|
|
||||||||
Institute for Systems Biology, Seattle, WA 98103
| Abstract |
|---|
|
|
|---|
promoter, perhaps because the TNF-
promoter has C/EBP and AP-1 binding sites in a similar configuration to the IL-12p40 promoter. The fact that simvastatin potently augments LPS-induced IL-12p40 and TNF-
production has implications for the treatment of bacterial infections in statin-treated patients. | Introduction |
|---|
|
|
|---|
Large-scale clinical trials have demonstrated significant reductions in cardiovascular events following statin therapy. However, the observed benefit of statin therapy is greater in these trials than would be expected from lowering lipid levels alone (2, 3). Statins are now believed to exert pleiotropic effects that include improvement of endothelial function, stabilization of atherosclerotic plaques, thrombosis control, and anti-inflammatory effects (4).
Accumulating evidence supports the assumption that statins have anti-inflammatory properties and thus may regulate important molecules in both immune and vascular biology. Pravastatin lowered the level of C-reactive protein and eliminated the higher risk of cardiovascular events associated with this inflammatory marker (5). Pravastatin or simvastatin therapy reduced the incidence of rejection and improved survival after heart transplantation (6).
Several recent observations suggest a mechanism for the anti-inflammatory effects of statins. Statins suppressed IFN-
-inducible expression of MHC class II on monocyte-derived macrophages and endothelial cells, but not constitutive expression of MHC-II in peripheral blood-derived dendritic cells (7). Statin pretreatment of monocyte-derived macrophages and endothelial cells repressed subsequent activation of allogenic T cells; this effect was due to inhibition of the inducible promoter IV of the MHC class II transactivator (7). Statins have also been shown to bind directly to the
2 integrin LFA-1, thereby blocking LFA-1-mediated adhesion and costimulation of lymphocytes (8). In addition, atorvastatin prevented and reversed chronic and relapsing paralysis in experimental autoimmune encephalomyelitis (EAE), a murine model of multiple sclerosis (9). In these studies, atorvastatin induced the secretion of Th2 cytokines, but inhibited secretion of Th1 cytokines, thereby suppressing Ag-specific T cell activation (9). This effect was thought to be due to enhanced STAT6 phosphorylation, and decreased STAT4 phosphorylation. By contrast, Aktas et al. (10) suggested that atorvastatin-induced down-regulation of cyclin-dependent kinase 4 and up-regulation of p27kip1 caused the decrease of T cell proliferation.
Contrary to these anti-inflammatory effects, lipophilic statins, including simvastatin, atorvastatin, lovastatin, and fluvastatin, have been shown to have proinflammatory effects on PBMC, endothelial cells, monocytes, or bone marrow-derived dendritic cells. Montero et al. (11) reported that fluvastatin activated caspase-1, and enhanced secretion of IL-1
, IL-18, and IFN-
from PBMC stimulated with Mycobacterium tuberculosis. Unexpectedly, simvastatin potentiated TNF-
- or IL-1
-induced expression of E-selectin, ICAM-1, and VCAM-1 in HUVECs (12). The authors also demonstrated that pertussis toxin mimicked this simvastatin effect, suggesting the participation of a Gi
protein. Recently, Sun and Fernandes (13) reported that lovastatin enhanced IL-6, IL-12, and TNF-
production in bone marrow-derived dendritic cells, and Monick et al. (14) reported that lovastatin increased TNF-
production by inhibition of Rho family GTPases in a murine macrophage cell line.
Thus, statins have both anti-inflammatory and proinflammatory effects; however, the molecular mechanisms underlying these properties are poorly understood. In this study, we define the molecular mechanism underlying the proinflammatory response to statins. We demonstrate that simvastatin pretreatment enhances LPS-induced IL-12p40 production through activation of the IL-12p40 promoter, and that C/EBP and AP-1 binding sites are essential for this effect. Furthermore, we have shown that c-Fos repression and c-Jun N-terminal kinase activation underlie this mechanism. Simvastatin also augments TNF-
expression, which is also controlled by the C/EBP and AP-1 transcription factors.
| Materials and Methods |
|---|
|
|
|---|
Simvastatin, c-Jun N-terminal kinase (JNK) inhibitor I, and negative control peptide were purchased from Calbiochem (La Jolla, CA). Simvastatin was converted to open acid form before use, as previously described (15). Briefly, 20 mg of simvastatin was suspended in 0.4 ml of ethanol, and 2.4 ml of 0.1 M NaOH was added. The solution was heated to 50°C for 2 h. To this heated solution, 3.6 ml of an aqueous solution containing 81 mM Na2HPO4 and 15 mM NaH2PO4 was added. The solution was heated to 40°C for 30 min, and the pH was adjusted to 7.3 with concentrated HCl. The carrier was used as vehicle control in the same dilution as simvastatin. Mevalonate, farnesylpyrophosphate, geranylgeranylpyrophosphate, and squalene were purchased from Sigma-Aldrich (St. Louis, MO). We used 0.7 mg/ml methanol and 3 mM NH4OH that dissolved farnesylpyrophosphate and geranylgeranylpyrophosphate as mock in Fig. 5. LPS O55:B5 was purchased from List Biological Laboratories (Campbell, CA). N-palmitoyl-S-dipalmitoylglyceryl (Pam3) Cys-Ser-(Lys)4 (CSK4) was purchased from EMC Microcollections (Tuebingen, Germany). R848 was purchased from 3M Pharmaceuticals (St. Paul, MN). Rabbit polyclonal Abs recognizing C/EBP
(14AA), C/EBP
(C-19), C/EBP
(C-22), C/EBP
(C-22), c-Jun (H-79), JunB (N-17), JunD (329), c-Fos (4), FosB (102), Fra-1 (R-20), and Fra-2 (Q-20) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-c-Jun (Ser63) and JNK Abs were purchased from Cell Signaling Technology (Beverly, MA).
|
The murine IL-12p40 promoter region was amplified by PCR from the genomic DNA of C57BL/6 mouse. Appropriate 5' primers and a common 3' primer were used to amplify varying lengths of the promoter region. The following primers were used to generate the 352, the 194, and the 127 constructs: 5' primers, 352; 5'-GGCAAGTCCTTCCTTTTTCTGCAGTCTGTGG-3', 194; 5'-TCTATATTCCCTCTGTAT-3', 127; 5'-CCCCCAGAATGTTTTGAC-3', 3' primer, +55; 5'-CTTGCTTTGCTGCGAGCTGCC-3'.
Amplified products were inserted into pCR2.1 TOPO vector (Invitrogen, Carlsbad, CA), digested with SacI/XhoI, and subcloned into pGL3 basic vector (Promega, Madison, WI). The 81 construct was generated by self ligation after excising 352 to 81 region with SpeI digestion. Mutants with 2-bp mutations in NF-
B, C/EBP, or AP-1 binding site were generated for the 352 construct by QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The mutagenic primers for NF-
B, C/EBP, and AP-1 binding sites (with altered nucleotides underlined) were 5'-CTTCTTAAAATTCGGCCAGAATGTTTTG-3', 5'-GTTTTCAGTGTTGCCCTTGAGACTAGTC-3', and 5'-GCAATTGAGACTAGTTGGTTTCTACTTTGGGTTTCCATC-3', respectively. The mouse JunB was amplified by RT-PCR from resident macrophages and cloned into the expression vector pcDNA3.1+ (Invitrogen). All constructs generated by PCR were confirmed by sequencing. The expression plasmids for the C/EBP dominant-negative protein A-C/EBP and the AP-1 dominant-negative protein A-Fos were kindly provided by C. Vinson (National Cancer Institute, Bethesda, MD) (16, 17). The expression plasmids for rat c-Jun and c-Fos (CMV-c-Jun and CMV-c-Fos) were gifts from T. Curran (St. Jude Childrens Research Hospital, Memphis, TN) (18). The expression plasmid for mouse FosB (pcDNA3.1-FosB) was a gift from S. Okada (Kumamoto University, Kumamoto, Japan) (19). The expression plasmid for rat Fra-2 (pcDNA3.1-Fra-2) was a gift from R. Baler (National Institutes of Health, Bethesda, MD) (20). pGL2-mouse TNF-
promoter was a gift from R. Ulevitch (The Scripps Research Institute, La Jolla, CA) (21). The TNF-
promoter region (1072 to +131) was excised with KpnI/HindIII and cloned into pGL3 basic vector for this study. pGL3-human endothelial leukocyte adhesion molecule (ELAM) promoter was described previously (22). Numbers described above indicate positions relative to the transcriptional start site.
Macrophage cultures and generation of stable transfectants
Resident peritoneal macrophages were harvested from specific pathogen-free female C57BL/6 mice (Charles River Breeding Laboratories, Wilmington, MA) by peritoneal lavage with 8 ml of ice-cold PBS. The cells were plated at 1 x 106 cells/ml and washed three times in PBS to remove nonadherent cells after incubation for 2 h. Resident peritoneal macrophages and RAW264.7 macrophages (ATCC TIB-71; American Type Culture Collection, Manassas, VA) were cultured in RPMI 1640 supplemented with 10% FBS (HyClone Laboratories, Logan, CT), 2 mM L-glutamine, and 1% of penicillin/streptomycin (Invitrogen) at 37°C in a humidified atmosphere of 5% CO2. The pooled stable transfectant of RAW264.7 cells expressing human ELAM promoter-firefly luciferase was described previously (23). The pooled stable transfectant of RAW264.7 cells expressing mouse IL-12p40 promoter-firefly luciferase was generated by cotransfection of the pGL3-IL-12p40352 construct and pcDNA3.1+ vector. Both stable transfectants were maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, and 400 µg/ml geneticin (Invitrogen).
Luciferase assay
RAW264.7 cells were seeded at 1.5 x 105 cells/well into 48-well plate on the day before transfection. pGL3-IL-12p40 promoter constructs and phRG-TK (Promega) were transiently transfected by Fugene6 (Roche Diagnostics, Indianapolis, IN), following the manufacturers instruction. Cells were subsequently treated with vehicle or 8 µM simvastatin for 20 h and stimulated with or without 10 ng/ml LPS for 5 h. Luciferase assays were done by dual-luciferase assay kit, according to the manufacturers instruction (Promega). The pooled stable transfectants of RAW264.7 cells, expressing either the ELAM or IL-12p40 promoter-driven firefly luciferase, were seeded at 5 x 104 cells/well into 96-well plates on the day before stimulation. Cells were subsequently treated with vehicle or 8 µM simvastatin for the indicated time periods and stimulated with or without 1 ng/ml LPS for 6 h. Luciferase assays were performed using the luciferase 1000 assay system (Promega). The protein concentration of the cell lysate was determined by the bicinchoninic acid method (Pierce, Rockford, IL) in parallel. The luciferase values were normalized to protein concentration. All assays were done in triplicate, and each experiment was repeated at least three times. The luciferase activity was calculated for each individual assay. Fold activation was calculated by dividing the luciferase values for the test conditions by the relative luciferase value for the control conditon. In all cases, values are the mean ± SD of triplicate wells and are representative of at least three separate experiments.
ELISA
The concentration of IL-12p40 and TNF-
was measured with DuoKit ELISA system (R&D Systems, Minneapolis, MN). The production of IFN-
-inducible protein-10 (IP-10) was determined with IP-10 ELISA system (Cedarlane Laboratories, Hornby, Ontario, Canada).
Real-time PCR analysis
After stimulation, total RNA was isolated with an RNeasy minikit (Qiagen, Valencia, CA). Approximately 2 µg of total RNA was treated with DNase I (Fisher Scientific, Pittsburgh, PA) and reverse transcribed using Moloney murine leukemia virus reverse transcriptase and oligo(dT) primers (Promega). Quantitative real-time PCR was performed on an ABI 7700 (Applied Biosystems, Foster City, CA) using TaqMan Universal PCR Master Mix (Applied Biosystems). All data were normalized to elongation factor-1
(EF-1
) expression in the same cDNA set. Each experiment was performed independently at least three times, and the results of one representative experiment are shown. Sequences of TaqMan probes and forward and reverse primers for TNF-
and EF-1
were described previously (24). Sequences for IL-12p40 and IP-10 are as follows: IL-12p40 probe, CTGCAGGGAACACATGCCCACTTG; forward primer, GCTCAGGATCGCTATTACAATTCC; reverse primer, TCTTCCTTAATGTCTTCCACTTTTCTT. IP-10 probe, TCACTGGCCCGTCATCGATATGGA; forward primer, GACGGTCCGCTGCAACTG; reverse primer, GCTTCCCTATGGCCCTCATT.
EMSA
The nuclear extracts were prepared, as described previously (25). The protein concentration was determined by bicinchoninic acid method (Pierce). Probes were made by annealing single-stranded oligonucleotides and labeled by filling in with [
-32P]dCTP using Klenow fragment (Promega). Five micrograms of nuclear extracts were mixed with 5 x 104 cpm probe in 20 mM HEPES (pH 7.9), 50 mM KCl, 1 mM EDTA, 0.2 mM EGTA, 5% glycerol, 1 mM DTT, and 1x protease inhibitor mixture (Roche Diagnostics) at room temperature for 30 min. Bound and free DNAs were then resolved by electrophoresis through a 5% polyacrylamide gel (0.5 x Tris-glycine-EDTA buffer) at 25 mA for 90 min. For supershift analysis, Abs were incubated with the nuclear extracts for 1 h on ice, followed by an additional incubation for 30 min with labeled probes. Binding activities were measured by PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Immunoblot analysis
Forty micrograms of nuclear extracts or 100 µg of whole cell lysates were denatured in SDS, electrophoresed on a 12% SDS-polyacrylamide gel, and transferred to polyvinylidene difluoride membrane (Immobilon-P; Millipore, Billerica, MA). Ponceau S staining was performed to ensure equivalent gel loading. Membranes were then incubated with the indicated rabbit polyclonal Abs, followed by HRP-conjugated goat anti-rabbit IgG (Zymed Laboratories, South San Francisco, CA), which were detected using WestPico chemiluminescence reagent (Pierce).
In vitro kinase assay
RAW264.7 cells (2 x 106 cells in a 35-mm dish) were washed twice with ice-cold PBS and lysed in lysis buffer (1x PBS, 0.2% IGEPAL CA630, 0.1% SDS, 0.25% sodium deoxycholate, 2 mM Na3VO4, 1x complete protease inhibitor). Lysates were passed through a 26-gauge needle five times, clarified by centrifugation, and assayed for protein content (Pierce). Five hundred micrograms of whole cell lysates were suspended in JNK lysis buffer (25 mM HEPES, pH 7.5, 0.2% IGEPAL CA630, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 1 mM DTT, 2 mM Na3VO4, 20 mM
-glycerophosphate, 10 mM p-nitrophenyl phosphate, and 1x complete protease inhibitor) and incubated with 20 µl of GST-c-Jun189 beads (Cell Signaling Technology) on a rotator for 1 h. The beads were washed and transferred to JNK assay buffer containing 10 µCi of [
-32P]ATP, and JNK activity was determined (26).
| Results |
|---|
|
|
|---|
To study the effect of simvastatin on IL-12 production by macrophages, we pretreated murine resident peritoneal macrophages with simvastatin for 20 h and stimulated them with LPS for 8 h. As shown in Fig. 1A, simvastatin primed the cells for enhanced LPS-induced IL-12p40 production, and this occurred in a dose-dependent manner. Simvastatin also augmented IL-12p40 production in response to other Toll-like receptor agonists, such as R848 and Pam3-CSK4 (Fig. 1A). The effect was not general, because LPS-induced IP-10 secretion was decreased in simvastatin-treated cells (Fig. 1B). Because mechanistic studies are not possible in primary macrophages, we decided to focus on the murine macrophage cell line RAW264.7. The primary cell data were recapitulated in the cell line, thereby validating the model (Fig. 1, C and D). We next examined whether simvastatin regulates IL-12p40 production at the mRNA level. RAW264.7 macrophages were pretreated with simvastatin for 20 h and stimulated with LPS, and the levels of IL-12p40 and IP-10 mRNA were measured by quantitative PCR. As shown in Fig. 1E, during the early time points (26 h), simvastatin pretreatment enhanced LPS-induced IL-12p40 mRNA levels by 5- to 10-fold. Interestingly, at later time points (1224 h), the increased IL-12p40 mRNA levels persisted, hinting at additional forms of regulation. By contrast, simvastatin pretreatment inhibited LPS-induced IP-10 mRNA levels (Fig. 1F). Taken together, these data indicate that simvastatin pretreatment enhances LPS-induced IL-12p40 production, whereas it inhibits LPS-induced IP-10 production.
|
To investigate whether simvastatin enhances IL-12p40 production at the transcriptional level, we compared the effect of simvastatin on RAW264.7 cells that stably express the IL-12p40 promoter linked to the firefly luciferase gene with cells that stably express the ELAM promoter-firefly luciferase gene. As shown in Fig. 2B, simvastatin activated the IL-12p40 promoter, and substantially augmented the LPS response. By contrast, simvastatin did not activate the ELAM promoter and did not augment LPS stimulation of the ELAM promoter. This clearly demonstrates that simvastatin regulates the IL-12p40 promoter. The promoter of the gene encoding IL-12p40 has been studied in great detail. The murine IL-12p40 promoter has an Ets, an NF-
B, a C/EBP, and an AP-1 binding site at 218 to 213, 131 to 122, 96 to 88, and 79 to 74 relative to the transcription start site, respectively (Fig. 2A). These transcription factors have been shown to functionally cooperate with each other for efficient transcription of IL-12p40 in response to LPS (27, 28, 29, 30).
|
B-binding element; the 81 construct lacks the C/EBP binding site. RAW264.7 cells were transiently transfected with these constructs and then treated with simvastatin. After 20 h of incubation, the cells were stimulated for 5 h with 10 ng/ml LPS, and the luciferase activities were measured. The 352, the 194, and the 127 luciferase constructs were activated by 5- to 7-fold in response to simvastatin treatment (Fig. 2C). Both the 81 and the empty pGL3 constructs were activated
2-fold by simvastatin, suggesting a small, promoter-independent effect.
Progressive deletion of the IL-12p40 promoter demonstrated the requirement for Ets, NF-
B, and C/EBP in LPS responsiveness in simvastatin-treated cells (Fig. 2C). By contrast, simvastatin alone activated the 352, 194, and 127 constructs equally, suggesting that the statin-responsive elements are contained within the 127 construct (Fig. 2C). To more precisely delineate the statin-responsive elements, we introduced a 2-bp substitution in either the NF-
B, C/EBP, or AP-1 binding sites in the 352 construct, and examined their response to simvastatin and/or LPS. As previously described, all mutants lost the response to stimulation with LPS alone (Fig. 2D) (29). By contrast, the NF-
B mutant showed a normal response to simvastatin treatment, whereas both C/EBP and AP-1 mutants were unresponsive (Fig. 2D). Taken together, the data demonstrate that NF-
B does not play a role in the simvastatin effects on the IL-12p40 promoter.
We next used dominant-negative inhibitors to address the involvement of C/EBP and AP-1 transcription factors in the simvastatin response. We used a strategy in which we introduced artificial homologues that form heterodimers with C/EBP and AP-1, thereby preventing them from activating target genes; C/EBP was inhibited with A-C/EBP (16), and AP-1 was inhibited by A-Fos (17). Either A-C/EBP or A-Fos substantially inhibited the simvastatin-mediated response. Moreover, A-C/EBP suppressed the basal activity of the IL-12p40 promoter by 70% (Fig. 2E). These data suggest that the C/EBP and AP-1 transcription factors have a role in the augmentation of the IL-12p40 promoter activity by simvastatin.
We explored the temporal effect of simvastatin on IL-12p40 promoter activity in stably transfected RAW264.7 cells. At early time points (up to 4 h), simvastatin had no effect on the IL-12p40 promoter activity (Fig. 2F). After 8 h, there was a gradual increase in IL-12p40 promoter activity (Fig. 2F). Importantly, there was no temporal difference in AP-1 binding to the IL-12p40 promoter (Fig. 2G). Taken together, these data clearly demonstrate that there is no initial spike in AP-1 activity.
Simvastatin reduces c-Fos binding to the IL-12p40 promoter
We examined the effect of simvastatin on the binding activities of the C/EBP and AP-1 transcription factors to the IL-12p40 promoter. Radiolabeled double-stranded oligonucleotide probes spanning the sequence from position 103 to 76, and 88 to 56, were prepared and used to detect the C/EBP and AP-1 complexes, respectively. LPS stimulation enhanced the binding activities of both C/EBP and AP-1, as previously reported (data not shown) (29, 30). Simvastatin pretreatment did not show any effects on either constitutive or LPS-induced C/EBP-binding activities (data not shown). C/EBP refers to a family of transcription factors; and the formal possibility existed that a different C/EBP family member might be induced to bind to the IL-12p40 promoter when the cells were treated with simvastatin. Supershift assays were performed using polyclonal Abs against C/EBP
, -
, -
, or -
, and nuclear extracts from LPS-stimulated RAW264.7 cells with or without simvastatin pretreatment. The majority of the C/EBP complex consisted of C/EBP
and C/EBP
, and this was not changed by the presence of simvastatin (Fig. 3A). Simvastatin pretreatment slightly inhibited the augmentation of AP-1-binding activities by LPS (data not shown). Supershift assays demonstrated that the AP-1 complex formed in response to LPS contained c-Jun, JunB, c-Fos, FosB, and Fra-2 (Fig. 3B). Importantly, simvastatin pretreatment decreased c-Fos dramatically from the AP-1 complex (Fig. 3B). This decrease in c-Fos is due to a simvastatin-mediated inhibition of LPS-induced c-Fos synthesis (Fig. 3C).
|
The simvastatin-mediated inhibition of c-Fos binding appeared to be paradoxical. On the one hand, simvastatin clearly triggered IL-12p40 production through the AP-1 binding site (Fig. 2, D and E). In contrast, simvastatin drastically reduced LPS-mediated c-Fos induction and binding to the promoter (Fig. 3, B and C). This suggested that the reduction of c-Fos contributed to the activation of the IL-12p40 promoter. Ectopic expression of c-Fos reduced p40127 promoter activity by 70% in the simvastatin-treated cells, while c-Jun expression enhanced it (Fig. 3D). Thus, these findings suggest a resolution to the paradox: c-Fos negatively regulates the IL-12p40 promoter activity, whereas c-Jun augments it. Ectopic expression of JunB, FosB, and Fra-2 had no effect on IL-12p40 promoter activity (Fig. 3D).
Simvastatin induces c-Jun phosphorylation
c-Jun is activated when c-Jun N-terminal kinase (JNK) phosphorylates Ser63 and Ser73. An in vitro kinase assay showed that simvastatin pretreatment provoked JNK activation at 12 h in RAW264.7 cells (Fig. 4A). Moreover, simvastatin pretreatment significantly induced Ser63 phosphorylation of the endogenous c-Jun protein (Fig. 4B, lane 6) and substantially augmented LPS-induced phosphorylation at the same site (Fig. 4B, lanes 7-10). Thus, JNK activation appeared responsible for the simvastatin-mediated IL-12p40 promoter activation. This was tested directly using a cell-permeable peptide inhibitor of JNK (31). Indeed, the JNK inhibitor diminished the simvastatin-mediated JNK activation in a dose-dependent manner (Fig. 4C), and this was accompanied by the partial inhibition of transcriptional activation of the IL-12p40 promoter (Fig. 4D). Taken together, simvastatin diminished the negative regulator, c-Fos, by inhibiting its induction, and augmented the positive regulator, c-Jun, through phosphorylation.
|
To show that the simvastatin effect was due to its inhibition of the HMG-CoA reductase, we demonstrated that mevalonate, farnesylpyrophosphate, and geranylgeranylpyrophosphate, intermediates in the cholesterol biosynthetic pathway, reversed the effect (Fig. 5). Interestingly, squalene, a cholesterol precursor that is distal to geranylgeranylpyrophosphate, did not reverse the simvastatin effect on the IL-12p40 production. This suggests that the simvastatin effect on the IL-12p40 is not due to cholesterol deprivation, but rather on a proximal step, perhaps on protein prenylation.
Simvastatin also augments TNF-
production by transcriptional activation
The promoter analysis indicates that both C/EBP and AP-1 binding sites are critical for the simvastatin-induced augmentation of IL-12p40 promoter. Other promoters containing both C/EBP and AP-1 binding sites might also be expected to be activated by simvastatin treatment. To confirm this hypothesis, we examined another inflammatory cytokine whose promoter has a similar structure to the IL-12p40 promoter. The unique feature of IL-12p40 promoter is that the C/EBP and AP-1 binding sites are located close to each other. The human TNF-
promoter has C/EBP and AP-1 binding sites similarly apposed (32, 33, 34), and, based on sequence homology, so does the murine TNF-
promoter. As expected, simvastatin induced TNF-
promoter-luciferase construct by 7-fold (Fig. 6A), and this was mirrored by increased TNF-
mRNA and secreted protein (Fig. 6, B and C).
|
| Discussion |
|---|
|
|
|---|
Although the AP-1 binding site was critical for simvastatin-mediated activation of the IL-12p40 promoter, so was the C/EBP binding site, and this was confirmed by the demonstration that dominant-negative C/EBP completely abolished the simvastatin effect. It is not clear how these sites functionally interact to mediate the simvastatin effect; one possible explanation is that AP-1 requires the assistance of C/EBP to enhance IL-12p40 transcription.
Two recent reports present compelling evidence that statins have potent anti-inflammatory effects in an EAE model. Atorvastatin induced STAT6 phosphorylation and secretion of Th2 cytokines such as IL-4, IL-5, IL-10, and TGF-
. In contrast, STAT4 phosphorylation was inhibited, resulting in suppression of Th1 cytokine secretion (IL-2, IL-12, IFN-
, and TNF-
) (9, 10). Although these observations appear to be at variance with our results, a number of important differences exist between the two experimental systems. Principally, Ag presentation is crucial for both the initiation and the progression of EAE (38), whereas we were examining LPS-induced cytokine production by macrophages.
There is also evidence for a proinflammatory effect of statins in human disease. Mevalonate kinase (MK) is the next enzyme after HMG-CoA reductase in the cholesterol biosynthetic pathway. Mutation of the MK gene results in two inflammatory diseases in humans, mevalonic aciduria and hyperimmunogloburinaemia D and periodic fever syndrome (39, 40, 41). The mutation of MK, like statin treatment, results in substantially reduced cholesterol biosynthesis, and both appear to elicit proinflammatory responses. This is supported by the observation that lovastatin treatment substantially exacerbated mevalonic aciduria (39).
In conclusion, simvastatin potentiates proinflammatory responses induced by bacterial products, and this occurs by a mechanism involving the AP-1 and C/EBP transcription factors. Given the prevalence of statin use, it may be important to monitor inflammatory responses when treated individuals experience bacterial infection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alan Aderem, Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103-8904. E-mail address: aderem{at}systemsbiology.org ![]()
3 Abbreviations used in this paper: HMG-CoA, 3-hydroxyl-3-methylglutaryl-coenzyme A; CSK4, Cys-Ser-(Lys)4; EAE, experimental autoimmune encephalomyelitis; EF-1
, elongation factor-1
; ELAM, endothelial leukocyte adhesion molecule; IP-10, IFN-
-inducible protein-10; JNK, c-Jun N-terminal kinase; MK, mevalonate kinase; Pam3, N-palmitoyl-S-dipalmitoylglyceryl; R.L.U., relative luciferase unit. ![]()
Received for publication December 1, 2003. Accepted for publication April 12, 2004.
| References |
|---|
|
|
|---|
production after lipopolysaccharide exposure. J. Immunol. 171:2625.
B. J. Clin. Invest. 102:1645.[Medline]
B binding sites in the human E-selectin gene required for maximal tumor necrosis factor
-induced expression. Mol. Cell. Biol. 14:5820.
(C/EBP
) and C/EBP
transcription factors. J. Biol. Chem. 276:48693.
B and Ets transcription factors in Epstein-Barr virus-transformed B cells and macrophages. J. Biol. Chem. 273:6431.
B half-site. Mol. Cell. Biol. 15:5258.[Abstract]
-cell death. Diabetes 50:77.
regulation of the tumor necrosis factor
gene. J. Clin. Invest. 94:1449.
gene regulation: enhancement of C/EBP
-induced activation by c-Jun. Mol. Cell. Biol. 18:2815.
gene expression in macrophages: regulation by NF-
B is independent of c-Jun or C/EBP
. J. Immunol. 164:4277.This article has been cited by other articles:
![]() |
H. Morishita, F. Saito, H. Kayama, K. Atarashi, H. Kuwata, M. Yamamoto, and K. Takeda Fra-1 negatively regulates lipopolysaccharide-mediated inflammatory responses Int. Immunol., April 1, 2009; 21(4): 457 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Sundararaj, D. J. Samuvel, Y. Li, A. Nareika, E. H. Slate, J. J. Sanders, M. F. Lopes-Virella, and Y. Huang Simvastatin suppresses LPS-induced MMP-1 expression in U937 mononuclear cells by inhibiting protein isoprenylation-mediated ERK activation J. Leukoc. Biol., October 1, 2008; 84(4): 1120 - 1129. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Kroening, T. W. Barnes, L. Pease, A. Limper, H. Kita, and R. Vassallo Cigarette Smoke-Induced Oxidative Stress Suppresses Generation of Dendritic Cell IL-12 and IL-23 through ERK-Dependent Pathways J. Immunol., July 15, 2008; 181(2): 1536 - 1547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takahashi, H. Nakamura, M. Seki, Y. Shiraishi, M. Yamamoto, M. Furuuchi, T. Nakajima, S. Tsujimura, T. Shirahata, M. Nakamura, et al. Reversal of elastase-induced pulmonary emphysema and promotion of alveolar epithelial cell proliferation by simvastatin in mice Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L882 - L890. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Clarke, A. Lyons, F. O'Connell, B. F. Deighan, C. E. Barry, N. G. Anyakoha, A. Nicolaou, and M. A. Lynch A Pivotal Role for Interleukin-4 in Atorvastatin-associated Neuroprotection in Rat Brain J. Biol. Chem., January 25, 2008; 283(4): 1808 - 1817. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Lee, H. Qin, and E. N. Benveniste Simvastatin inhibits IFN-{gamma}-induced CD40 gene expression by suppressing STAT-1{alpha} J. Leukoc. Biol., August 1, 2007; 82(2): 436 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gianella, E. Nobili, M. Abbate, C. Zoja, P. Gelosa, L. Mussoni, S. Bellosta, M. Canavesi, D. Rottoli, U. Guerrini, et al. Rosuvastatin Treatment Prevents Progressive Kidney Inflammation and Fibrosis in Stroke-Prone Rats Am. J. Pathol., April 1, 2007; 170(4): 1165 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Karamouzis, P. A. Konstantinopoulos, and A. G. Papavassiliou The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Mol. Cancer Res., February 1, 2007; 5(2): 109 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanaka, C. M. Porter, J. A. Horvath-Arcidiacono, and E. T. Bloom Lipophilic statins suppress cytotoxicity by freshly isolated natural killer cells through modulation of granule exocytosis Int. Immunol., February 1, 2007; 19(2): 163 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. D. Patino, J.-G. Kang, S. Matoba, O. Y. Mian, B. R. Gochuico, and P. M. Hwang Atherosclerotic Plaque Macrophage Transcriptional Regulators Are Expressed in Blood and Modulated by Tristetraprolin Circ. Res., May 26, 2006; 98(10): 1282 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ray, M. Kuwahara, Y. Takada, K. Maruyama, T. Kawaguchi, H. Tsubone, H. Ishikawa, and K. Matsuo c-Fos suppresses systemic inflammatory response to endotoxin Int. Immunol., May 1, 2006; 18(5): 671 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. R. Coward, A. Marei, A. Yang, M. M. Vasa-Nicotera, and S. C. Chow Statin-Induced Proinflammatory Response in Mitogen-Activated Peripheral Blood Mononuclear Cells through the Activation of Caspase-1 and IL-18 Secretion in Monocytes J. Immunol., May 1, 2006; 176(9): 5284 - 5292. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Kay, R. Z. Murray, J. K. Pagan, and J. L. Stow Cytokine Secretion via Cholesterol-rich Lipid Raft-associated SNAREs at the Phagocytic Cup J. Biol. Chem., April 28, 2006; 281(17): 11949 - 11954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yilmaz, C. Reiss, A. Weng, I. Cicha, C. Stumpf, A. Steinkasserer, W. G. Daniel, and C. D. Garlichs Differential effects of statins on relevant functions of human monocyte-derived dendritic cells J. Leukoc. Biol., March 1, 2006; 79(3): 529 - 538. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Tomczak, M. Gadjeva, Y. Y. Wang, K. Brown, I. Maroulakou, P. N. Tsichlis, S. E. Erdman, J. G. Fox, and B. H. Horwitz Defective Activation of ERK in Macrophages Lacking the p50/p105 Subunit of NF-{kappa}B Is Responsible for Elevated Expression of IL-12 p40 Observed after Challenge with Helicobacter hepaticus J. Immunol., January 15, 2006; 176(2): 1244 - 1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sekine, T. Yumioka, T. Yamamoto, R. Muromoto, S. Imoto, K. Sugiyma, K. Oritani, K. Shimoda, M. Minoguchi, S. Akira, et al. Modulation of TLR4 Signaling by a Novel Adaptor Protein Signal-Transducing Adaptor Protein-2 in Macrophages J. Immunol., January 1, 2006; 176(1): 380 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Murthy, H. Tong, and R. J. Hohl Regulation of Fatty Acid Synthesis by Farnesyl Pyrophosphate J. Biol. Chem., December 23, 2005; 280(51): 41793 - 41804. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirotani, P. Y. Lee, H. Kuwata, M. Yamamoto, M. Matsumoto, I. Kawase, S. Akira, and K. Takeda The Nuclear I{kappa}B Protein I{kappa}BNS Selectively Inhibits Lipopolysaccharide-Induced IL-6 Production in Macrophages of the Colonic Lamina Propria J. Immunol., March 15, 2005; 174(6): 3650 - 3657. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Fessler, S. K. Young, S. Jeyaseelan, J. G. Lieber, P. G. Arndt, J. A. Nick, and G. S. Worthen A Role for Hydroxy-Methylglutaryl Coenzyme A Reductase in Pulmonary Inflammation and Host Defense Am. J. Respir. Crit. Care Med., March 15, 2005; 171(6): 606 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sironi, E. Gianazza, P. Gelosa, U. Guerrini, E. Nobili, A. Gianella, B. Cremonesi, R. Paoletti, and E. Tremoli Rosuvastatin, but not Simvastatin, Provides End-Organ Protection in Stroke-Prone Rats by Antiinflammatory Effects Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 598 - 603. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |