The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campos-Martín, Y.
Right arrow Articles by Martínez-Naves, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campos-Martín, Y.
Right arrow Articles by Martínez-Naves, E.
The Journal of Immunology, 2004, 172: 7297-7305.
Copyright © 2004 by The American Association of Immunologists

Expression of Human CD1d Molecules Protects Target Cells from NK Cell-Mediated Cytolysis1

Yolanda Campos-Martín*, Manuel Gómez del Moral{dagger}, Beatriz Gozalbo-López*, Javier Suela* and Eduardo Martínez-Naves2,*

* Unidad de Inmunología and {dagger} Departamento de Biología Celular, Facultad de Medicina, Universidad Complutense, Madrid, Spain


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cytotoxic activity of NK cells can be inhibited by classical and nonclassical MHC molecules. The CD1 system is formed by a family of glycoproteins that are related to classical MHC. CD1a, b, and c molecules present lipids or glycolipids to T cells and are involved in defense against microbial infections, especially mycobacteria. It has been shown recently that these molecules can inhibit target cell lysis by human NK cells. It has also been shown that mouse CD1d molecules can protect cells from NK cell-mediated cytotoxicity. In the present study, we describe how human CD1d, orthologous to murine CD1 molecules, can inhibit NK cell-mediated cytolysis. We have expressed CD1d in the HLA class I-deficient cell lines L721.221 and C1R. The inhibitory effect is observed when effector NK cells from different donors are used, as well as in different cell lines with NK activity. The inhibitory effect was reversed by incubating the target cells with a mAb specific for human CD1d. Incubation of target cells with the ligands for CD1d, {alpha}-galactosylceramide ({alpha}-GalCer), and {beta}-GalCer abolishes the protective effect of CD1d in our in vitro killing assays. Staining the effector cells using CD1d tetramers loaded with {alpha}-GalCer was negative, suggesting that the putative inhibitory receptor does not recognize CD1d molecules loaded with {alpha}-GalCer.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Natural killer cells are a lymphoid population distinct from T and B lymphocytes. Initially, NK cells were characterized as cells capable of killing some tumor cells without previous activation. It is now known that NK cells play important roles in host defense against pathogens such as herpesvirus, in tumor immunity, and in the rejection of transplants. Upon activation, NK cells are able to secrete a variety of cytokines that can induce inflammation. They also play a role in regulating the immune response.

NK cells are regulated through activating and inhibitory receptors that allow them to distinguish between healthy and diseased cells. There are a number of these receptors, and their function is the subject of active research. The ligand(s) for activating receptors has not yet been identified (1). The ligands for inhibitory receptors are MHC class I proteins (2). Loss of expression of class I proteins induced by a viral infection or a tumoral transformation renders most cells highly susceptible to lysis by NK cells. Thus, NK cells seem to act as complementary players to CTL because they are able to kill cells invisible to CTL.

Initially, classical MHC class I molecules were identified as ligands for NK inhibitory receptors (2). Recognition of class I molecules is highly specific, and there are receptors capable of distinguishing locus or allelic variants of MHC class I molecules (3). Nonclassical MHC molecules are also able to inhibit NK lysis (4). CD94/NKG2A is an inhibitory receptor that recognizes HLA-E, a nonpolymorphic MHC class Ib molecule in humans (5). In mice, Qa-1, which is HLA-E orthologous, is recognized by CD94/NKG2A (6). Another member of the Qa-2 family, Q9 has also been shown to inhibit NK cell and lymphokine-activated killer (3) cell-mediated cytolysis (7). The family of MHC-related genes also includes genes, in mice and in humans, outside the MHC complex. Recently, a new taxonomy for this family of genes has been proposed (8). Following this nomenclature, classical HLA-A, -B, and -C would be named as HLA class Ia, whereas the genes located inside the HLA complex and showing high similarity to the classical (HLA-E, -F, and -G) would be named as class Ib. More divergent genes with respect to the classical and located inside the HLA complex (MIC, HFE) would be named as HLA class Ic. Finally, genes located outside the HLA complex, and often being more divergent with respect to the classical (FcRN, ZAG, MR1, CD1, ULBP, EPCR), would be named as class Id. This last group includes gene-encoding and Ag-presenting molecules such as MR1 and CD1.

The CD1 genes encode a family of glycoproteins that are related to MHC molecules (9). CD1 molecules can be divided in two groups according to sequence homology and tissue distribution (10). Human CD1A, -B, and -C genes are members of group I, whereas group II is formed by CD1D. Mice only have group II CD1 genes, CD1D1 and CD1D2, which are 95% homologous. Mouse and human CD1 molecules are able to present nonpeptide Ags to T cells. CD1a, b, and c molecules present lipids or glycolipids to T cells and are involved in defense against microbial infections, especially mycobacteria. The three-dimensional structure of the murine CD1d molecule has been solved, and it shows a folding very similar to HLA class I molecules (11). Human CD1d and murine CD1d1 are able to present {alpha}-galactosylceramide ({alpha}-GalCer 3; a ceramide initially isolated from a marine sponge with a potent antitumoral effect) to NKT cells (12). NKT cells are a specialized set of T lymphocytes capable of secreting large amounts of cytokines, including IL-4 and IFN-{gamma}, which can have multiple regulatory activities (13).

It has been shown that murine CD1d1 molecules can inhibit the cytotoxic activity of lymphokine-activated killer cells (14). Furthermore, it has been shown that human CD1 group I molecules, CD1a, b, and c, can also inhibit NK cell lysis (15). We show in this study that human CD1d molecules can also inhibit NK activity.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
CD1D cloning and expression

Total RNA was isolated from the epithelial cell line Caco-2 using the ULTRASPEC RNA isolation method (Bioteck Laboratories, Houston, TX). First strand cDNA was synthesized from total RNA using first strand cDNA synthesis kit (Roche Biochemicals-Boehringer Mannheim, Mannheim, Germany). Full-length CD1D cDNA was obtained after PCR amplification using primers CD1D3 (5'), GGGCGTCGACAGAAGAGTGCGCAGGTCAGAG and CD1D4 (3'), CCGCAAGCTTGAAGTCTTGGGAACCTGAGGTC containing SalI and HindIII recognition sites at 5' ends. The PCR products were sequenced and cloned into pSR{alpha}Neo vector. The plasmid was transfected by electroporation in the HLA class I-deficient lymphoblastoid cell lines L721.221 (16) and C1R (17).

Cells expressing high levels of CD1d were selected using Dynabeads M-450 (Dynal Biotech, Great Neck, NY) and the Ab 51.1.3 (gift from Dr. S. A. Porcelli, Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, NY) specific for human CD1d (18, 19). HLA-B48.221 (20) and CD1a.221 (21), generated previously in our laboratory, were used as controls in the cytotoxicity assays. All the cell lines were cultured in RPMI 1640, 1% antibiotic/antimycotic solution (Life Technologies, Carlsbad, CA), and 10% FCS (Harlan Sera-Lab, Indianapolis, IN).

NK cell culture

PBMC were isolated by centrifugation on Lymphoprep (Amersham Biosciences, Amersham, U.K.) gradients from healthy donors and from healthy donors’ buffy coats (obtained from the Blood Bank of the Fundación Jiménez Díaz, Madrid, Spain). Cells were activated for 48–72 h with 800 IU/ml human rIL-2 (rhIL-2) (gift from Hoffmann-LaRoche, Nutley, NJ, and Dr. C. W. Reynolds, Frederick Cancer Research and Development Center, National Cancer Institute, National Institutes of Health, Frederick, MD), before their use in cytotoxicity assays. Fresh NK cells CD56+ were isolated from PBMC activated with 800 IU/ml rhIL-2 (3) for 48–72 h. CD56+ was selected by immunomagnetic separation using magnetic beads (Miltenyi Biotec, Cologne, Germany). CD56+ cells were maintained in culture with rhIL-2 (50 IU/ml) previous to the cytotoxicity assays. CD56+CD3– were isolated from PBMC healthy donors’ buffy coats, using the NK Cell Isolation kit II human (Miltenyi Biotec). Two rounds of CD3+ cell depletion were used, and >95% of the cells were CD56+CD3– as assessed by FACS analysis. CD56+CD3– cells were activated with rhIL-2 (50 IU/ml) previous to the cytotoxicity assays. All these effector cells were cultured in RPMI 1640, 1% antibiotic/antimycotic solution, and 10% FCS. The cell line NKL (22) (kindly provided by Dr. M. López-Botet, Unidad de Inmunopatología molecular, Universidad Pompeu Fabra, Barcelona, Spain) was cultured with RPMI 1640, 1% antibiotic/antimycotic solution, 10% human serum AB (Sigma-Aldrich, Oakville, Ontario, Canada), and rhIL-2 (50 IU/ml). T cell lines CD8+ immortalized with Herpesvirus saimiri (HVS) with NK activity (23) were cultured in 50% RPMI 1640, 50% PanSerin 401 (PAN; Biotech International, Aidenbach, Germany) with 1% antibiotic/antimycotic solution, and 10% FCS, and activated with 40 IU/ml rhIL-2.

NKT cell expansion

PBMC were isolated by centrifugation on Lymphoprep gradients from healthy donors. A total of 1 x 106 cells/ml was cultured in 24-well plates with RPMI 1640, 1% antibiotic/antimycotic solution, and 10% FCS. PBMC were activated with 50 IU/ml rhIL-2 and 100 ng/ml {alpha}-GalCer (Kirin, Tokyo, Japan), for 2 wk. Abs, anti-V{alpha}24 and anti-V{beta}11 (Beckman Coulter, Fullerton, CA), were used to isolate NKT cells by Miltenyi Biotec MicroBeads, and to identify them by FACS analysis.

Abs, F(ab')2 production, and flow cytometry analysis

Anti-human CD1d mAbs used in this study were 51.1.3 (mouse IgG2b) (gift from Dr. S. A. Porcelli) (18, 19) and CD1d42 (mouse IgG1,{kappa}) (BD PharMingen, San Diego, CA). Other Abs used were: anti-human CD1a OKT6 (mouse IgG1) culture supernatant (from American Type Culture Collection (ATCC), Manassas, VA); anti-human HLA-B48 MB40.3 (mouse IgG1) culture supernatant (from ATCC) purified by protein A column affinity (Bio-Rad, Richmond, CA); conjugated anti-human CD3 Leu4-PE (BD Biosciences, Franklin Lakes, NJ); a PE-coupled polyclonal goat anti-mouse IgG (H + L) (Caltag Laboratories, Burlingame, CA), used as a secondary Ab in FACS analysis; and conjugated anti-human CD56-PE (Miltenyi Biotec). Finally, CD1d-Fc/PA-A488 tetramers (24) (gift from Dr. J. Gumperz, Medical Microbiology and Immunology, University of Wisconsin-Madison Medical School, Madison, WI) were also used in FACS analysis. An Epics Elite cytometer (Beckman Coulter) was used in the flow cytometry analysis. Typically, 20 x 104 to 30 x 104 cells were stained in each analysis.

F(ab')2 CD1d42 and MB40.3 (used as negative control) were generated, using an Immunopure IgG1 Fab and F(ab')2 preparation kit (Pierce, Rockford, IL), by Ficin enzymatic digestion for 20 h, and purified by passing through a protein A column, followed by concentration of the sample using CentriconYM-10 (Millipore, Billerica, MA) and dissolving in PBS (Valeant, Costa Mesa, CA). The concentration of F(ab')2 was measured by the Bio-Rad DC colorimetric assay for protein, based on the Lowry assay. The correct fragmentation of the Abs was checked in a SDS-PAGE on 10% polyacrylamide gels under reducing conditions. CD1d.221 and CD1d.C1R were labeled with CD1d42 F(ab')2, followed by anti-mouse Ig{kappa}-PE (BD Biosciences), to be sure that the F(ab')2 generated recognized CD1d expressed in these cell lines.

L721.221 and C1R transfectant cell lines were incubated with 4 µg/ml specific anti-CD1d F(ab')2 for 30 min at room temperature, washed twice, and used in the cytotoxicity assays.

Cytotoxicity assay

Cytotoxicity was measured using the conventional 4-h 51Cr release assay (15) and the nonradioactive cytotoxicity detection kit lactate dehydrogenase (LDH; Roche Biochemicals). Target cells were cultured in 96-well plates V, with effector cells for 4 h, at different E:T ratio. The percentage of specific lysis in each assay depends on the amount of LDH activity detected in the culture supernatant. LDH is rapidly released into the cell culture supernatant upon damage of the plasma membrane. The culture cell-free supernatants were collected and incubated with the reaction mixture from the kit. A Microplate Autoreader Bio-Tek instrument (Cultek, Madrid, Spain) was used to read the absorption. All cytotoxic assays were performed in triplicate. Percent specific lysis was calculated as: 100 x (experiment value – low control)/(high control – low control).

Pretreatment of Mock.221 and CD1d.221 was performed by adding 100 ng/ml {alpha}-GalCer dissolved in polisorbate 20 (P-20) (Kirin), {alpha}-GalCer dissolved in DMSO (a gift from Dr. P. Savage, Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT), synthetic {beta}-galactosylceramide ({beta}-GalCer) (C12) (Avanti Polar Lipids, Alabaster, AL), and bovine brain {beta}-GalCer (Sigma-Aldrich) as CD1d Ags. Mycolic acid from Mycobacterium tuberculosis (human strain) (Sigma-Aldrich) was used as an additional CD1 Ag control. P-20 (Kirin) and DMSO (Sigma-Aldrich), respectively, were used as controls, added to 35 x 104 cells in a final volume of 500 µl of culture medium, and incubated overnight at 37°C. Purified CD56+CD3– were used as effector cells.

Statistical analysis

We analyzed samples with the Kolmogorov-Smirnoff and {chi}2 tests for normality distribution and Bartlett and Cochran's test to assure homoscedasticity. We used one-way ANOVA to test for differences between experiments. The figures represent the mean ± SEM of specific lysis in our cytotoxicity tests.

To analyze the CD1 ligand effect on our in vitro cytotoxicity tests, we first calculated the percentage of lysis inhibition, which represented the difference between percentage of lysis of Mock.221 and percentage of lysis of CD1d.221, in each treatment (nontreatment, ligand treatment, and vehicle).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of CD1d molecules on the MHC class I-negative cell lines inhibits the cytotoxicity of NK cells and different cell lines with NK activity

To investigate the possible action of CD1d on NK cells, we decided to use the class I-negative cell line L721.221 and C1R as models. Both L721.221 and C1R cells were transfected with human CD1d cDNA. Expression of CD1d molecules on the cell surface was analyzed by FACS. Cells expressing high levels of CD1d were selected by magnetic beads. Next, we obtained two cell lines that we named CD1d.221 and CD1d.C1R. We also transfected L721.221 and C1R cells with the vector alone, generating the mock cell lines that we used as controls. Fig. 1 shows the expression of CD1d analyzed by FACS using the CD1d-specific Ab CD1d42. Transfected L721.221 and C1R cells express high levels of CD1d compared with those of the mock-transfected controls.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 1. Analysis of CD1d expression. L721.221 and C1R cells transfected with CD1d-encoding cDNA express high levels of CD1d on the cell surface, as assessed by FACS analysis. Filled histograms indicate the fluorescence intensity of cells Mock.221 or Mock.C1R stained with CD1d42 mAb. Open histograms show fluorescence of cells CD1d.221 or CD1d.C1R stained with CD1d42 mAb. The symbol – shows the stained cells obtained with the isotype control mAb.

 
We first decided to study the possible effect of CD1d expression on the cell surface, using as effector cells freshly isolated PBMC. Our initial in vitro killing assays included Mock.221 and CD1d.221 as target cells. As a control, we decided to include cells previously generated in our laboratory, expressing high levels of CD1a (CD1a.221) and the class I HLA molecule B48 (HLA-B48.221). The CD1a molecule has been previously shown to inhibit NK lysis, and HLA-B48 is a classical class I molecule that is likely to inhibit NK cytotoxicity. The killing activity of freshly isolated PBMC was inhibited in the cells expressing HLA-B48, CD1a, as well as in CD1d, in comparison with the mock-transfected cell lines, as shown in Fig. 2a. This inhibition was observed in independent experiments using cells from different donors, although the amount of the protection varied between individuals (results not shown). Results showing higher levels of inhibition were obtained in experiments with bulk short-term IL-2-activated PBMC, as shown in Fig. 2b. A clear reduction in the susceptibility to NK lysis was observed in CD1a.221, HLA-B48.221, and CD1d.221 cells compared with the mock-transfected L721.221 cells.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 2. PBMCs, IL-2-activated PBMCs, and CD56+CD3– cytolytic activity. a, Cytotoxicity against Mock.221 cells of freshly isolated PBMC was higher than that of CD1d.221, B48.221, and CD1a.221 transfectants. b, The differences were more pronounced when IL-2-activated PBMC were used. Mock.221 ({diamondsuit}), CD1d.221 ({diamond}), HLA-B48.221 ({Delta}), and CD1a.221 (X). c, The cytotoxicity of CD56+CD3– effector cells against CD1d.221 and CD1d.C1R transfectants is reduced compared with mock-transfected target cells. Mock.221 ({diamondsuit}), CD1d.221 ({diamond}), Mock.C1R (•), and CD1d.C1R ({circ}). The results shown are representative of at least three independent experiments.

 
We next purified CD56+CD3– cells and used them as effector cells in the in vitro killing assays. At this point, we also decided to include a second target cell type, and the CD1d cDNA was transfected into the HLA class I-deficient C1R cell (see Fig. 1). As expected, both C1R and L721.221 cells were efficiently lysed by CD56+CD3– cells. The expression of CD1d on the cell surface significantly reduced the specific lysis in both targets, as shown in Fig. 2c.

We also included in our studies different cell lines with NK activity. First, we used the NKL cell line (22). In this case, CD1d also inhibits the cytotoxic activity against L721.221 and C1R, as shown in Fig. 3a.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 3. Cytolytic activity of NK and HVS-T cell lines. The cytotoxicity of a, NKL and b, HVS-T cell lines against CD1d.221 and CD1d.C1R transfectants is reduced compared with mock-transfected target cells. Mock.221 ({diamondsuit}), CD1d.221 ({diamond}), Mock.C1R (•), and CD1d.C1R ({circ}). The results shown are representative of at least three independent experiments.

 
Human T cells CD8+ transformed with HVS-T cells have been shown to display NK activity against the K562 cell line (23). Thus, we decided to investigate whether HVS-T cell lines also were able to kill the cell line L721.221. We tested several HVS-transformed T cells to identify those with significant NK activity against L721.221 cells. Fig. 3b shows the results of the cytotoxicity assays using three different CD8+ HVS-T cell lines: HVS-CJL, HVS-ANZ, and HVS-CTO. The lysis of CD1d.221 was always lower than the lysis of Mock.221. However, significant differences were observed between the cell lines regarding the ability of CD1d to inhibit killing in the cytotoxicity test. The cell line HVS-CTO was the most sensitive regarding the CD1d inhibition of the NK activity, and for that reason we selected this cell line for subsequent experiments. The NK cytotoxicity of HVS-CTO against the CD1d.C1R was also reduced compared with mock.C1R (Fig. 3b).

To confirm the results obtained, we decided to replicate a number of experiments and to apply accurate statistical analysis. Fig. 4 summarizes the results of these experiments in which we observed statistically significant differences in the lysis of Mock.221 and CD1d.221 cells with different effector cells: CD56+CD3–, HVS-CTO, and NKL.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. Statistical analysis of CD56+CD3–, HVS-CTO, and NKL cytolytic activity. The figure shows significant differences between Mock.221 and CD1d.221 lysis. The results were analyzed by ANOVA test, which showed: CD56+CD3– effector cells, E:T ratio 7.5:1 and 15:1 (*, p = 0.041 and *, p = 0.0346, respectively) (n = 8); HVS-CTO effector cells, E:T ratio 5:1 and 10:1 (**, p = 0.0044 and *, p = 0.0195, respectively) (n = 8); and NKL effector cells, E:T ratio 2:1 (*, p = 0.0481) (n = 7). {square}, Correspond to lysis of Mock.221 cells; , correspond to CD1d.221.

 
The inhibitory effect of CD1d expression on L721.221 is reversed by mAbs against CD1d

To confirm the specificity of the inhibition of CD1d, we performed additional cytotoxicity experiments in which the target cells were pretreated with mAbs against CD1d. Fig. 5 shows that the F(ab')2 of the mAb CD1d42 is able to partially reverse the inhibitory effect of CD1d in all the effector cells studied. This reversion was statistically significant with the three types of effector cells, as observed in Fig. 5. A similar, but less pronounced effect was observed with the mAb 51.1.3 (data not shown).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 5. Effect of CD1d-specific F(ab')2 mAb. The inhibitory effect of CD1d expression on L721.221 is reversed by pretreatment of target cells with CD1d42 F(ab')2 mAb. In CD56+CD3–, in HVS-CTO, and in NKL, the different colors of the columns depend on the target cells pretreatment. {square}, Correspond to target cells not pretreated; , correspond to target cells pretreated with F(ab')2 CD1d42; and , correspond to F(ab')2 control. Differences between CD1d.221-nontreated cells and cells treated with control F(ab')2 are statistically significant: CD56+CD3– (p = 0.0099; **, p < 0.01) (n = 3), HVS-CTO (p = 0.0446; *, p < 0.05) (n = 3), and NKL (p = 0.0396; *, p < 0.05) (n = 3).

 
Effect of {alpha}-GalCer on CD1d-dependent NK inhibition

The natural ligand of CD1d molecules is currently unknown. However, human and murine CD1d molecules bind and present {alpha}-GalCer to NKT lymphocytes. To investigate the effect of this compound in the inhibition of NK activity, we performed the cytotoxicity tests after pretreating the target cells with {alpha}-GalCer. As shown in Fig. 6a, our results suggest that pretreatment of the target cells with {alpha}-GalCer seems to abolish the inhibitory effect of CD1d. However, when the cells were pretreated with the vehicle (P-20) alone, the same effect was observed. To avoid the P-20 effect, we next used {alpha}-GalCer dissolved in DMSO (Fig. 6b), confirming that the effect of {alpha}-GalCer is independent of the solvent, DMSO, in this case. It has been described previously that {beta}-GalCer also binds to CD1d, so we tested its effect in the killing assays. Our data indicate that synthetic {beta}-GalCer (as observed in Fig. 6c) is able to reverse the inhibitory effect of CD1d and that this effect is also independent of the vehicle (DMSO). Similar data were obtained with bovine brain {beta}-GalCer (data not shown). Pretreatment of HLA-B48.221 and CD1a.221 with {alpha}-GalCer and {beta}-GalCer dissolved in DMSO were used as controls, and no statistical differences were observed in their NK lysis inhibition (data not shown). In addition, mycolic acid from M. tuberculosis, CD1b-binding lipids, was used as Ag control with our target cells, and no differences in lysis inhibition were observed (data not shown).



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 6. Effect of {alpha}-GalCer and {beta}-GalCer presented by CD1d. a, The percentage of lysis inhibition was lower in target cells treated with {alpha}-GalCer and P-20 compared with untreated cells (p = 0.0028; **, p < 0.01) (n = 14). b, Pretreatment of target cells with {alpha}-GalCer abolishes the protector effect of CD1d compared with DMSO-treated or untreated target (p = 0.001; **, p < 0.01) (n = 12). c, {beta}-GalCer bound to CD1d increased the NK lysis, compared with DMSO-treated and untreated target cells (p = 0.046; *, p < 0.05) (n = 6).

 
To clarify the role of {alpha}-GalCer in our assays, we decided to verify its biological effect by testing the cytotoxicity of NKT cells against our CD1d.221 cells treated with or without {alpha}-GalCer. As expected, {alpha}-GalCer increases the cytotoxicity of NKT cells against CD1d.221 cells in a dose-dependent manner (data not shown), indicating that {alpha}-GalCer does bind to CD1d in our cells and can mediate a biological effect in NKT recognition.

Our results suggest that pretreatment of target cells with {alpha}-GalCer as well as {beta}-GalCer reverses the inhibitory effect of CD1d expression in NK lysis. One explanation for this could be that these ceramides can displace an unknown endogenous ligand of CD1d, involved in the interaction with the NK inhibitory receptor, impairing its binding to CD1d loaded with {alpha}-GalCer or {beta}-GalCer.

To find out whether CD1d loaded with {alpha}-GalCer is able to bind any receptor on the surface of NK cells, we performed flow cytometry experiments in which we stained our effector cells with CD1d-Fc/PA-A488 tetramers (a gift from Dr. J. Gumperz). As shown in Fig. 7, CD1d tetramers loaded with {alpha}-GalCer failed to stain any of the effector cells used in our study. In contrast, CD1d tetramer clearly binds to V{alpha}24+/V{beta}11+ NKT cells used as controls.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 7. CD1d tetramers do not bind NK cells. Effector cells, NKL, CD56+CD3–, HVS-CTO, and NKT were stained with CD1d-Fc/PA-A488+{alpha}GalCer, in the y-axis, and with CD25-PE, CD56-PE, CD3-PE, and V{beta}11-PE, respectively, in the x-axis.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Previous studies have shown that CD1 molecules can inhibit NK cell-mediated cytotoxicity. Carbone et al. (15) have shown that human CD1a, b, and c molecules can inhibit NK cell-mediated cytotoxicity. Murine CD1 molecules, orthologous to human CD1d, can also inhibit lymphokine-activated killer and NK cytotoxicity (14). Murine and human CD1d molecules are very similar in terms of sequence; they bind the same ligand, {alpha}-GalCer; and are recognized by each other’s NKT cells (25). The main difference between human and mouse CD1d is the tissue expression pattern. Human CD1d molecules are expressed mainly on epithelial cells, whereas murine CD1d molecules are expressed on most cells of hemopoietic origin (9). The CD1 system is divergent between humans and mice. In contrast to humans and other mammalian species, mice and rats lack orthology to the group I CD1 molecules that are present in other rodents, such as guinea pigs and rabbits (26). For that reason, we thought it would be interesting to investigate whether human CD1d molecules could behave as NK cell inhibitors.

The results of our study showed that NK-mediated cytotoxicity of freshly isolated PBMC, IL-2-activated PBMC, and CD56+ cells activated with IL-2 against the NK-sensitive target cell lines L721.221 and C1R can be partially inhibited by expression of CD1d on the cell surface. In addition, we have observed that expression of CD1a can also inhibit the cytotoxicity on L721.221. This observation is in agreement with the results of Carbone et al. (15), in which they observed that the NK-sensitive cell lines T2 and HeLa are protected in NK cytotoxicity assays when transfected with CD1a, b, or c molecules.

In our study, we also included two kinds of cell lines with NK activity: NKL and HVS-transformed T cells. NKL is a cell line characterized by having a number of inhibitory receptors, and has been used previously in cytotoxicity experiments with L721.221 cells. Our data showed that this cell line kills L721.221 more efficiently than C1R. This is probably due to the fact that C1R expresses HLA-B35 at reduced levels and normal amounts of HLA-Cw04 (27), which could also induce the expression of HLA-E on the cell surface. It has been described that expression of CD1a, b, and c on C1R (15, 28) does not protect target cells from NK cytotoxicity. This observation could be explained by the masking effect of the endogenous HLA class I molecules. The effect of CD1d expression on C1R was not analyzed in those studies (15, 28). Another possibility could be a higher level of CD1d expression on our CD1d.C1R cells than the expression of CD1a–c in those C1R. However, our data show that CD1d can inhibit the lysis of L721.221 as well as C1R cells. This could suggest that the mechanisms (inhibitory receptors) governing CD1d-mediated inhibition can be different from those involved in CD1 type I molecules.

Most of CD8+ HVS-T cell lines have been shown to display NK-like cytotoxic activity, measured as the ability to efficiently kill the K562 cell line (23) (J. R. Regueiro, unpublished observations). We demonstrate in this study that these cells can also efficiently lyse L721.221 and C1R cell lines. Moreover, our data indicate that the NK-like HVS-T cytotoxicity can be inhibited by expression of CD1d, although the quantitative effect varies between different effector cell lines. The molecular and cellular basis of the NK-like activity of HVS-T cell lines is, to our knowledge, unknown. Our results indicate that these cell lines can be a good model to study mechanisms, such as inhibitory receptors involved in the NK cytotoxicity inhibition by CD1d, and perhaps other MHC-related molecules.

In every case, the lysis inhibition we observed was not complete, but it was specific because it can be reversed in experiments using specific mAbs for CD1d. Another way to study the specificity of the phenomenon is to analyze the effect of CD1d-specific ligands. In mice, some ligands have been described for CD1d1. Cellular glycosylphosphatidylinositol was identified as a major ligand of mouse CD1d1. CD1d1 binds glycosylphosphatidylinositol through its phosphatidylinositol aspect with high affinity (29). Phosphatidylinositol could play a chaperone-like role during the assembly of CD1d1 in vivo (30). It has been described as an autoreactive NKT clone (V{alpha}14J{alpha}15) that is specifically activated, upon recognition of phosphatidylinositol bound to mouse CD1d1 (31). In contrast, the murine T cell lymphoma line L5178-R is known to shed a tumor-associated glycolipid, gangliotriaosylceramide, into the culture medium. It has been found that this glycolipid was presented by CD1d1 and that it can inhibit CD1-specific stimulation of canonical (V{alpha}14+), but not noncanonical (V{alpha}5+) NKT cells (32). Phosphatidylethanolamine was also described as a natural Ag presented by CD1d1. An invariant NKT cell hybridoma (24.8.A) was activated by this Ag, and this activation was correlated with the degree of unsaturation of the acyl chains (33). The natural endogenous ligands of human CD1d are unknown. However, the capacity of CD1d to bind and present {alpha}-GalCer is very well known. For this reason, we decided to study the effect of this compound in our cytotoxicity assays. Pretreatment of target cells with {alpha}-GalCer seemed to abolish the protective effect of CD1d in our in vitro killing assays. Unexpectedly, the same phenomenon was observed when the target cells were pretreated with P-20, the vehicle in which {alpha}-GalCer was dissolved. The reasons for this are unknown. P-20 can augment the sensitivity of the target cells to the NK cell-mediated cytotoxicity. This is, however, unlikely because L721.221 cells pretreated with P-20 are killed with the same efficiency as the untreated targets. Another possibility is that P-20 may alter the nature of an endogenous ligand (maybe a lipid) of CD1d. This ligand could be involved in the interaction between CD1d and an inhibitory NK receptor. Of course, in this case, the effect of {alpha}-GalCer cannot be analyzed. In our cells, {alpha}-GalCer seems to be bound to CD1d, as demonstrated by the fact that CD1d.221 cells incubated with {alpha}-GalCer are more efficiently killed by NKT cells than untreated CD1d.221 cells. We thus decided to analyze the effect of {alpha}-GalCer dissolved in DMSO. In this case, no effect was observed with the vehicle (DMSO), but a decrease in the lysis inhibition was obtained in the presence of {alpha}-GalCer bound to CD1d, similar to that observed with {alpha}-GalCer dissolved in P-20.

We also use in our NK-mediated killing assays the related compound, {beta}-GalCer, which is dissolved in DMSO. Pretreatment of CD1d.221 target cells with {beta}-GalCer also abolishes the CD1d-mediated protective effect in the cytotoxicity tests. An explanation for our results could be that {beta}-GalCer and {alpha}-GalCer can displace an endogenous ligand for CD1d that could be important for the interaction between the NK inhibitory receptor and CD1d. This receptor could be unable to bind to CD1d loaded with {beta}-GalCer or {alpha}-GalCer. In this hypothesis, P-20 could have the effect suggested above, which would not occur when using DMSO as a solvent. This hypothesis could also explain our FACS analysis data in which CD1d tetramers loaded with {alpha}-GalCer did not bind to our effector cells. These results are in agreement with those from Gumperz et al. (24) and Ortaldo et al. (34) in which no NK cells were stained and only a fraction of T (NKT) cells was labeled by CD1d tetramers loaded with {alpha}-GalCer, and also with {beta}-GalCer (34).

A different effect has a bacterial lipid Ag presented by CD1b, mycolic acid from M. tuberculosis, which may be able to significantly augment the protection against NK cell lysis conferred by this CD1 protein (15). This lipid Ag was used in cytotoxic assays with all our target cells, and no effect was observed.

In summary, our data suggest that CD1d could interact with a NK inhibitory receptor in NK and HVS-T cells. This inhibitory receptor could interact with CD1d in a ligand-dependent way, and {beta}-GalCer and {alpha}-GalCer would act as antagonists of this ligand.

Our results are in agreement with those of the CD1d system in mice, although in this case, the effect of murine CD1d ligands was not analyzed. However, it was analyzed in the study of Carbone et al. (15), in which extracts from mycobacteria or the purified glucose monomycolate (ligands of type I CD1 molecules) led to an increase in the inhibition of NK killing.

The results presented in this work and those previously published by other groups strongly suggest the existence of inhibitory receptors for CD1 molecules in humans and mice. The identification of those receptors will clarify the important role of CD1 molecules in the immune response.


   Acknowledgments
 
We thank Dr. S. Porcelli for Abs against human CD1d molecules; Dr. M. López-Botet for NKL cell line and for helpful advice; Dr. J. R. Regueiro for HVS-transformed T cell lines; Dr. Jenny Gumperz for the CD1d tetramers; Fundación Jiménez Díaz blood bank for buffy coats; Kirin for {alpha}-GalCer; Hoffman-LaRoche and Dr. Craig W. Reynolds for rhIL-2; and Dr. Savage for {alpha}-GalCer dissolved in DMSO.


   Footnotes
 
1 This work was supported by a grant from Spanish Ministerio de Ciencia y Tecnología (BMC2001-1382) (to E.M.-N.). Y.C.-M. is the recipient of a predoctoral fellowship from Universidad Complutense. B.G.-L. is supported by a predoctoral fellowship from Spanish Ministerio de Educación y Cultura. Back

2 Address correspondence and reprint requests to Dr. Eduardo Martínez-Naves, Unidad de Inmunología, Facultad de Medicina, Universidad Complutense, Avenida Complutense s/n. 28040 Madrid, Spain. E-mail address: emnaves{at}med.ucm.es Back

3 Abbreviations used in this paper: {alpha}-GalCer, {alpha}-galactosylceramide; {beta}-GalCer, {beta}-galactosylceramide; HVS, Herpesvirus saimiri; LDH, lactate dehydrogenase; P-20, polisorbate 20; rhIL-2, human rIL-2. Back

Received for publication December 15, 2003. Accepted for publication April 7, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Moretta, A., C. Bottino, M. Vitale, D. Pende, C. Cantoni, M. C. Mingari, R. Biassoni, L. Moretta. 2001. Activating receptors and coreceptors involved in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19:197.[Medline]
  2. Karre, K., H. G. Ljunggren, G. Piontek, R. Kiessling. 1986. Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defense strategy. Nature 319:675.[Medline]
  3. Lanier, L. L.. 1998. NK cell receptors. Annu. Rev. Immunol. 16:359.[Medline]
  4. Lopez-Botet, M., M. Llano, F. Navarro, T. Bellon. 2000. NK cell recognition of non-classical HLA class I molecules. Semin. Immunol. 12:109.[Medline]
  5. Braud, V. M., D. S. Allan, C. A. O’Callaghan, K. Soderstrom, A. D’Andrea, G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, et al 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795.[Medline]
  6. Vance, R. E., J. R. Kraft, J. D. Altman, P. E. Jensen, D. H. Raulet. 1998. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b). J. Exp. Med. 188:1841.[Abstract/Free Full Text]
  7. Chiang, E. Y., M. Henson, I. Stroynowski. 2002. The nonclassical major histocompatibility complex molecule Qa-2 protects tumor cells from NK cell- and lymphokine-activated killer cell-mediated cytolysis. J. Immunol. 168:2200.[Abstract/Free Full Text]
  8. Hughes, A. L., M. Yeager, A. E. Ten Elshof, M. J. Chorney. 1999. A new taxonomy of mammalian MHC class I molecules. Immunol. Today 20:22.[Medline]
  9. Porcelli, S. A., R. L. Modlin. 1999. The CD1 system: antigen-presenting molecules for T cell recognition of lipids and glycolipids. Annu. Rev. Immunol. 17:297.[Medline]
  10. Porcelli, S. A.. 1995. The CD1 family: a third lineage of antigen-presenting molecules. Adv. Immunol. 59:1.[Medline]
  11. Zeng, Z., A. R. Castano, B. W. Segelke, E. A. Stura, P. A. Peterson, I. A. Wilson. 1997. Crystal structure of mouse CD1: an MHC-like fold with a large hydrophobic binding groove. Science 277:339.[Abstract/Free Full Text]
  12. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, et al 1997. CD1d-restricted and TCR-mediated activation of v{alpha}14 NKT cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  13. Kronenberg, M., L. Gapin. 2002. The unconventional lifestyle of NKT cells. Nat. Rev. Immunol. 2:557.[Medline]
  14. Chang, C. S., L. Brossay, M. Kronenberg, K. P. Kane. 1999. The murine nonclassical class I major histocompatibility complex-like CD1.1 molecule protects target cells from lymphokine-activated killer cell cytolysis. J. Exp. Med. 189:483.[Abstract/Free Full Text]
  15. Carbone, E., G. Terrazzano, A. Melian, D. Zanzi, L. Moretta, S. Porcelli, K. Karre, S. Zappacosta. 2000. Inhibition of human NK cell-mediated killing by CD1 molecules. J. Immunol. 164:6130.[Abstract/Free Full Text]
  16. Shimizu, Y., R. DeMars. 1989. Production of human cells expressing individual transferred HLA-A,-B,-C genes using an HLA-A,-B,-C null human cell line. J. Immunol. 142:3320.[Abstract]
  17. Edwards, P. A., C. M. Smith, A. M. Neville, M. J. O’Hare. 1982. A human-hybridoma system based on a fast-growing mutant of the ARH-77 plasma cell leukemia-derived line. Eur. J. Immunol. 12:641.[Medline]
  18. Exley, M., J. Garcia, S. P. Balk, S. Porcelli. 1997. Requirements for CD1d recognition by human invariant V{alpha}24+ CD4–CD8– T cells. J. Exp. Med. 186:109.[Abstract/Free Full Text]
  19. Kim, H. S., J. Garcia, M. Exley, K. W. Johnson, S. P. Balk, R. S. Blumberg. 1999. Biochemical characterization of CD1d expression in the absence of {beta}2-microglobulin. J. Biol. Chem. 274:9289.[Abstract/Free Full Text]
  20. Martinez-Naves, E., L. D. Barber, J. A. Madrigal, C. M. Vullo, C. Clayberger, S. C. Lyu, R. C. Williams, C. Gorodezky, T. Markow, M. L. Petzl-Erler, P. Parham. 1997. Interactions of HLA-B*4801 with peptide and CD8. Tissue Antigens 50:258.[Medline]
  21. Oteo, M., P. Arribas, F. Setien, J. F. Parra, I. Mirones, D. M. Gomez, E. Martinez-Naves. 2001. Structural characterization of two CD1A allelic variants. Hum. Immunol. 62:1137.[Medline]
  22. Robertson, M. J., K. J. Cochran, C. Cameron, J. M. Le, R. Tantravahi, J. Ritz. 1996. Characterization of a cell line, NKL, derived from an aggressive human natural killer cell leukemia. Exp. Hematol. 24:406.[Medline]
  23. Biesinger, B., I. Muller-Fleckenstein, B. Simmer, G. Lang, S. Wittmann, E. Platzer, R. C. Desrosiers, B. Fleckenstein. 1992. Stable growth transformation of human T lymphocytes by herpesvirus saimiri. Proc. Natl. Acad. Sci. USA 89:3116.[Abstract/Free Full Text]
  24. Gumperz, J. E., S. Miyake, T. Yamamura, M. B. Brenner. 2002. Functionally distinct subsets of CD1d-restricted natural killer T cells revealed by CD1d tetramer staining. J. Exp. Med. 195:625.[Abstract/Free Full Text]
  25. Brossay, L., M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, M. Kronenberg. 1998. CD1d-mediated recognition of an {alpha}-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.[Abstract/Free Full Text]
  26. Dascher, C. C., M. B. Brenner. 2003. Evolutionary constraints on CD1 structure: insights from comparative genomic analysis. Trends Immunol. 24:412.[Medline]
  27. Zemmour, J., A. M. Little, D. J. Schendel, P. Parham. 1992. The HLA-A,B "negative" mutant cell line C1R expresses a novel HLA-B35 allele, which also has a point mutation in the translation initiation codon. J. Immunol. 148:1941.[Abstract]
  28. Storkus, W. J., M. Wei, P. Cresswell, J. R. Dawson. 1996. Class I-like CD1A-C do not protect target cells from NK-mediated cytolysis. Cell. Immunol. 167:154.[Medline]
  29. Joyce, S., A. S. Woods, J. W. Yewdell, J. R. Bennink, A. D. De Silva, A. Boesteanu, S. P. Balk, R. J. Cotter, R. R. Brutkiewicz. 1998. Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science 279:1541.[Abstract/Free Full Text]
  30. De Silva, A. D., J. J. Park, N. Matsuki, A. K. Stanic, R. R. Brutkiewicz, M. E. Medof, S. Joyce. 2002. Lipid protein interactions: the assembly of CD1d1 with cellular phospholipids occurs in the endoplasmic reticulum. J. Immunol. 168:723.[Abstract/Free Full Text]
  31. Gumperz, J. E., C. Roy, A. Makowska, D. Lum, M. Sugita, T. Podrebarac, Y. Koezuka, S. A. Porcelli, S. Cardell, M. B. Brenner, S. M. Behar. 2000. Murine CD1d-restricted T cell recognition of cellular lipids. Immunity 12:211.[Medline]
  32. Sriram, V., S. Cho, P. Li, P. W. O’Donnell, C. Dunn, K. Hayakawa, J. S. Blum, R. R. Brutkiewicz. 2002. Inhibition of glycolipid shedding rescues recognition of a CD1+ T cell lymphoma by natural killer T (NKT) cells. Proc. Natl. Acad. Sci. USA 99:8197.[Abstract/Free Full Text]
  33. Rauch, J., J. Gumperz, C. Robinson, M. Skold, C. Roy, D. C. Young, M. Lafleur, D. B. Moody, M. B. Brenner, C. E. Costello, S. M. Behar. 2003. Structural features of the acyl chain determine self-phospholipid antigen recognition by a CD1d-restricted invariant NKT (iNKT) cell. J. Biol. Chem. 278:47508.[Abstract/Free Full Text]
  34. Ortaldo, J. R., H. A. Young, R. T. Winkler-Pickett, E. W. Bere, Jr, W. J. Murphy, R. H. Wiltrout. 2004. Dissociation of NKT stimulation, cytokine induction, and NK activation in vivo by the use of distinct TCR-binding ceramides 1. J. Immunol. 172:943.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Campos-Martin, M. Colmenares, B. Gozalbo-Lopez, M. Lopez-Nunez, P. B. Savage, and E. Martinez-Naves
Immature Human Dendritic Cells Infected with Leishmania infantum Are Resistant to NK-Mediated Cytolysis but Are Efficiently Recognized by NKT Cells
J. Immunol., May 15, 2006; 176(10): 6172 - 6179.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Maeda, C. Carpenito, R. C. Russell, J. Dasanjh, L. L. Veinotte, H. Ohta, T. Yamamura, R. Tan, and F. Takei
Murine CD160, Ig-Like Receptor on NK Cells and NKT Cells, Recognizes Classical and Nonclassical MHC Class I and Regulates NK Cell Activation
J. Immunol., October 1, 2005; 175(7): 4426 - 4432.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
J. M. Martin-Fernandez, J. A. Cabanillas, M. Rivero-Carmena, E. Lacasa, J. Pardo, A. Anel, P. R. Ramirez-Duque, F. Merino, C. Rodriguez-Gallego, and J. R. Regueiro
Herpesvirus saimiri-transformed CD8+ T cells as a tool to study Chediak-Higashi syndrome cytolytic lymphocytes
J. Leukoc. Biol., May 1, 2005; 77(5): 661 - 668.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campos-Martín, Y.
Right arrow Articles by Martínez-Naves, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campos-Martín, Y.
Right arrow Articles by Martínez-Naves, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS