| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
Departments of
*
Medicine and
Microbiology and Immunology, Dartmouth Medical School, Lebanon, NH 03756;
Veterans Affairs Medical Center, White River Junction, VT 05009; and
Baylor Institute for Immunology Research, Dallas, TX 75204
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mRNA stability and is the only trans-acting factor shown to be capable of regulating AU-rich element-dependent mRNA turnover at the level of the intact animal. Using the THP-1 myelomonocytic cell line, we demonstrated for the first time that TTP is encoded by an mRNA with a short half-life under resting conditions. Using pharmacologic inhibitors of the mitogen-activated protein kinase pathways, we show that the induction of TTP by LPS activation is mediated through changes in transcription, mRNA stability, and translation. A coordinate increase in both TTP and TNF- mRNA stability occurs within 15 min of LPS treatment, but is transduced through different mitogen-activated protein kinase pathways. This regulation of TTP and TNF- mRNA stability is associated with the finding that TTP binds these mRNA under both resting and LPS-activated conditions in vivo. Finally, we demonstrate that TTP can regulate reporter gene expression in a TTP 3' untranslated region-dependent manner and identify three distinct AU-rich elements necessary to mediate this effect. Thus, TTP regulates its own expression in a manner identical to that seen with the TNF- 3' untranslated region, indicating that this autoregulation is mediated at the level of mRNA stability. In this manner, TTP is able to limit the production of its own proteins as well as that of TNF- and thus limit the response of the cell to LPS. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is an inflammatory cytokine expressed by lymphocytes and macrophages and is a critical mediator of inflammation. Activation of macrophages results in a 10,000-fold increase in TNF- biosynthesis with only a 3-fold increase in transcription (1, 2). Thus, the expression of TNF- is primarily regulated at the level of mRNA stability and translation (1, 2) with control of both message stability and translation mediated through the TNF- ARE (2).
The zinc finger protein tristetraprolin (TTP), also know as Nup475, TIS11, G0S24, ZFP36, was originally identified on the basis of its rapid induction in response to a variety of stimuli (3, 4, 5, 6, 7). Subsequently, the generation of TTP-deficient mice elucidated the central role of TTP in mediating TNF- mRNA instability in macrophages (8). Mice that lack TTP spontaneously develop erosive arthritis, cachexia, alopecia, dermatitis, autoantibodies, and myeloid hyperplasia. Administration of anti-TNF- Abs prevents the phenotype, indicating the pathogenic role of this cytokine (8). Macrophages derived from the TTP knockout mice produce enhanced levels of TNF- mRNA (2-fold) and protein (5-fold) in response to LPS stimulation (9). This increase in TNF- biosynthesis by TTP-deficient mice is due to increased TNF- mRNA stability (10). Further studies revealed that TTP binds directly to the TNF- mRNA 3'UTR ARE in vitro (10, 11), thereby establishing TTP as a trans-acting factor that binds to the TNF- 3'UTR ARE to increase its rate of mRNA turnover.
Mutations of TTP that abolished binding to the TNF- mRNA 3'UTR ARE (10, 11) were associated with an inability to reduce TNF- mRNA levels when cotransfected into 293 cells. Using this cell system, it was shown that the ability of human TTP expression to reduce luciferase reporter gene expression required the TNF- mRNA 3'UTR ARE. In these same studies, a direct in vivo interaction between TTP and luciferase mRNA was dependent on the TNF- mRNA 3'UTR (12). These data establish that TTP directly interacts with the TNF- mRNA 3'UTR ARE to increase mRNA turnover.
These studies demonstrate the importance of TTP in regulating the expression of TNF-. It has been previously shown that TTP is up-regulated in response to LPS stimulation of monocyte/macrophage cells and cell lines (10, 12, 13, 14, 15, 16). Moreover, LPS treatment has been shown to induce TTP expression in myeloid cells in vivo (17). Despite these studies, there is little or no understanding of the mechanism of the rapid induction of TTP by LPS, let alone the pathways regulating its transient expression (10).
We examined the induction of TTP biosynthesis by LPS in the human myelomonocytic cell line THP-1. Based on the striking parallels between the LPS-mediated induction of TNF- and TTP biosynthesis in human and murine macrophages (10, 17), we predicted that this induction would be coordinately regulated at the posttranscriptional level by specific mitogen-activated protein kinase (MAPK) signaling pathways. Like TNF-, the induction of TTP that accompanies LPS stimulation requires the presence of functionally active p38, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) pathways. However, substantive differences in the role of specific MAPK pathways were observed. In contrast to TNF- mRNA, the p38 pathway played no role in the stabilization of TTP mRNA that accompanied LPS stimulation. Activation of the ERK pathway was necessary for the rapid stabilization of TTP mRNA triggered by LPS stimulation, which had no effect on TNF- mRNA stability. Thus, while both TTP and TNF- mRNA are stabilized by LPS stimulation, the stabilization occurs through distinct signaling pathways in the same cell. Despite these distinctions, interesting parallels in the TTP-dependent regulation of mRNA stability were discovered. Immunoprecipitation demonstrated that TTP bound to both TNF- and TTP mRNA in vivo in both unstimulated and LPS-stimulated THP-1 cells. Furthermore, we demonstrated that TTP expression regulated reporter gene expression in a TTP 3'UTR-dependent manner, as previously observed with the TNF- 3'UTR. The cis-acting elements through which TTP mediated its effects were localized to three functionally independent AREs clustered between nucleotides 1466–1557 in the TTP-3'UTR.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
LPS (Escherichia coli 026:B6), actinomycin D (ActD), and DMSO were purchased from Sigma-Aldrich (St. Louis, MO). SB202190 (SB), PD98059 (PD), SP600125 (JK) were purchased from Calbiochem (La Jolla, CA). GAPDH 6C5 Ab was purchased from American Research (Beltsville, MD). Oligonucleotides were purchased from Operon Technologies (Alameda, CA).
Cell lysis and immunoblotting
Cytoplasmic preparations were performed as previously described using a method characterized for its lack of contamination by nuclear proteins (12, 18). Cytoplasmic lysates were prepared by washing the cells twice in ice-cold PBS. All reagents and subsequent steps were used at 4°C. The cells were lysed by gentle resuspension in 1% Triton X-100 lysis buffer (50 µl, 2 x 107 cells) containing 10 mM PIPES (pH 6.8), 100 mM KCl, 2.5 mM MgCl2, 300 mM sucrose, 1 mM pefabloc, and 2 µg/ml each of leupeptin and pepstatin A before a 3-min incubation followed by a 3-min centrifugation at 500 x g. The supernatant was aliquoted and stored at –80°C as the cytoplasmic fraction. The pellet was gently resuspended in lysis buffer and spun through a 30% sucrose cushion twice. The nuclear pellet was gently resuspended with 0.5 vol of nuclei pellet of low salt buffer containing 10 mM Tris-HCl (pH 7.6), 20 mM KCl, 1.5 mM MgCl2, 0.5 µM DTT, 0.2 mM EDTA, 25% glycerol, 2 mM pefabloc, and 1 µg/ml each of leupeptin and pepstatin A. While vortexing gently, 1.5 vol nuclei pellet of high salt buffer (identical with the low salt buffer except for the presence of 0.5 M KCl) was added dropwise. Samples were gently rocked for 30 min before centrifuging at 12,000 x g for 30 min. The supernatant was aliquoted and stored at –80°C as the nuclear fraction.
For immunoblotting, cytoplasmic, nuclear, and immunoprecipitates were boiled in loading buffer (50 mM Tris-HCl, pH 6.8, 100 mM DTT, 2% SDS, 0.1% bromphenol blue, 10% glycerol) for 3 min, resolved by 12% SDS-PAGE, then electrotransferred to nitrocellulose. Immunoblotting was performed with the following Abs as indicated: CARP-3 anti-TTP Ab, anti-GAPDH Ab 6C5. Immunoblot band intensity was calculated using NIH Image and normalized TTP expression was calculated using the formula (TTP signal/GAPDH signal) for each sample.
Immunoprecipitation (IP) and RNA isolation
For IPs, cells (2 x 108) were washed three times with 1x PBS and resuspended in 3.5 ml of buffer A (10 mM Tris-HCl, pH 7.6, 1 mM KAc, 1.5 mM MgAc, 2 mM DTT, 1 µg/ml pepstatin A, 1 µg/ml leupeptin, 1 mM pefabloc). Cells were lysed by 20 strokes with a Teflon pestle homogenizer at 1500 rpm, centrifuged at 12,000 x g for 10 min to pellet the nuclei, and labeled IP lysate. Antisera against aa 302–328 of human TTP (CARP-3) were raised by immunizing rabbits as previously described (12). Affinity purified CARP-3, or CARP-3 preimmune serum were bound to 3-mg swollen protein A-Sepharose beads by incubating overnight at 4°C with continuous rotation in IP buffer (10 mM Tris-HCl, pH 7.6, 1.5 mM MgCl2, 100 mM NaCl, 0.5% Triton X-100, 1 mM pefabloc, and 1 mg/ml pepstatin A). The beads were then washed three times with 500 µl of IP buffer and 5 mg of IP lysate were incubated in IP buffer with continuous rotation for 2 h at 4°C first with the preimmune serum-bound beads, followed by 2 h at 4°C with the CARP-3 Ab-bound beads. Following IP, the beads were pelleted, and washed six times with IP buffer. RNA was isolated from each immunoprecipitate by TRIzol (Invitrogen, Carlsbad, CA) and then half of the isolated RNA was reverse transcribed with an oligo(dT) 20-mer, using Superscript II reverse transcriptase (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol and then analyzed by RT-PCR using the real-time PCR primers listed below.
Cell treatment and real-time PCR
THP-1 cells were treated with the indicated MAPK inhibitor or DMSO for 5 min followed by LPS (1 µg/ml) for 15 min, except DMSO alone, which was not treated with LPS. Following 15 min of LPS pretreatment ActD was added to a final concentration of 5 µg/ml at time 0. Total RNA was isolated using TRIzol (Invitrogen) and poly(A)+ mRNA was isolated using the Oligotex mRNA mini kit (Qiagen, Valencia, CA). mRNA was quantified by spectrophotometry and diluted to 10 ng/µl. Reverse transcription was performed using Superscript II (Invitrogen), 100 ng of mRNA, and oligo(dT) according to the manufacturer’s protocol. Following reverse transcription, the reaction was diluted 1/5 with nanopure water.
For real-time PCR, a master mix was made from the 10x SYBR Green PCR Core Reagent kit (Applied Biosystems, Foster City, CA) (2.5 µl of 10x SYBR buffer, 3 µl of 25 mM MgCl2, 2 µl of dNTP Mix with dUTP, 0.125 µl of AmpliTaq Gold (5 U/µl). A primer master mix was then made using 7.625 µl of master mix, 25 pmol of each primer, and nanopure water to 20 µl). Each real-time reaction well received 20 µl of primer mix and 5 µl of sample for a final volume of 25 µl. Each experimental reaction was performed in triplicate and each loading control, serial dilution, and negative control reaction was performed in duplicate. Serial dilutions consisted of 10-fold dilutions of a previously amplified copy of the message being tested (TTP, TNF, GAPDH, actin) with four points used for each serial dilution. The four dilution points were determined empirically to cover the range of expression of the gene being tested. Negative controls included water alone as well as 100 ng of non-reverse transcribed mRNA from the zero time point or half of the immunoprecipitated RNA. Samples were run in 96-well amplification plates, with a two-step reaction 95°C for 15 s, 64°C for 1 min for 40 cycles; each run was preceded by a 95°C incubation for 8 min to remove the hotstart Ab from the AmpliTaq Gold and followed by a melt analysis. Primers are as follows: TNF sense, GGACACCATGAGCACTGAAAGC; TNF antisense, TGCCACGATCAGGAAGGAGAAG; TTP sense, TCGGGACCCTGGAGCCTGAG; TTP antisense, AGCCAGCGGTGCGAAGCC; GAPDH sense, CCATCACTGCCACCCAGAAGAC; GAPDH antisense, ATGACCTTGCCCACAGCCTTG; actin sense, CAAGCAGGAGTATGACGAGT; actin antisense, TGTCAAGAAAGGGTGTAACG.
All primer sets had efficiencies of 100% (±10%) and each primer efficiency was within 10% of the other primers. The correlation coefficient for each dilution series was >0.95. Equal loading of RNA was calculated from the actin signal using the formula (actin concentration at time X/actin concentration at time 0). The percent of remaining TTP mRNA was calculated from the actin-corrected TTP concentration using the formula [(TTP concentration time X/normalized actin signal time X)/(TTP concentration time 0/normalized actin signal time 0)] x 100, for each sample condition time point.
Generation of TTP and luciferase vector constructs
Orientation of the cDNA inserts and the integrity of the DNA sequences were confirmed by sequencing using the ABI Prism Dye Terminator Cycle Sequencing kit (PerkinElmer, Wellesley, MA), and searched against the published sequence, TTP accession no. M63625, on the National Center for Biotechnology Information database using the basic local alignment search tool search program (12, 19). The pcDNA 3.1 His-C-TTP (TTP) expression construct (CMV promoter) was generated as previously described (12). The pGL3 luciferase constructs (SV40 promoter) contain different components of the human TTP 3'UTR as follows: TTP-3'UTR, nucleotides 991–1683; TTP 991–1477, nucleotides 991–1477 lacking the ARE; TTP-1480–1684, nucleotides 1480–1684 contain the ARE; TTP-ARE, nucleotides 1466–1557, each cloned into the XbaI site in the pGL3-C 3'UTR. TTP-3'UTR and TTP-ARE fragments were generated by PCR using primers corresponding to the 20 nucleotides at each end of the fragment and flanked by an XbaI site. Digesting the TTP 3'UTR with XbaI and ApaI and subcloning the resulting fragments generated the TTP 991–1477 and TTP-1480–1684. Finally, TTP 3'UTR point mutant constructs were generated using the Quick-Change Site Directed Mutagenesis kit (Stratagene, La Jolla, CA) of the TTP 3'UTR construct. These mutants change the central A to a G of one or a combination of the three-pentamer sequence contained in the TTP ARE: M-1, first pentamer nucleotide 1486 A to G; M-2, second pentamer nucleotide 1501 A to G; M-3, third pentamer nucleotide 1526 A to G; M-1-2, the first and second pentamers mutated as above; M-1-3, the first and third pentamers mutated as above; M-2-3, the second and third pentamers mutated as above; TTP M-1-2-3, all three pentamers mutated as above.
Transient transfections and luciferase assays
HEK 293 cells were plated at a density of 300,000 cells per well in six-well plates, with RPMI 1640 supplemented with 10% FCS and 85 ng/ml gentamicin. Each well received the following: 1 µg of pGL3 luciferase vector and varying concentrations of pcDNA 3.1 His C-TTP (from 0 to 100 ng) with the difference in DNA transfected made up with the pcDNA3.1 His-C parental for a total of 1 µg in 100 µl of total, serum-free RPMI 1640 media. The DNA mixture was mixed with 4 µl of lipofectamine reagent (Life Technologies) in 100 µl of serum-free RPMI 1640, and incubated at 22°C to 25°C for 20 min following which 800 µl of serum-free media were added and the mixture placed over the cells. After 3 h, an equal volume of RPMI 1640 supplemented with 20% FCS media was added. Transfections for luciferase assays were performed in triplicate in six-well plates and each vector was used in at least three experiments. Cells were lysed 24 h after serum addition in 100 µl of 1x lysis buffer, and 20 µl of each sample was read in a luminometer according to the manufacturer’s protocol. Luciferase values were normalized for each luciferase vector with the formula [(X ng of TTP transfection/0 ng of TTP transfection) x 100].
Statistics
ANOVA was performed for each data set, followed by individual comparisons using a t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We examined the effect of LPS stimulation (1 µg/ml 2 h) on TTP protein levels in THP-1 cells. As reported, LPS treatment stimulates an increase in TTP (43 kDa) expression in THP-1 cells (10, 12, 13, 14, 15, 16, 17) (Fig. 1). Previous studies of LPS induction of TTP in THP-1 cells demonstrate peak expression at 2 h (17). Similar kinetics of TTP induction were seen in monocytes and neutrophils in response to in vivo LPS administration, with peak expression at 1–2 h (17). The interaction of LPS with the Toll-like receptor 4 activates the MAPK signaling pathways, each of which play discrete roles in TNF- biosynthesis (20). The contribution of the p38, ERK, and JNK pathways to the LPS-mediated induction of TTP and TNF- was compared using, specific, well-characterized pharmacologic inhibitors. THP-1 cells were preincubated with SB202190 (1 µM) (21), PD98059 (20 µM) (22), or SP600125 (20 µM) (23) for 5 min before LPS addition (Fig. 1). Each agent markedly reduced the LPS-mediated increase in TTP protein expression, becoming apparent after 60–120 min. Identical results were obtained whether the THP-1 cells were treated with the inhibitors for 5 or 30 min before LPS addition, and no loss of cell viability was observed at any time point in the experiment. Inhibition of the p38 and JNK pathways each markedly lowered TTP protein levels at 60 and 120 min time 0. Inhibition of the ERK pathway by treatment with PD98059 blunted the LPS-dependent increase in TTP expression, such that TTP expression was 30% lower at 120 min.
|
The rapid rise in TTP expression following various stimuli, including LPS, a pattern associated with rapidly degraded mRNAs like TNF- and c-Fos (24), prompted consideration that posttranscriptional mechanisms played a major role in its expression (5, 10). In addition, the TTP 3'UTR (Fig. 2) contains multiple polyuridine and ARE sequences that are associated with rapid mRNA turnover (25).
|
mRNA stability was observed (Fig. 3A), indicating that the stability of both TTP and TNF- mRNA is increased by LPS stimulation.
|
mRNA stability (Fig. 3B). The opposite relationship was observed with inhibition of the p38 pathway. Treatment with the specific p38 inhibitor, SB202190, had no effect on TTP mRNA stability (Fig. 3C), while blunting the increase in TNF- mRNA stability (Fig. 3C) triggered by LPS treatment.
These data indicate that LPS-mediated increases in TTP and TNF- mRNA stability are transduced through discrete signaling pathways activated by the same stimulus in the same cell. In contrast, pharmacologic inhibition of the JNK pathway (SP600125, 20 µM final) had no effect on either TTP (Fig. 3D) or TNF- (Fig. 3D) mRNA stability, a novel finding given the recent availability of the JNK inhibitor (23). The differing patterns of modulation of TTP and TNF- mRNA stability seen with these inhibitors is consistent with their exerting selective and specific effects under the conditions used in these studies. In a similar vein, our observations on TNF- mRNA turnover confirm previous work demonstrating that p38, but not ERK, inhibition alters LPS-mediated stabilization of the TNF- message in THP-1 cells (26).
Additionally, we assessed the changes in TTP mRNA levels as a function of LPS activation, by comparing the amount of TTP message present at time 0 of the real-time PCR studies. Analysis of the data in this manner allowed us to determine the contribution of the ERK, p38, and JNK signals to changes in TTP mRNA levels triggered by LPS treatment (Fig. 3E). Because TTP is induced by TNF- alone (10, 17), and these MAPK inhibitors can block TNF- biosynthesis, we minimized this potential confounding effect by examining changes in TTP mRNA stability after only 15 min of LPS stimulation in the absence or presence of MAPK inhibitors (Fig. 3E). LPS activation alone resulted in a 40% increase in TTP mRNA compared with unstimulated cells. This increase in TTP mRNA was abolished by p38 inhibition. In contrast, JNK inhibition had no effect on steady state levels of TTP mRNA levels, while PD98059 treatment reduced TTP mRNA levels to an intermediate degree.
TTP binds TTP and TNF- mRNA in vivo
With the demonstration that TTP and TNF- mRNA turnover were coordinately regulated by LPS activation, we examined whether TTP protein might be implicated in an autoregulatory process similar to its effects on TNF- mRNA. We previously demonstrated that TTP interacted with the luciferase reporter mRNA in a TNF- 3'UTR-dependent manner in vivo in transfected 293 cells (12). Using resting and LPS-activated (1 µg/ml, 2 h) THP-1 cells, we established the interaction of TTP with native TNF- mRNA in vivo by IP and RT-PCR (35 cycles) (Fig. 4). Similarly, we demonstrated the interaction of TTP protein with its own mRNA in vivo (35 cycles) (Fig. 4). Thus, TTP interacts with both TTP and TNF- mRNA in monocytic cells in vivo. Because TTP regulates TNF- mRNA turnover, the rapid degradation of TTP mRNA along with its interaction with TTP protein suggest a causal relationship.
|
Using an in vivo model (293 cell line) system, we previously established that the effects of TTP on the expression of a luciferase reporter construct were conferred by the ARE found in the TNF- 3'UTR (12). The same approach was used to examine the potential for TTP to regulate its own expression in a 3'UTR-dependent manner. Using pGL3-C luciferase constructs containing different portions of the TTP 3'UTR (Table I), the effect of cotransfection of 293 cells with various amounts of our TTP expression construct (lacking the TTP 3'UTR) on luciferase expression was examined (Fig. 5). Cotransfection of TTP reduced luciferase activity from vectors containing the full-length TTP 3'UTR. The pattern, dose dependency, and magnitude of this effect of TTP expression was similar to that seen with the TNF- 3'UTR (12). Nearly identical results were obtained using the 3' end of the TTP 3'UTR containing the terminal 0.2 kb (nucleotides 1480–1684), as well as the TTP ARE alone (nucleotides 1466–1557). In contrast, TTP expression increased luciferase activity from either the pGL3 control construct, as previously reported (12), or that containing the 5' end of the TTP 3'UTR (nucleotides 991-1479). Because these reporter constructs are identical, including their promoters, except for the 3'UTR, these data suggest that nucleotides 1466–1557 are necessary and sufficient for TTP regulation of the TTP mRNA.
|
|
AUGUA) were generated in the context of full-length TTP 3'UTR (Fig. 6A). Because in vitro binding studies of TTP favored AUUUA sequences in uridine-rich contexts (27, 28), only AUUUA sequences between nucleotides 1466–1557 were targeted. A single UG mutation in the M-1, M-2, and M-3 AREs did not alter the TTP-mediated inhibition of luciferase expression (data not shown). Similarly, vectors containing two mutations (M-1-2, M-1-3, and M-2-3) in the context of the TTP 3'UTR, did not abolish the ability of TTP to reduce luciferase expression (Fig. 6B). Only mutation of each AUUUA sequence between nucleotides 1466–1557 (M-1-2-3) resulted in the loss of TTP-mediated reduction of luciferase activity. Because the effect of these three nucleotide changes is seen in the context of the full-length, 693 nucleotide TTP 3'UTR, these data indicate that the autoregulation of TTP mRNA stability requires at least one of these cis-acting elements.
|
A recent study demonstrated that TNF- mRNA contains an additional, non-ARE cis-acting element in its 3'UTR that contributes to its rapid mRNA turnover (29). With identification of the cis-acting element necessary to regulate TTP-dependent changes in expression, we compared the effects of these mutations on luciferase expression in the absence of TTP cotransfection (Fig. 7). The presence of the entire TTP 3'UTR reduced luciferase expression by nearly 75%. In contrast, the presence of nucleotides 1466–1557 that contain the TTP-responsive cis-acting element resulted in only 44% inhibition. The TTP 3'UTR mutant that lacks TTP responsiveness exhibited similar levels of inhibition (39%) in the absence of TTP cotransfection. These data indicate that the TTP 3'UTR, as with the TNF- 3'UTR, contains additional, TTP-independent cis-acting element(s). The exact nature and location of this element(s) remains to be determined.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) are stabilized by distinct signaling pathways in response to the same stimulus (LPS). Adding to this complexity, we present evidence that TTP regulates its own expression in a 3'UTR-dependent manner, similar to its regulation of TNF-. The role of MAPK pathways in the induction of TTP expression by LPS
Using specific pharmacologic inhibitors, we confirmed the contributions of the ERK, p38, and JNK pathways on the regulation of TNF- mRNA expression by LPS in THP-1 cells. Inhibition of the p38 pathway blocked the rapid stabilization of TNF- mRNA, consistent with prior studies (2, 26). In contrast, ERK and JNK inhibition had no effect on TNF- mRNA stability (2, 26, 31). These effects were not affected by the duration (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) of preincubation of the inhibitor before LPS addition. The similarity of these observations to those made using both pharmacologic and molecular approaches (2, 26) indicates that these effects were attributable to their selective inhibitory effects on specific MAPK pathways.
The increase in TTP protein in response to LPS has been demonstrated in both tissue culture conditions as well as in vivo (10, 12, 13, 14, 15, 16, 17). Immunoblotting indicated that, like TNF-, each of the MAPK signaling pathways contributes to the LPS induction of TTP expression. The effect of p38 inhibition on TTP protein and mRNA has been previously reported but the mechanism was uncharacterized (10, 12, 13, 14, 15, 16, 17). Despite containing a 3'UTR ARE, TTP mRNA induction by LPS was reduced by p38 inhibition without a discernable effect on mRNA turnover, suggesting a transcriptional effect, as seen with IL-1
(26, 32).
There are no previous studies examining the role of the JNK pathway on TTP expression. Pharmacologic inhibition of the JNK pathway blocked the induction of TTP by LPS without altering mRNA levels or turnover. This effect on TTP and TNF- mRNA is identical to that seen with studies of the role of JNK activation on TNF- biosynthesis, which we independently confirm (33, 34). These data suggest that LPS activates the JNK pathway to use translational mechanisms to enhance both TNF- and TTP expression. Further work is required to demonstrate this conclusively.
Surprisingly, ERK inhibition by PD98059 resulted in a loss of LPS-mediated stabilization of the TTP mRNA. This is in contrast to the effect of ERK inhibition on TNF- biosynthesis, which act at the level of ARE-dependent nuclear export (31). In addition to TTP, the ERK pathway has been shown to regulate the stability of other mRNA including IL-6 and natural resistance-associated macrophage protein (35, 36). Our observations that both ERK and p38 pathways selectively stabilize different ARE-containing mRNAs in the same cell, in response to the same stimuli, demonstrate the complexity of ARE-dependent gene expression. This intricacy has been clearly demonstrated in mice lacking an intact p38 signaling pathway in which TNF- and IL-6 mRNA are differentially regulated (27).
Functional mapping and characterization of the interaction of TTP with its 3'UTR ARE
With the demonstration that TTP interacts with both TNF- and TTP mRNA in vivo, we examined whether TTP might regulate its own expression. The ability of TTP to modulate reporter gene expression in a TTP 3'UTR-dependent manner localized to three AUUUA type AREs located between nucleotides 1466–1557. Mutation of these AREs to AUGUA resulted in the loss of TTP to modulate TTP 3'UTR-dependent luciferase expression. These AREsshare a core UAUUUAU (UUAUUUAUG, UUAUUUAUU, GUAUUUAUA) sequence. Each ARE functioned as an independent cis-acting element where TTP expression inhibited reporter gene expression. Mutation of all three ARE resulted in loss of TTP responsiveness, despite retention of polyuridine-rich and ARE (AUUUA) sequences 5' and 3' to, as well as within (AUUUUA) this region.
This specificity of TTP for these ARE is consistent with prior studies in which TTP binding exhibits a clear preference for adenine-uridine rich sequences over polyuridine sequences (37). Similarly, systematic evolution of ligands by exponential enrichment identified the nonamer UUAUUUAUU (as seen in ARE-2) as the consensus sequence, but UUAUUUAUG (ARE-1) was also seen (28). The activity of ARE-3 (GUAUUUAUA) as a TTP binding site would not have been predicted from these studies. This functional analysis indicates that the ability of TTP to bind and regulate ARE function is restricted to the ARE containing the sequences NUAUUUAUN, in which T, G, or A can be tolerated at the first and ninth position. This model accounts for the lack of TTP responsiveness seen with the retained AREs(AUAUUUAAG, AUAUUUAGU) in the M-1-2-3 triple mutant. This does not rule out that these ARE may function through non-TTP trans-acting factors. Rather, these data suggest a predictive model for gauging the TTP responsiveness of the numerous mRNAs identified in the ARE database (38, 39).
The independent activity of each ARE is consistent with the finding that the tandem zinc finger domain of TTP exhibits a 9-nucleotide footprint with UUAUUUAUU with two molecules capable of binding a 19-nucleotide sequence (10, 40). Because the minimum distance spanning any of the functionally active ARE in the 1466–1557 region is 24 bases, their independent regulation by TTP is consistent with the binding of an individual TTP protein. By extension, our mutational analysis indicates that TTP can bind monomerically to an ARE to influence 3'UTR-dependent reporter gene expression. This finding prompts the question of why UUAUUUAUU frequently exist in a reiterated context; is the effect of TTP on mRNA stability magnified by the binding of multiple molecules? Alternatively, does the presence of multiple ARE enhance the likelihood of TTP binding under limiting conditions or enable other trans-acting factors to bind?
Model of TTP function
Regulation of TTP and TNF- mRNA stability appears to share common and discrete elements. Although TTP regulates both TNF- and TTP expression through specific 3'UTR ARE, different signaling pathways regulate TTP and TNF- mRNA turnover. These data suggest that the differential regulation of TTP and TNF- mRNA stability may not always target the same cis-acting elements, consistent with the additional pathways of mRNA turnover that we have shown for TTP and has recently been shown for TNF- (29). An alternative possibility is that the consequence of TTP binding to a specific mRNA is regulated by the phosphorylation of other proteins that interact with TTP or the mRNA (or both) to mediate mRNA decay.
Thus, while TTP is phosphorylated in response to LPS activation in murine macrophages (14, 16, 41, 42, 43), these posttranslational modifications do not obviously influence its ARE-binding activity. Phosphorylation of rTTP by ERK, p38, and JNK did not alter ARE binding (14, 16, 41, 42, 43) suggesting the affinity of TTP for an ARE may not be affected by LPS activation, consistent with our in vivo binding experiments. These observations suggest that TTP may mediate both functions by serving as an "adaptor" protein to regulate ARE-dependent mRNA expression. In this model, TTP binds specific AREs in a constitutive manner in macrophages, while the functional consequences of this interaction (rates of mRNA deadenylation or degradation) are determined by its interaction with other proteins which are regulated through the phosphorylation events that occur following LPS activation (44). Consistent with this model is the recent report by Stoecklin (45) which suggests that TTP function may be regulated through its interaction with 14-3-3 proteins. This model may explain why TTP, although present, does not regulate TNF- mRNA stability in T cells (8). A corollary of this model is that the rapid induction of TTP mRNA and protein that accompanies macrophage activation provides cells with adequate levels of TTP to modulate the expression of the massive increase in ARE-containing mRNA.
In closing, our data indicate that in human macrophages, TTP binds to the TNF- and TTP mRNA through their 3'UTR, leading to the ARE-dependent mRNA turnover under resting conditions. TTP and TNF- expression are rapidly up-regulated by LPS stimulation, although the coordinate increase in their mRNA stability appears to be transduced by separate MAPK pathways. The interaction of TTP with these mRNA in vivo is not obviously affected by activation. These data suggest that LPS-dependant changes in TTP "function," at least in terms of mediating mRNA stability, are mediated downstream to ARE binding, perhaps through interactions with other proteins that are regulated by phosphorylation. Upon removal or degradation of the activation signal, TTP shuts down its own expression as well as that of TNF- by destabilizing the mRNA of each, contributing to the return to a resting nonactivated state.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Seth A. Brooks, Veterans Affairs Medical Center, Research (151), 215 North Main Street, White River Junction, VT 05009. E-mail address: seth.brooks{at}dartmouth.edu
3 Abbreviations used in this paper: ARE, AU-rich element; UTR, untranslated region; TTP, tristetraprolin; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; ActD, actinomycin D; IP, immunoprecipitation.
Received for publication December 9, 2003. Accepted for publication April 5, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in the syndrome of cachexia, arthritis, and autoimmunity resulting from tristetraprolin (TTP) deficiency. Immunity 4:445.[Medline]
overproduction. J. Clin. Invest. 100:986.[Medline]
production by tristetraprolin. Science 281:1001. mRNA. Mol. Cell. Biol. 19:4311. mRNA stability in human peripheral blood cells after lipopolysaccharide stimulation. Eur. Cytokine Network 13:92.[Medline]
mRNA stability. Mol. Cell. Biol. 21:6461. mRNA remains unstable and hypoadenylated upon stimulation of macrophages by lipopolysaccharides. Eur. J. Biochem. 267:6004.[Medline]
(TNF-) mRNA induction: evidence for selective destabilization of TNF- transcripts. J. Biol. Chem. 276:6666. mRNA degradation via an AU-rich element-independent pathway. Mol. Cell. Biol. 23:3506. induction by LPS is regulated posttranscriptionally via a Tpl2/ERK-dependent pathway. Cell 103:1071.[Medline]
transcription. J. Immunol. 162:5367. (TNF-) translation: glucocorticoids inhibit TNF- translation by blocking JNK/SAPK. Mol. Cell. Biol. 17:6274.[Abstract]
-induced stabilization of interleukin-6 mRNA in human pancreatic myofibroblasts. Biochim. Biophys. Acta 1591:69.[Medline]
mRNA and serve as a substrate for mitogen-activated protein kinases. Arch. Biochem. Biophys. 412:106.[Medline]
Related articles in The JI:
This article has been cited by other articles:
|
|
 |
|
  H. Takada, T. Kawana, Y. Ito, R. F. Kikuno, H. Mamada, T. Araki, H. Koga, M. Asashima, and M. Taira The RNA-binding protein Mex3b has a fine-tuning system for mRNA regulation in early Xenopus development Development, July 15, 2009; 136(14): 2413 - 2422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Emmons, W.H. D. Townley-Tilson, K. M. Deleault, S. J. Skinner, R. H. Gross, M. L. Whitfield, and S. A. Brooks Identification of TTP mRNA targets in human dendritic cells reveals TTP as a critical regulator of dendritic cell maturation RNA, May 1, 2008; 14(5): 888 - 902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Ciais, M. T. Bohnsack, and D. Tollervey The mRNA encoding the yeast ARE-binding protein Cth2 is generated by a novel 3' processing pathway Nucleic Acids Res., May 1, 2008; 36(9): 3075 - 3084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Stoecklin, S. A. Tenenbaum, T. Mayo, S. V. Chittur, A. D. George, T. E. Baroni, P. J. Blackshear, and P. Anderson Genome-wide Analysis Identifies Interleukin-10 mRNA as Target of Tristetraprolin J. Biol. Chem., April 25, 2008; 283(17): 11689 - 11699. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Skinner, K. M. Deleault, R. Fecteau, and S. A. Brooks Extracellular Signal-regulated Kinase Regulation of Tumor Necrosis Factor-{alpha} mRNA Nucleocytoplasmic Transport Requires TAP-NxT1 Binding and the AU-rich Element J. Biol. Chem., February 8, 2008; 283(6): 3191 - 3199. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Winzen, B. K. Thakur, O. Dittrich-Breiholz, M. Shah, N. Redich, S. Dhamija, M. Kracht, and H. Holtmann Functional Analysis of KSRP Interaction with the AU-Rich Element of Interleukin-8 and Identification of Inflammatory mRNA Targets Mol. Cell. Biol., December 1, 2007; 27(23): 8388 - 8400. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Frasca, A. M. Landin, J. P. Alvarez, P. J. Blackshear, R. L. Riley, and B. B. Blomberg Tristetraprolin, a Negative Regulator of mRNA Stability, Is Increased in Old B Cells and Is Involved in the Degradation of E47 mRNA J. Immunol., July 15, 2007; 179(2): 918 - 927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. A. Khabar Rapid transit in the immune cells: the role of mRNA turnover regulation J. Leukoc. Biol., June 1, 2007; 81(6): 1335 - 1344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Smoak and J. A. Cidlowski Glucocorticoids Regulate Tristetraprolin Synthesis and Posttranscriptionally Regulate Tumor Necrosis Factor Alpha Inflammatory Signaling Mol. Cell. Biol., December 1, 2006; 26(23): 9126 - 9135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Sauer, B. Schaljo, C. Vogl, I. Gattermeier, T. Kolbe, M. Muller, P. J. Blackshear, and P. Kovarik Interferons limit inflammatory responses by induction of tristetraprolin Blood, June 15, 2006; 107(12): 4790 - 4797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wang, J. Zhang, S. Theel, J. J. Barb, P. J. Munson, and R. L. Danner Nitric oxide activation of Erk1/2 regulates the stability and translation of mRNA transcripts containing CU-rich elements Nucleic Acids Res., June 6, 2006; 34(10): 3044 - 3056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Hitti, T. Iakovleva, M. Brook, S. Deppenmeier, A. D. Gruber, D. Radzioch, A. R. Clark, P. J. Blackshear, A. Kotlyarov, and M. Gaestel Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol. Cell. Biol., March 1, 2006; 26(6): 2399 - 2407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. F. C. Rigby, K. Roy, J. Collins, S. Rigby, J. E. Connolly, D. B. Bloch, and S. A. Brooks Structure/Function Analysis of Tristetraprolin (TTP): p38 Stress-Activated Protein Kinase and Lipopolysaccharide Stimulation Do Not Alter TTP Function J. Immunol., June 15, 2005; 174(12): 7883 - 7893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Esclatine, B. Taddeo, and B. Roizman The UL41 protein of herpes simplex virus mediates selective stabilization or degradation of cellular mRNAs PNAS, December 28, 2004; 101(52): 18165 - 18170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Yang, W. Wang, J. Fan, A. Lal, D. Yang, H. Cheng, and M. Gorospe Prostaglandin A2-mediated Stabilization of p21 mRNA through an ERK-dependent Pathway Requiring the RNA-binding Protein HuR J. Biol. Chem., November 19, 2004; 279(47): 49298 - 49306. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
0.05) (*) relative to DMSO.
