was greatly and reproducibly enhanced by type B CpG ODN and was much less consistently enhanced by influenza virus, CD40L, polyI:C, SAC, type B CpG, and LPS (Fig. 5). IL-3 had no effect on in vitro rat spleen pDC survival.
|
|
did not induce maturation of rat spleen pDC. Cytokine production by rat pDC
Spleen pDC were FACS-sorted as described in Fig. 2 and stimulated in vitro for 24 h with various TLR ligands, soluble recombinant mouse hCD8-CD40L, or inactivated influenza virus. Cytokine production was then analyzed in the supernatant (Fig. 6). Rat pDC produced substantial amounts of type I IFN upon stimulation by influenza virus. This production was 10- and 6-fold higher when pDC were stimulated with soluble CD40L (10,000 U/ml/1 x 105 cells) or CpG ODN 2216 (6,400 U/ml) (Fig. 6, top panel), indicating that rat pDC indeed have the capacity to produce very large amounts of type I IFNs. These results were confirmed by real-time quantitative PCR measurements of IFN- mRNA (Fig. 7). IFN- mRNA expression was increased 2,000-fold by influenza or CD40L, and 10,000-fold by CpG 2216, whereas IFN- mRNA expression was increased 300 and 1,000-fold with the same samples and stimulation conditions. The discrepancies between the bioassay and the PCR data regarding stimulation by the CD40L supernatant suggest that the kinetics of expression of type I IFN mRNA and protein differed upon stimulation by influenza or CpG2216 vs the CD40L supernatant. It is possible that the surprisingly strong type I IFN-inducing capacity of our soluble CD40L supernatant might be the result of a synergism between CD40-triggering and contaminating viral determinants. The TLR9 ligand CpG ODN 1668, the TLR3 ligand polyI:C, and SAC induced moderate IFN- production, whereas LPS induced very little, if any.
CpG ODN 1668 induced strong production, and CpG 2216 as well as CD40L induced moderate production of IL-12p40 (Fig. 6, middle panel); however, we could not detect IL-12p70 under these stimulation conditions (data not shown). The levels of IL-12p40 production by pDC were always several-fold lower than those produced by classical CD11b+ DC when stimulated under the same conditions (data not shown). We found that CD40L and CpG ODN, but not influenza virus, SAC, LPS, or polyI:C, induced rat pDC to produce large amounts of IL-6 (Fig. 6, bottom panel). Finally, rat pDC did not significantly produce IL-10, IL-1, or TNF- under these stimulation conditions (data not shown).
Plasmacytoid DC selectively express TLR7 and TLR9
The previous results indicated that rat pDC strongly responded to the TLR9 ligands CpG ODN as well as to virus. In contrast, the TLR4 ligand LPS had no significant effect on pDC maturation and cytokine production, although it could, in some experiments, slightly increase in vitro pDC survival (Fig. 5). We therefore measured by real-time quantitative RT-PCR the expression of TLR1–10 mRNA in highly purified splenic pDC and compared it with the expression by monocytes prepared by adherence. As shown in Fig. 8, splenic pDC selectively expressed high levels of TLR7 and TLR9 and very low levels of TLR1, TLR6, and TLR10. In contrast, TLR2, TLR3, TLR4, TLR5, and TLR8 mRNA were almost undetectable. Blood monocytes expressed a much broader pattern of TLR mRNA, with high levels of TLR1, TLR2, TLR6, TLR7, TLR8, and TLR9 and low levels of TLR3, TLR4, and TLR5, whereas TLR10 mRNA was virtually undetectable. In control experiments we found substantial expression of all TLR mRNA in total spleen cells (data not shown).
|
To determine the Ag presentation capacity of pDC, freshly sorted splenic pDC were used as stimulator cells in allogeneic direct MLR. As shown in Fig. 9, splenic pDC induced moderate proliferation of allogeneic CD4+ T cells; however, they were 3- to 10-fold less efficient than classical fresh CD4+CD11b+OX62+ DC (data not shown), which we have previously shown to be the most potent APC among splenic OX62+ DC (25). In contrast, fresh pDC induced very low, if any, proliferation of allogeneic CD8+ T cells (Fig. 9). To assess the Ag-presenting capacity of mature pDC, we stimulated pDC overnight with type B CpG, which was shown to promote maturation as well as survival (Fig. 5). As shown in Fig. 10A, mature pDC induced potent proliferation of both allogeneic CD4+ and CD8+ T cells.
|
|
, but not IL-13 or IL-10, i.e., Th1 cells (Fig. 10B). Beside this majority of Th1 cells, pDC also induce the differentiation of a low number of T cells producing IL-10 (<2%), whereas no cells produce IL-13. CpG-stimulated pDC induced potent differentiation of IFN--producing Th cells, of which 95% had a Th1 phenotype (IFN-, no IL-13), and 5% had a Th0 phenotype (IFN- and IL-13). The production of IFN- was confirmed by ELISA (data not shown). In control experiments we found that under the same secondary stimulation conditions, naive CD4+ T cells did not express IFN-, IL-13, or IL-10 (data not shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Rat pDC could be readily separated from classical CD4+ and CD4– spleen DC subsets because they did not express CD11b or the rat DC-specific integrin CD103 recognized by the OX62 mAb (26, 30). Of note, similar to human, but not mouse, pDC (15), rat pDC did not express CD11c. Rat pDC expressed a mixture of lymphoid Ag, such as CD5 and CD90 (Thy1.1), and of myeloid Ags, such as CD172a (SIRP) and CD200. Moreover, they expressed two restricted isoforms of the CD45 molecule, CD45R and CD45RC, which are usually found on B cells (CD45R and His24 mAb) and on B and a subset of T cells (CD45RC and OX22 mAb) (32), respectively. To our knowledge, the expression of CD45RC has not been reported previously on human or mouse pDC. Interestingly, rat pDC expressed higher levels of CD4 than T cells in naive animals, and this difference together with the expression of MHC class II and the absence of CD11b proved useful in the identification of pDC in the spleen, in which they represented 
1–1.5% of mononuclear cells. Splenic pDC were as or more abundant than classical CD4+CD11b+ and CD4–CD11b– DC, respectively, and therefore represent a major subset of DC in rat spleen. Plasmacytoid DC were also identified in lymph nodes, but were very rare in the blood (data not shown). Interestingly, significant differences in pDC frequency between different mouse strains have been recently demonstrated (33).
The major feature of pDC is their capacity to produce enormous amounts of type I IFN upon viral and bacterial stimulation, and this subset of DC therefore plays an important effector function during innate immune responses (34). In our previous study we found that classical CD11b+CD4+ and CD11b+CD4– DC produced very little, if any, type I IFN upon stimulation by influenza virus (25), a finding confirmed in the current study at both mRNA and protein levels. In contrast, CD11b–CD4+ DC exhibited very strong IFN- and IFN- mRNA up-regulation and produced substantial amounts of type I IFN upon viral stimulation. It should be pointed out that a rat IFN- standard is not available, and the activity of recombinant rat IFN- used in this study is determined by comparison with a mouse standard. Therefore, the actual levels of type I IFN production by rat pDC cannot be precisely assessed. The ability of pDC to respond to virus and bacteria is thought to be related to a restricted expression of TLRs (35). Indeed, previous studies in humans have shown that blood pDC express high levels of TLR7 and TLR9 and low levels of TLR1, TLR6, and TLR10 mRNAs (16). TLR9 confers responsiveness to bacterial DNA (36), whereas natural TLR7 ligands have not yet been identified, but could conceivably confer responsiveness to viruses (37). A recent report indicates that mouse pDC expressed a broader set of TLRs than human pDC, yet they expressed high TLR7 and TLR9 and low TLR3 mRNA (17). In rat spleen pDC the restricted pattern of TLR expression we described in this study was similar to that described in human blood pDC, indicating that the role of pDC in responding to specific pathogens has been conserved between species. However, unlike in humans, rat blood monocytes were found to express high levels of TLR7 and TLR9 mRNA, indicating that TLR9 expression is not restricted to pDC and B cells in the rat. Other subtle differences between DC of different species exist, such as the expression of CD8 on a subset of mouse, but not human or rat, DC or the expression of CD11c on murine, but not human and rat, pDC.
The strong expression of TLR9 in rat pDC correlated to a high level of responsiveness to CpG ODN. Recent results indicated that CpG ODN can, in fact, be separated into two classes: CpG ODN A that induce high type I IFN in pDC, but are weak activators of B cells; and CpG ODN B that selectively activate pDC, but are weak inducers of type I IFN (38). Although the precise sequences of stimulatory CpG ODN have not been clearly identified for rat cells, our results confirm this functional dichotomy for CpG ODN. We found that CpG ODN 1668, a type B CpG used for murine cells, was by far the best maturation stimulus for pDC and induced strong production of IL-12p40 and IL-6, but moderate amounts of IFN-. In contrast, the type A CpG ODN 2216 induced pDC to produce large amounts of type I IFN, but did not promote their survival and maturation. Surprisingly, we found that soluble human CD8-mCD40L induced not only moderate IL-12p40 and high IL-6 production in pDC, but also enormous amounts of type I IFN. However, CD40L alone did not induce potent maturation of pDC. We cannot exclude the possibility that this potent effect was related to the presence of TLR ligands, such as viral products in the supernatant we used and that could synergize with CD40L in stimulating type I IFN production in pDC. Finally, it is interesting to note that despite the virtual absence of expression of TLR3, rat pDC appear to produce low levels of type I IFN upon polyI:C stimulation, suggesting TLR3-independent mechanisms for polyI:C recognition (39).
Although CpG ODN induced strong production of IL-12p40 in pDC, we were unable to detect the bioactive p70 heterodimer. According to our previous study (25), we could detect IL-12p70 in the supernatant of CpG ODN- or CD40L-stimulated CD4–CD11b+, but not CD4+CD11b+ (F. X. Hubert and R. Josien, unpublished observation). None of the three spleen DC subsets produced IL-12 in response to influenza virus. Although mouse pDC have been widely reported to secrete IL-12p70 in vitro (18, 20), this has been a controversial issue for human pDC (9). Several groups have reported that human blood pDC produce very little, if any, IL12-p70 (4, 40), whereas others have found strong IL-12p70 secretion in pDC (9). It is possible that the production of IL-12p70 by human pDC requires both TLR ligation and CD40 triggering (8). In vivo, pDC appeared to be the main source of IL-12 upon CMV, but not toxoplasma, infection in mice (41). Therefore, the contribution of each DC subset to IL-12 production appears to reflect its ability to respond to specific pathogens and thus, at least in part, its pattern of TLR expression. Our results indicate that rat spleen pDC did not produce detectable TNF- under the stimulation conditions we used in this study; however, this does not exclude that rat pDC could produce this cytokine under appropriate stimulation conditions or during viral infection in vivo. One group has reported that human pDC produced TNF- upon viral stimulation (34), but not TLR ligand stimulation (16). However, others have reported TNF- production by CpG-stimulated human pDC (7, 42). Concerning murine pDC, TNF- production has been reported for in vitro bone marrow-derived pDC as well as by pDC isolated from murine CMV-infected mice (43), but not for freshly isolated and in vitro stimulated pDC.
According to their immature phenotype, freshly isolated human and murine pDC have been shown to induce poor or no proliferation of naive T cells (13, 16, 34). These discrepancies are probably dependent on differences in purification procedures and the origin of pDC. We found that fresh rat spleen pDC induced low proliferation of allogeneic CD4+ T cells compared with classical CD11b+OX62+ DC and were even poorer stimulator of allogenic CD8+ T cells. The difference in the capacity of pDC to stimulate CD4+ and CD8+ T cells is not specific for pDC, as we previously showed similar differences for CD11b+CD4– splenic DC (25). Similar observations were reported for CD8+ spleen DC in mice (44). Although in vitro pDC can up-regulate MHC class II and costimulatory molecule expression especially upon TLR9 triggering, the in vivo relevance of this maturation, and therefore the role of pDC in initiating T cell responses, are still unclear (45). It has been suggested recently that pDC could be involved in the activation and Th1 polarization of Ag-experienced cells, but not naive T cells (45). However, similar to other DC subsets, the T cell stimulatory activity of pDC is largely dependent on the maturation/stimulatory signals that they have received as well as the Ag dose (20). The fact that human pDC have been shown to drive Th2 (4), Th1 (8, 9), as well as T regulatory cell differentiation (46) indicates a high level of intrinsic plasticity. We found that freshly isolated rat pDC induced Th1 polarization in a low number of allogeneic CD4+ T cells, and that this Th1-inducing capacity was strongly enhanced by type B CpG stimulation. Whether this Th1 polarization is IL-12 or IFN- dependent is currently under investigation, and experiments are underway to determine the T cell stimulatory activity of rat pDC after various TLR stimulations.
In conclusion, we have described a new subset of leukocytes in the rat that have the features of pDC. Importantly, these cells represent the main subset of DC in the spleen and differed from the classical subsets of splenic DC in the lack of expression of OX62 and CD11b. Rat pDC appear to be more similar to human pDC than are mouse pDC regarding their phenotype, function, and restricted pattern of TLR expression. These data will be useful for the study of pDC function in rat models of infectious diseases, tumors, organ transplantation, or autoimmunity.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 C.V. and C.L. contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Régis Josien, Institut National de la Santé et de la Recherche Médicale, Unité 437, 30 boulevard Jean Monnet, 44093 Nantes Cedex 1, France. E-mail address: rjosien{at}nantes.inserm.fr
4 Abbreviations used in this paper: DC: dendritic cell; CD40L, CD40 ligand; CpG ODN, oligonucleotides containing certain CpG motifs; HPRT, hypoxanthine phosphoribosyltransferase; pDC, plasmacytoid DC; poly I:C, polyinosinic-polycytidylic acid; SAC, Staphylococcus aureus Cowan I; SIRP, signal regulatory protein; TLR, Toll-like receptor; IPC, IFN-producing cells.
Received for publication May 1, 2003. Accepted for publication April 12, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
producing cells: the plasmacytoid dendritic cells. BioTechniques 33:S16.
-producing cells (plasmacytoid dendritic cells) in the pathogenesis of lupus. J. Exp. Med. 194:F59.
B interaction in acute allograft rejection and CD40L-independent chronic allograft rejection. J. Immunol. 172:1619.E1 and E2 subunits: tissue expression reveals phenotypic similarities between intraepithelial lymphocytes and dendritic cells in lymph. Eur. J. Immunol. 27:3070. [published erratum appears in 1998 Eur. J. Immunol. 28:3891]. [Medline]
/-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219. and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507./ and interleukin 12 responses to viral infections: pathways regulating dendritic cell cytokine expression in vivo. J. Exp. Med. 195:517./. J. Exp. Med. 197:885.This article has been cited by other articles:
|
|
 |
|
  A. Kiely, A. Robinson, N. H McClenaghan, P. R Flatt, and P. Newsholme Toll-like receptor agonist induced changes in clonal rat BRIN-BD11 {beta}-cell insulin secretion and signal transduction J. Endocrinol., September 1, 2009; 202(3): 365 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Chauvin, J.-M. Philippeau, C. Hemont, F.-X. Hubert, Y. Wittrant, F. Lamoureux, B. Trinite, D. Heymann, F. Redini, and R. Josien Killer Dendritic Cells Link Innate and Adaptive Immunity against Established Osteosarcoma in Rats Cancer Res., November 15, 2008; 68(22): 9433 - 9440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Naito, T. Anzai, Y. Sugano, Y. Maekawa, T. Kohno, T. Yoshikawa, K. Matsuno, and S. Ogawa Differential Effects of GM-CSF and G-CSF on Infiltration of Dendritic Cells during Early Left Ventricular Remodeling after Myocardial Infarction J. Immunol., October 15, 2008; 181(8): 5691 - 5701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Veelken, E.-M. Vogel, K. Hilgers, K. Amann, A. Hartner, G. Sass, W. Neuhuber, and G. Tiegs Autonomic Renal Denervation Ameliorates Experimental Glomerulonephritis J. Am. Soc. Nephrol., July 1, 2008; 19(7): 1371 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ouabed, F.-X. Hubert, D. Chabannes, L. Gautreau, M. Heslan, and R. Josien Differential Control of T Regulatory Cell Proliferation and Suppressive Activity by Mature Plasmacytoid versus Conventional Spleen Dendritic Cells J. Immunol., May 1, 2008; 180(9): 5862 - 5870. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pascale, V. Contreras, M. Bonneau, A. Courbet, S. Chilmonczyk, C. Bevilacqua, M. Eparaud, V. Niborski, S. Riffault, A.-M. Balazuc, et al. Plasmacytoid Dendritic Cells Migrate in Afferent Skin Lymph J. Immunol., May 1, 2008; 180(9): 5963 - 5972. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Forsbach, J.-G. Nemorin, C. Montino, C. Muller, U. Samulowitz, A. P. Vicari, M. Jurk, G. K. Mutwiri, A. M. Krieg, G. B. Lipford, et al. Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses J. Immunol., March 15, 2008; 180(6): 3729 - 3738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cassone, F. De Bernardis, and G. Santoni Anticandidal Immunity and Vaginitis: Novel Opportunities for Immune Intervention Infect. Immun., October 1, 2007; 75(10): 4675 - 4686. [Full Text] [PDF]
|
|
|
|
 |
|
 E. Chiffoleau, J.-M. Heslan, M. Heslan, C. Louvet, T. Condamine, and M.-C. Cuturi TLR9 ligand enhances proliferation of rat CD4+ T cell and modulates suppressive activity mediated by CD4+ CD25+ T cell Int. Immunol., February 1, 2007; 19(2): 193 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Zipris, E. Lien, A. Nair, J. X. Xie, D. L. Greiner, J. P. Mordes, and A. A. Rossini TLR9-Signaling Pathways Are Involved in Kilham Rat Virus-Induced Autoimmune Diabetes in the Biobreeding Diabetes-Resistant Rat J. Immunol., January 15, 2007; 178(2): 693 - 701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Yrlid, V. Cerovic, S. Milling, C. D. Jenkins, J. Zhang, P. R. Crocker, L. S. Klavinskis, and G. G. MacPherson Plasmacytoid Dendritic Cells Do Not Migrate in Intestinal or Hepatic Lymph J. Immunol., November 1, 2006; 177(9): 6115 - 6121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. K. Affolter and P. F. Moore Feline progressive histiocytosis. Vet. Pathol., September 1, 2006; 43(5): 646 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-X. Hubert, C. Voisine, C. Louvet, J.-M. Heslan, A. Ouabed, M. Heslan, and R. Josien Differential Pattern Recognition Receptor Expression but Stereotyped Responsiveness in Rat Spleen Dendritic Cell Subsets J. Immunol., July 15, 2006; 177(2): 1007 - 1016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. De Bernardis, R. Lucciarini, M. Boccanera, C. Amantini, S. Arancia, S. Morrone, M. Mosca, A. Cassone, and G. Santoni Phenotypic and Functional Characterization of Vaginal Dendritic Cells in a Rat Model of Candida albicans Vaginitis Infect. Immun., July 1, 2006; 74(7): 4282 - 4294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Yrlid, S. W. F. Milling, J. L. Miller, S. Cartland, C. D. Jenkins, and G. G. MacPherson Regulation of Intestinal Dendritic Cell Migration and Activation by Plasmacytoid Dendritic Cells, TNF-{alpha} and Type 1 IFNs after Feeding a TLR7/8 Ligand J. Immunol., May 1, 2006; 176(9): 5205 - 5212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Han, S. Wang, Y. Fan, J. Yang, L. Jiao, H. Qiu, and X. Yang Chlamydia Infection Induces ICOS Ligand-Expressing and IL-10-Producing Dendritic Cells That Can Inhibit Airway Inflammation and Mucus Overproduction Elicited by Allergen Challenge in BALB/c Mice J. Immunol., May 1, 2006; 176(9): 5232 - 5239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Degauque, D. Lair, A. Dupont, A. Moreau, G. Roussey, F. Moizant, F. X. Hubert, C. Louvet, M. Hill, F. Haspot, et al. Dominant Tolerance to Kidney Allografts Induced by Anti-Donor MHC Class II Antibodies: Cooperation between T and Non-T CD103+ Cells J. Immunol., April 1, 2006; 176(7): 3915 - 3922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Hatterer, N. Davoust, M. Didier-Bazes, C. Vuaillat, C. Malcus, M.-F. Belin, and S. Nataf How to drain without lymphatics? Dendritic cells migrate from the cerebrospinal fluid to the B-cell follicles of cervical lymph nodes Blood, January 15, 2006; 107(2): 806 - 812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Chauveau, S. Remy, P. J. Royer, M. Hill, S. Tanguy-Royer, F.-X. Hubert, L. Tesson, R. Brion, G. Beriou, M. Gregoire, et al. Heme oxygenase-1 expression inhibits dendritic cell maturation and proinflammatory function but conserves IL-10 expression Blood, September 1, 2005; 106(5): 1694 - 1702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Trinite, C. Chauvin, H. Peche, C. Voisine, M. Heslan, and R. Josien Immature CD4-CD103+ Rat Dendritic Cells Induce Rapid Caspase-Independent Apoptosis-Like Cell Death in Various Tumor and Nontumor Cells and Phagocytose Their Victims J. Immunol., August 15, 2005; 175(4): 2408 - 2417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Miyahara, K. Takeda, S. Miyahara, S. Matsubara, T. Koya, A. Joetham, E. Krishnan, A. Dakhama, B. Haribabu, and E. W. Gelfand Requirement for Leukotriene B4 Receptor 1 in Allergen-induced Airway Hyperresponsiveness Am. J. Respir. Crit. Care Med., July 15, 2005; 172(2): 161 - 167. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Galibert, G. S. Diemer, Z. Liu, R. S. Johnson, J. L. Smith, T. Walzer, M. R. Comeau, C. T. Rauch, M. F. Wolfson, R. A. Sorensen, et al. Nectin-like Protein 2 Defines a Subset of T-cell Zone Dendritic Cells and Is a Ligand for Class-I-restricted T-cell-associated Molecule J. Biol. Chem., June 10, 2005; 280(23): 21955 - 21964. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Hasan, C. Chaffois, C. Gaillard, V. Saulnier, E. Merck, S. Tancredi, C. Guiet, F. Briere, J. Vlach, S. Lebecque, et al. Human TLR10 Is a Functional Receptor, Expressed by B Cells and Plasmacytoid Dendritic Cells, Which Activates Gene Transcription through MyD88 J. Immunol., March 1, 2005; 174(5): 2942 - 2950. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and peripheral blood adherent monocytes (
) by real-time quantitative PCR. The results are expressed as a ratio of TLR to HPRT mRNA expression and represent the mean ± SD of two and three independent experiments for pDC and monocytes, respectively.
