HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Related articles in The JI Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ying, G. Articles by Wang, J. M. Search for Related Content PubMed PubMed Citation Articles by Ying, G. Articles by Wang, J. M.

Humanin, a Newly Identified Neuroprotective Factor, Uses the G Protein-Coupled Formylpeptide Receptor-Like-1 as a Functional Receptor¹

Guoguang Ying^*, Pablo Iribarren^*, Ye Zhou^*, Wanghua Gong, Ning Zhang^*, Zu-Xi Yu, Yingying Le^*, Youhong Cui^* and Ji Ming Wang^2,*

^* Laboratory of Molecular Immunoregulation and Basic Research Program, SAIC-Frederick, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702; and Pathology Section, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Alzheimer’s disease (AD) is characterized by overproduction of amyloid peptides in the brain with progressive loss of neuronal cells. The 42-aa form of the amyloid peptide (A₄₂) is implied as a major causative factor, because it is toxic to neurons and elicits inflammatory responses in the brain by activating microglial cells. Despite the overproduction of A₄₂, AD brain tissue also generates protective factor(s) that may antagonize the neurodestructive effect of A₄₂. Humanin is a gene cloned from an apparently normal region of an AD brain and encodes a 24-aa peptide. Both secreted and synthetic Humanin peptides protect neuronal cells from damage by A₄₂, and the effect of Humanin may involve putative cellular receptor(s). To elucidate the molecular identity of such receptor(s), we examined the activity of synthetic Humanin on various cells and found that Humanin induced chemotaxis of mononuclear phagocytes by using a human G protein-coupled formylpeptide receptor-like-1 (FPRL1) and its murine counterpart FPR2. Coincidentally, FPRL1 and FPR2 are also functional receptors used by A₄₂ to chemoattract and activate phagocytic cells. Humanin reduced the aggregation and fibrillary formation by suppressing the effect of A₄₂ on mononuclear phagocytes. In neuroblast cells, Humanin and A₄₂ both activated FPRL1; however, only A₄₂ caused apoptotic death of the cells, and its cytopathic effect was blocked by Humanin. We conclude that Humanin shares human FPRL1 and mouse FPR2 with A₄₂ and suggest that Humanin may exert its neuroprotective effects by competitively inhibiting the access of FPRL1 to A₄₂.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Overproduced amyloid peptides, the 42 aa (A₄₂)³ in particular, play a central role in mediating neurotoxicity and the formation of senile plaques in the brains of Alzheimer’s disease (AD) (1). Elevated level of A₄₂, both in soluble (2, 3) and fibrillary (4) forms, can be directly cytotoxic to neuronal cells (5). A₄₂ also may activate mononuclear phagocytes in the brain to elicit inflammatory responses (6). In vitro, A peptides are taken up by monocytes and microglia, and stimulate these cells to release proinflammatory cytokines and neurotoxic mediators (6, 7). Consequently, mononuclear phagocytes in the brain of AD may play a dual role in the formation of senile plagues, by dissolving preformed plaques when the cells are in an activated state (e.g., under the influence by TGF-) (8), or by promoting A aggregation after prolonged exposure to A₄₂ (9). Thus, it is important to identify the molecular basis that may determine the beneficial vs detrimental role of mononulear phagocytes in affecting the pathogenesis of AD.

A₄₂ interacts with human mononuclear phagocytes and neuronal cells typically through a receptor-mediated signaling pathway. A number of putative surface receptors for A₄₂ and its analogues on myeloid as well as neuronal cells have been described in the literature (10, 11, 12, 13, 14, 15, 16). We recently found that a member of the G protein-coupled formylpeptide receptor (FPR) family, FPR-like-1 (FPRL1), and its murine counterpart, FPR2, mediate chemotaxis and activation of monocytes and microglia induced by A₄₂ (17, 18). The prototype FPR was originally identified in human myeloid cells as a high affinity receptor for the bacterial chemotactic peptide formyl-methionyl-leucyl-phenylalanine (fMLF). fMLF at micromolar concentration range also activates FPRL1, which is therefore defined as a low affinity fMLF receptor. The mouse analogues of human FPR and FPRL1 are termed FPR1 and FPR2, respectively (19, 20). The chemotactic activity of A₄₂ was specific on human FPRL1 and mouse FPR2 because A₄₂ at a wide concentration range did not induce migration of cell lines transfected to overexpress human FPR or mouse FPR1 (17, 18, 21). In addition to mediating the chemotactic activity of A₄₂, FPRL1 also participates in the process of endocytosis and subsequent aggregation of A₄₂ in mononuclear phagocytes. Moreover, activation of FPRL1 overexpressed in cells of the nonhemopoietic origin by A₄₂ results in apoptotic cell death (9).

Despite the progressive nature of neurodegeneration, the occipital lobe in AD brains is rarely affected by the disease. This led to the hypothesis that the occipital lobe may produce protective factors against AD-associated pathologic insults. Recently, a cDNA was isolated from the occipital region of an AD brain that encodes a 24-aa neuroprotective peptide Humanin (HN) (22). Immunoreactive HN peptide was detected in the occipital lobe of AD brain, consistent with the origin from which its cDNA was isolated (23). When transfected into neuronal cells, HN protected the cells from cytotoxicity caused by coexpression of a variety of genes coding for mutated amyloid precursors associated with familial forms of AD and aberrant production of A₄₂ (22). Addition of synthetic HN into neuronal cell culture also rescued the cells from apoptotic death induced by exposure to A₄₂. The fact that secreted or exogenously introduced HN possessed neuroprotective capabilities suggests that cell surface receptor(s) for HN might exist. The present study aimed at characterizing the putative cellular receptor(s) for HN. We report that synthetic HN shares the G protein-coupled receptor human FPRL1 and mouse FPR2 with A₄₂ on mononuclear phagocytes and neuronal cell lines. Our results further suggest that the neuroprotective activity of HN may be attributed to its competitive occupation of FPRL1.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Reagents and cells

HN (22) and the human FPRL1 (mouse FPR2) agonists W peptide (WKYMVm, W pep) (24) and MMK-1 (25) were custom synthesized by the Department of Biochemistry, Colorado State University (Fort Collins, CO). The bacterial chemotactic peptide fMLF was purchased from Sigma-Aldrich (St. Louis, MO). A₄₂ was purchased from California Peptide Research (Napa, CA). Unless otherwise indicated, A₄₂ was freshly dissolved before use in the experiments. Anti-phospho-extracellular signal-regulated kinase (p-ERK) 1/2 and ERK1/2 Abs were from Cell Signaling Technology (Beverly, MA). FITC-conjugated anti-Myc epitope Ab was from Covance Research Products (Berkeley, CA).

Human peripheral blood monocytes were obtained from buffy coats (Transfusion Medicine Department, National Institutes of Health Clinical Center, Bethesda, MD) by using iso-osmotic Percoll gradient. The purity of cell preparations by morphology was >90%. The murine microglial cell line N9 was a kind gift from P. Ricciardi-Castagnoli (Universita Degli Studi di Milano-Bicocca, Milan, Italy) (21). The cells were grown in IMDM supplemented with 5% heat-inactivated FCS, 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 50 µM 2-ME. Human neuroblastoma cell lines SK-N-MC and SK-N-SH, and the rat pheochromocytoma cell line PC12 were purchased from American Type Culture Collection (Manassas, VA). Neuroblastoma cells were grown in DMEM (BioWhittaker, Walkersville, MD) plus 10% heat-inactivated FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. PC12 cells were maintained in DMEM supplemented with 10% horse serum, 5% FCS, and antibiotics (penicillin/streptomycin). HEK293 cells transfected with human FPR (FPR/293), FPRL1 (FPRL1/293), murine FPR1 (FPR1/293), or murine FPR2 (FPR2/293) were kind gifts from P. Murphy and J. L. Gao (National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD).

Primers 5'-CCCAAGCTTGACCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCAGTCGACGCAGGTGCAGGTATGGAATCCAACTACTCCATCC-3' (sense) and 5'-CCGTTACTCTCGTTAGTTCTTC-3' (antisense) were designed to generate an N-terminal Myc-tagged FPR2 fragment from the genomic DNA of N9 cells. The fragment was inserted into pcDNA3.1/myc-His^–A (Invitrogen, Carlsbad, CA) at HindIII/pflMI sites. The plasmid was stably transduced into HEK293 cells (Myc-FPR2/293 cells) using SuperFect transfection reagent (Qiagen, Valencia, CA).

Chemotaxis assays

Chemotaxis assays were performed using 48-well chemotaxis chambers (NeuroProbe, Cabin John, MD), as described previously (21, 24, 25). Chemoattractants at different concentrations were placed in the wells of the lower compartment of the chamber, and the cells (50 µl with monocytes or microglial cells at 2 x 10⁶/ml; receptor-transfected HEK293 cells at 1 x 10⁶/ml) were placed in the wells of the upper compartment. The upper and lower compartments were separated by a polycarbonate filter (Osmonics, Livermore, CA; 5 µm pore size for monocytes, 8 µm for microglial cells, and 10 µm for 293 cells). For migration of 293 cells, the filters were precoated with 50 µg/ml collagen type I (Collaborative Biomedical Products, Bedford, MA) to favor the attachment of the cells. After incubation at 37°C (90 min for monocytes and microglial cells; 5 h for 293 cells), the filters were removed and stained, and the cells migrated across the filters were counted under light microscope after coding the samples. The results were expressed as chemotaxis index, which represents the fold increase in the number of cells migrated in response to chemoattractants over the spontaneous cell migration (in response to control medium).

Calcium (Ca²⁺) mobilization

Cells were incubated with 2.5 µM fura 2-acetoxymethyl ester (Molecular Probes, Eugene, OR) in loading medium (RPMI 1640, 10% FCS, 2 mM glutamine) for 60 min at room temperature (RT) at a concentration of 1 x 10⁷ cells/ml, washed once, and resuspended in saline buffer (138 mM NaCl, 1 mM KCl, 1 mM CaCl2, 10 mM HEPES (pH 7.4), 5 mM glucose, 0.1% BSA) at a density of 0.5 x 10⁶ cells/ml. The cell suspension (2 ml) was placed in a cuvette in a fluorescence spectrometer (PerkinElmer, Beaconsfield, U.K.) and activated by adding 20 µl stimulants. The fluorescence intensity was calculated based on the ratio at 340 and 380 nm wavelengths with a FL WinLab program (PerkinElmer).

Ca²⁺ mobilization in neuroblastoma cells was measured by fluorescence microscope. The cells cultured on eight-well chamber slides (Nalge Nunc International, Rochester, NY) in DMEM supplied with 10% FCS were loaded with 5 µg/ml fura 2-acetoxymethyl ester for 40 min at 25°C, then were rinsed for three times with saline buffer. Ratiometric calcium imaging was performed using a Nikon Eclipse TE200 fluorescence microscope equipped with a variable filter wheel (Sutter Instruments, Novato, CA), a Spot-charge-coupled device camera, and a Nikon S Fluor x40 objective lens. Dual images (340 and 380 nm excitation, 510 emission) were collected by Openlab System 3.14 (Improvision, Lexington, MA), and pseudocolor ratiometric images were monitored at 4-s intervals.

Fluorescence confocal microscope

Myc-FPR2/293 cells were seeded at 20,000 cells/well on eight-well chamber slides for 48 h. The cells were then treated at 37°C with FPR2 agonists at 1 µM for 60 min and fixed in 4% paraformaldehyde for 10 min at RT. After washing with PBS and incubation in blocking buffer (PBS, 0.2% Nonidet P-40, 5% FCS) for 30 min at RT, FITC-conjugated anti-Myc Ab (1/1000) was added for 1 h. The cells were washed with PBS (0.2% Nonidet P-40) for 5 min, and the slides were mounted with VECTASHIELD mounting medium containing propidium iodide (PI) (1.5 µg/ml; Vector Laboratories, Burlingame, CA) and analyzed under a laser-scanning confocal fluorescence microscope (Leica TCS-4D DMIRBE, Heidelberg, Germany). Myc-tagged FPR2 was detected in green fluorescence, and the cell nuclei in red.

Flow cytometry

Myc-FPR2/293 cells were grown to subconfluency and treated with peptide agonists for 60 min at 37°C. The cells were then detached with cold Dulbecco’s PBS (5 mM EDTA) and washed with FACS buffer (5 mM EDTA, 0.1% NaN₃, 1% FCS, in Dulbecco’s PBS). After incubation with a FITC-conjugated anti-Myc Ab or control IgG (0.5 µg for 5 x 10⁵ cells in a 100 µl vol) for 30 min on ice in dark, the cells were washed once with FACS buffer, resuspended in 0.5 ml of FACS buffer, and analyzed by flow cytometry.

Congo red staining

Congo red staining was performed by using an amyloid stain kit (Sigma-Aldrich). Human monocytes are plated on eight-well chamber slides at a density of 1 x 10⁵ cells/well. The cells were cultured in RPMI 1640 containing 0.1% BSA, 0.01 M HEPES (pH7.4), and 20 ng/ml human M-CSF (PeproTech, Rocky Hill, NJ) for 48 h for differentiation. The macrophages were then cultured with 10 µM A₄₂ or HN alone for 48 h, or preincubated with 10 µM HN (1 h), followed by 10 µM A₄₂ for additional 48 h. The cells were fixed with 4% paraformaldehyde, and stained in Mayer’s hematoxylin for 2 min and Alkaline-NaCl solution for 20 min at RT. After 20-min staining with 0.2% Congo red solution, the cells were destained, dehydrated sequentially in 95%, 100% ethanol, and xylene. Coverslips were mounted onto the slides with 90% glycerol, and the slides were viewed under light microscopy.

RT-PCR

DNA-free total RNA was extracted from cells with RNeasy Mini kit and RNase-free DNase treatment (Qiagen). For each sample, 0.5 µg of total RNA was used for RT-PCR using High Fidelity ProSTAR HF System (Stratagene, Kingsport, TN). Reverse transcription was performed at 37°C for 15 min and terminated by incubation at 95°C for 1 min. Amplification was completed with 40 cycles of 95°C (45 s), 55°C (45 s), and 72°C (1 min), and a final extension for 10 min at 72°C. For human FPR, primers 5'-CTCCAGTTGGACTAGCCACA-3' (sense) and 5'-CCATCACCCAGGGCCCAATG-3' (antisense) were used to yield a 500-bp product. Primers 5'-CTGCTGGTGCTGCTGGCAAG-3' (sense) and 5'-AATATCCCTGACCCCATCCTCA-3' (antisense) were used to amplify a 1.1-kb fragment of human FPRL1. To amplify rat FPRL1 homologue, primers 5'-GGAGTACGAGGGTTACAACG-3' (sense) and 5'-GTCTCTTTCTCATTCACTGAAG-3' (antisense) were used to obtain a 1.1-kb fragment. GAPDH gene was used as a control in RT-PCR, and the primer pair was purchased from Stratagene.

Western immunoblotting

Cells grown in 12-well plates were treated with receptor agonists and were lysed with ice-cold lysis buffer (20 mM Tris-HCl, pH 7.4, 137 mM NaCl, 15% glycerol, 1% Triton X-100, 5 mM EDTA, 1 mM EGTA, 1 mM sodium orthovanadate, and Complete Mini protease inhibitor mixture tablet) (Roche Diagnostics, Indianapolis, IN). After centrifugation at 4°C for 10 min, the protein concentration in the supernatants was measured by bicinchoninic acid protein assay (Pierce, Rockford, IL). The supernatants were boiled in SDS sample buffer, and 30 µg of protein for each sample was electrophoresed on 10% SDS-PAGE precast gel (Invitrogen), followed by blotting onto Hybond-C Extra membranes (Amersham Biosciences, Piscataway, NJ). The membranes were blocked with a blocking solution (1% nonfat milk, 1x TBS, 0.2% Tween 20) overnight at 4°C; were incubated with anti-p-ERK1/2 Ab (1/1000) for 1 h at RT; and then were further incubated with a HRP-conjugated secondary Ab (1/4000) in blocking solution. After washing, the proteins on the membranes were detected using an ECL detection system (Amersham Biosciences). The membranes were then stripped and reacted with anti-ERK1/2 Ab as controls.

Cytotoxicity assays

The cytotoxicity of A₄₂ to neruoblastoma cells was measured by trypan blue exclusion, as described (2, 3). Neuroblastoma cells were plated at 20,000 cells/well on eight-well chamber slides. After preincubation for 12 h in the presence or absence of HN, the cells were further treated with A₄₂ for 48 h. The cells suspended by pipetting were stained with trypan blue (Invitrogen) at a final concentration of 0.08% and examined within 3 min. The cytotoxic effect was calculated as the percentage of the cells positively stained by trypan blue in total cells in suspension.

Statistical analysis

All experiments were performed at least three times, and representative results are presented. ANOVA was used to examine the significance of increased cell migration for multigroup comparisons. To compare the significance of cell migration between two groups, paired Student’s t test was used. Values of p equal to or less than 0.05 were considered statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
HN is a monocyte chemotactic peptide

To define the nature of putative receptor(s) potentially used by HN, we first tested the biological activity of this peptide on monocytic phagocytes. HN was capable of inducing migration of human monocytes in vitro with significant activities in the nanomolar to micromolar concentration range (Fig. 1A). Monocyte migration induced by HN is chemotactic rather than chemokinetic, as demonstrated by the requirement of positive HN concentration gradients for cell response in checkerboard analyses (data not shown). In addition, monocyte chemotaxis to HN was abolished by preincubation of the cells with pertussis toxin, implying the involvement of Gi protein-coupled cell surface receptor(s) (data not shown). This hypothesis was tested with Ca²⁺ mobilization and cross-desensitization experiments, which have been proven to be effective in distinguishing unique or shared G protein-coupled receptors for chemoattractants (17, 18, 21). HN induced Ca²⁺ mobilization in human monocytes (Fig. 1B), and, among a number of chemoattractants tested, the bacterial chemotactic peptide fMLF showed a capacity to progressively desensitize the cell response to HN (Fig. 1C). The fact that micromolar concentrations of fMLF were required to completely abolish the cell response to HN further suggested that HN might activate a receptor with low affinity for fMLF, presumably FPRL1 (19, 20). This possibility was tested with peptide agonists known to specifically activate either the high affinity fMLF receptor FPR, or the low affinity FPRL1 (19, 20). T20, a peptide derived from HIV-1 envelope protein gp41 and an agonist of FPR (26), at a wide concentration range up to 10 µM, did not desensitize monocyte response to HN (Fig. 1D and data not shown). However, an FPRL1-specific agonist, the random peptide library-derived MMK-1 peptide (25), desensitized HN-induced Ca²⁺ mobilization in human monocytes and vice versa (Fig. 1E). Another FPRL1 agonist, the AD-associated peptide A₄₂ (17), showed a moderate desensitizing activity on the cell response to HN. In contrast, HN effectively attenuated the monocyte response to A₄₂ (Fig. 1F). These results strongly indicate that HN uses FPRL1 on human monocytes as a functional receptor and appears to be a more potent FPRL1 agonist than A₄₂.

View larger version (32K): [in this window] [in a new window]   FIGURE 1. Activation of human monocytes by HN. HN at different concentrations induces migration (A) and Ca2+ flux (B) in human peripheral blood monocytes. The bacterial chemotactic peptide fMLF was used as a control in migration experiments at 102 nM. HN at concentrations from 10 nM induced significantly increased cell chemotaxis as compared with control medium (*). CI denotes chemotaxis index representing the fold increase in cell migration in response to stimulants vs control medium. Increasing concentrations of fMLF progressively attenuate monocyte response to HN in Ca2+ mobilization assays (C). T20, a specific agonist for the high affinity fMLF receptor FPR, failed to desensitize HN-induced signaling, or vice versa, in monocytes (D). However, an FPRL1 agonist MMK-1 and HN desensitized each other’s signaling (E). The AD-associated A42, an agonist for FPRL1, induces Ca2+ in monocytes and cross-desensitizes with HN for signaling (F).

The hypothesis that HN uses human receptor FPRL1 was tested directly by using HEK293 cells transfected to express either the high affinity fMLF receptor FPR or the low affinity FPRL1. Fig. 2A shows that HN induced a bell-shaped chemotactic response curve in 293 cells transfected with FPRL1 (FPRL1/293 cells), but was completely inactive on cells expressing FPR (FPR/293 cells), which nevertheless migrated in response to the agonist fMLF. In addition, HN elicited a dose-dependent Ca²⁺ mobilization in FPRL1/293 cells, which was completely desensitized by prior stimulation of the cells with the FPRL1 agonists MMK-1, but not by the FPR agonist T20 (Fig. 2, B and C). Furthermore, HN and A₄₂ cross-desensitized each other’s signaling in FPRL1/293 cells. It is interesting to note that compared with A₄₂, HN at lower concentrations was able to activate the receptor and to completely attenuate cell response to A₄₂ (Fig. 2C), in agreement with the results obtained in human monocytes (Fig. 1F).

View larger version (21K): [in this window] [in a new window]   FIGURE 2. Activation by HN of HEK293 cells transfected with human FPRL1. HN at concentrations starting from 10 nM induces significant migration (*) of HEK293 cells transfected with FPRL1, but not the cells transfected with FPR, which showed significantly increased chemotaxis to the bacterial chemotactic peptide fMLF at 102 nM (*). HN induces Ca2+ mobilization in FPRL1/293 cells (B), and its effect is attenuated by the FPRL1 agonist MMK-1 (C), but not the FPR agonist T20. HN also desensitizes the signaling of A42 in FPRL1/293 cells, and vice versa (C).

View larger version (23K): [in this window] [in a new window]   FIGURE 3. HN is an agonist for mouse FPR2. HN at concentrations from 102 nM induces significantly increased migration (*), and at 10 nM is sufficient to induce Ca2+ flux in HEK293 cells transfected with a Myc-tagged mouse FPR2 (A). Although the bacterial fMLF at 102 nM is inactive, the agonist for human FPRL1, MMK-1, at 102 nM was used as a positive control for cell chemotaxis. The human FPRL1 agonist A42 induces significant migration (*) of Myc-FPR2/293 cells as compared with control medium. Myc-FPR2/293 cells were also stimulated with different concentrations of HN or A42 for 5 min or with 103 nM peptides for different time periods and examined for increase in phosphorylation of ERK1/2 by using an anti-p-ERK1/2 Ab (B). W pep at 103 nM serves as a positive control. Anti-pan-ERK1/2 Ab was used to show the level of total ERK1/2 in each sample.

View larger version (28K): [in this window] [in a new window]   FIGURE 4. Activation of murine microglial cells by HN. Primary microglial cells (A) were isolated from the brains of newborn mice and stimulated with LPS at 600 ng/ml for 20 h (LPS+). The cells were then examined for their capacity to migration in response to HN or A42. *, Significantly increased cell migration in response to peptides vs control medium. The mouse microglial cell line N9 stimulated with LPS (600 ng/ml, 20 h) (LPS+) also showed significantly enhanced chemotaxis (*) in response to HN and A42 (B). In LPS-stimulated N9 cells, HN induced Ca2+ mobilization (C) and cross-desensitized with A42 for signaling.

One of the characteristic features of the G protein-coupled chemoattractant receptors upon agonist activation is their rapid internalization and down-regulation from the cell surface. Human FPRL1 was down-regulated and internalized after interaction with A₄₂ and other agonist peptides (9). We examined the capacity of HN to induce receptor internalization and down-regulation by using Myc-FPR2/293 cells. These cells maintained chemotactic and Ca²⁺ mobilization responses to HN and A₄₂ (Fig. 3), and the expression of FPR2 on the cell surface was detectable by an anti-myc Ab (Fig. 5A). FPR2 was down-regulated by HN and A₄₂, as well as another known FPR2 agonist, W pep (Fig. 5A and data not shown), from the cell surface. The down-regulation of FPR2 was associated with receptor internalization (Fig. 5B), as FPR2 aggregated in the cytoplasmic compartment of 293 cells after stimulation with HN and other FPR2 agonists (Fig. 5B and data not shown).

View larger version (65K): [in this window] [in a new window]   FIGURE 5. Down-regulation of FPR2 and inhibition of A42 aggregation in human macrophages by HN. Myc-FPR2/293 cells were incubated with the peptide agonists (103 nM) for 60 min at 37°C, then were stained with an FITC-conjugated anti-Myc Ab or control IgG. The cells were analyzed by flow cytometry (A). Myc-FPR2/293 cells grown on chamber slides were treated with medium or HN (103 nM) and stained with FITC-conjugated anti-Myc Ab and PI. The slides were analyzed with confocal microscope, which detects Myc-tagged FPR2 in green (FITC) and cell nuclei in red fluorescence (PI) (B). To examine A42 aggregation, human macrophages were cultured on chamber slides, in the presence or absence of 104 nM HN or A42 for 48 h. In parallel experiments, the cells were preincubated (1 h) with 104 nM HN, followed by A42 (104 nM) for 48 h. The cells were then stained with Congo red and examined under light microscope (C).

HN inhibits fibrillary aggregation of A₄₂ in macrophages

In human macrophages, soluble A₄₂ internalized with the receptor FPRL1 was capable of accumulating in the cytoplasmic region and forming Congo red-positive aggregation (9). This property of A₄₂ was confirmed, as shown in Fig. 5C, and in contrast to A₄₂, HN, over a wide concentration range, did not aggregate in macrophages (Fig. 5C). Furthermore, A₄₂ no longer formed aggregates in macrophages pre-exposed to HN, as demonstrated by the failure to detect significant levels of Congo red-positive fibrils (Fig. 5C). Thus, down-regulation of cell surface FPRL1 on human macrophages by HN may effectively prevent cell entry and the subsequent intracellular aggregation of A₄₂.

Protection from A₄₂-induced neuronal cell toxicity by HN

HN has been shown to suppress the cytotoxicity of A₄₂ on primary neurons and neuronal cell lines, and the protective effect of HN was proposed to involve putative cell surface receptor(s) (22). Although our results presented to date indicate that HN shares human FPRL1 and mouse FPR2 with A₄₂ as functional receptors on mononuclear phagocytes, it was not clear whether cells of the neuronal origin also express FPR, which may interact with HN and A₄₂. To examine this issue, we performed RT-PCR to detect the genes coding for FPR in several neuroblastoma cells extensively used in studies of the toxicity of A₄₂, including SK-N-MC, SK-N-SH, and PC12 cells. Although the transcripts for the high affinity fMLF receptor FPR were not detected in any of the neuroblastoma cells tested, all the cell lines expressed FPRL1 gene (Fig. 6A). By comparison, human monocytes expressed both FPR and FPRL1 genes. Functional studies revealed that all the neuroblastoma cells tested responded to HN, A₄₂, and another defined FPRL1 agonist W pep by a rapid, but transient enhancement in the phosphorylation of ERK1/2 MAPK (Fig. 6, B and C). The A₄₂- or HN-induced ERK phosphorylation in neuronal cells was significantly inhibited in cells treated with pertussis toxin (Fig. 6D), suggesting the involvement of Gi proteins in cell activation. In contrast, FPR-specific agonists fMLF in nanomolar concentration range or T20 peptide at concentrations up to 10 µM failed to increase ERK1/2 phosphorylation in neuroblastoma cells (data not shown). Similar to the defined FPRL1 agonist W pep, both HN and A₄₂ induced Ca²⁺ mobilization in neuroblastoma cells, while A₄₀ was not active (Fig. 7A). These results indicate that FPRL1 expressed in neuroblastoma cells is functional and can be activated by both HN and A₄₂. Interestingly, neither HN nor A₄₂ was capable of inducing chemotaxis of neuroblastoma cells (data not shown). The mechanistic basis for the lack of FPRL1-mediated chemotaxis in neuroblastoma cells as in contrast to myeloid cells remains to be determined, but is reminiscent of our previous observations that human astrocytoma cells responded to FPRL1 agonists by producing cytokines, but not with chemotaxis (28).

View larger version (48K): [in this window] [in a new window]   FIGURE 6. The expression and function of FPRL1 in neuroblastoma cells. RT-PCR was performed to examine the mRNA expression of FPRL1 and FPR in human neuroblastoma cells, the rat PC12 cells, and human monocytes (mono). GAPDH was used as control (A). The A42- or HN-induced ERK1/2 phosphorylation was examined in PC12 cells stimulated with different concentrations of the FPRL1 agonists for 5 min (B). ERK1/2 phosphorylation was also examined in SK-N-MC neuroblastoma cells after stimulation with different concentrations of HN, A42, or W pep for 5 min, or with 102 nM W pep, 103 nM A42, or HN for various time periods (C). SK-N-MC cells were also pretreated with pertussis toxin (PTX, 500 ng/ml, 30 min at 37°C), then were examined for ERK phosphorylation induced by A42 or HN (each at 100 nM for 5 min at 37°C) (D).

View larger version (51K): [in this window] [in a new window]   FIGURE 7. Ca2+ mobilization in neuroblastoma cells induced by FPRL1 agonists and cytotoxicity of A42. SK-N-MC neuroblastoma cells were cultured on chamber slides, loaded with fura 2, and stimulated with 103 nM HN or other FPRL1 agonists A42 and W pep. Dual images were collected by an Openlab System to show Ca2+ mobilization in light images on a blue cell background. Pseudocolor ratiometric images were monitored in every 4 s to show peaks of Ca2+ mobilization in representative individual cells (A). The 40-aa form A peptide (A40) at 103 nM did not induce Ca2+ in neuroblastoma cells. For cytotoxicity, SK-N-MC or PC12 cells grown on chamber slides were cultured with HN or A42 (103 nM) for 48 h. In parallel experiments, the cells were preincubated with HN (103 nM) for 12 h, followed by A42 (103 nM) (HN + A42) for 48 h. The cells were then stained with trypan blue, and positively stained cells were counted. The results were expressed as the percentage of trypan blue-positive cells in total cells counted. *, Significantly reduced cell death in samples preincubated with HN, followed by A42 vs A42 alone (B).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this study, we showed that the reported neuroprotective peptide HN is a chemotactic agonist for the human FPRL1 and its mouse counterpart FPR2. FPRL1 was originally identified as a low affinity receptor for the bacterial chemotactic peptide fMLF. During the past few years, a number of chemotactic agonists with minimal homology in their primary sequences have been found to interact with FPRL1, including HIV-1 envelope protein-derived peptides (30, 31), a peptide fragment of human prion (32), the amyloidogenic serum amyloid A (33), and A₄₂, one of the key elements involved in the pathogenesis of AD (17, 18, 22). Therefore, FPRL1 behaves as a pattern recognition receptor that may play important roles in inflammation and amyloidogenic diseases. Our present study identifies HN as yet another host-derived FPRL1 agonist, and suggests that HN may exert its neuroprotective effect by impeding the interaction of FPRL1 with A₄₂.

As a functional receptor for A₄₂, FPRL1 has been suggested to participate in the pathogenesis of AD in several crucial ways. Activation of FPRL1 on macrophages and microglial cells initiates a G protein-mediated signaling cascade that increases directional cell migration, phagocytosis, and mediator release (17, 18). These events may account for the recruitment of mononuclear cells to the vicinity of senile plaques in the diseased areas of AD brain, where A₄₂ is overproduced and accumulated (34). Although accumulation of leukocytes at the sites of tissue injury may be considered an innate host response aimed at the clearance of noxious agents, activated mononuclear phagocytes also release a variety of substances such as superoxide anions that may be toxic to neurons. Thus, FPRL1 may mediate proinflammatory responses elicited by A₄₂ in AD brain and exacerbate disease progression. FPRL1 has also been shown to promote the internalization of A₄₂ in the form of FPRL1/A₄₂ complexes in macrophages (9). If the in vitro exposure of the cells to A₄₂ was transient, macrophages were able to degrade ingested A₄₂ and FPRL1 was recycled to the cell surface. However, prolonged exposure of macrophages to A₄₂ for >24 h resulted in progressive accumulation of FPRL1/A₄₂ complexes in the cytoplasmic compartment of the cells, which culminated in the aggregation and deposition of Congo red-positive fibriles (9), an observation clearly confirmed in our present study. In contrast, HN, despite its being a seemingly more efficacious agonist for FPRL1 as compared with A₄₂, did not form any detectable Congo red-positive aggregates in macrophages. But rather, preincubation of macrophages with HN effectively prevented fibrillary aggregation of A₄₂ in such cells, presumably by blockade of the access of FPRL1 to A₄₂. Nevertheless, A₄₂ did not form Congo red-positive fibrils in all cell types that express FPRL1. In HEK293 cells transfected with FPRL1, FPRL1/A₄₂ complexes were also internalized into the cytoplasmic compartment, but no Congo red-positive fibrils were detectable after 24-h exposure (9). These observations suggest that only cells of the mononuclear phagocyte lineage may provide an appropriate microenvironment favoring fibrillar formation of A₄₂. In addition, the physicochemical property of the agonist may determine its capacity to aggregate in these cells (34). Therefore, HN and other FPRL1 agonists such as W pep (9, 24), which fail to aggregate in mononuclear phagocytes, are effective in specifically blocking the exploitation of FPRL1 by A₄₂ for cell entry, thereby reducing its intracellular aggregation.

Our previous study showed that activation of FPRL1 by A₄₂, but not other nonaggregating peptide agonists, increased the incidence of apoptotic cell death. FPRL1-transfected HEK293 cells were even more readily killed by exposure to A₄₂ than macrophages (9), suggesting that nonhemopoietic cells bearing FPRL1 may be more susceptible to the cytotoxic effects of A₄₂. Indeed, as shown in the present study, several neuroblastoma cell lines expressing functional FPRL1 also exhibited greater susceptibility to killing by A₄₂. In contrast, HN by itself did not significantly increase neuronal cell death, but protected the cells from damage by A₄₂. These results revealed, for the first time, the association of the expression of functional FPRL1 by neuronal cells and the resultant neurocytotoxicity of A₄₂.

HN has been reported to elicit a variety of neuroprotective effects. HN protects neuronal cells from damage inflicted by Ab against the amyloid precursor protein, and by transfection of mutated genes associated with familial forms of AD, resulting in aberrant production of A peptides (35). HN has also been shown to protect neuronal cells from serum deprivation-induced apoptosis (36). In vivo, mice receiving HN were protected from scopolamine-induced impairment of spontaneous alternation behavior in the Y-maze (37), a criterion of short-term memory. Thus, HN has shown beneficial effects not only on AD-associated pathology, but also on damages caused by serum deprivation or by perturbation of cholinergic systems in mice. Recently, HN in the cytosolic compartment was found to inhibit apoptosis by directly interacting with Bax and blocking its mitochondrial translocation in response to death stimulation (38). Therefore, HN appears to possess a broad spectrum of protective activity against diverse cytopathic insults. Our data suggest FPRL1 may play a role in mediating these beneficial effects of HN.

HN was initially found to act in a secreted form, and thus may use putative surface receptor(s). This assumption was supported by the capacity of HN to attach to the surface of target cells (22). In addition, in cytotoxicity assays with neuronal cells, HN expressed inside the cells was unable to protect the cells from apoptosis induced by A peptides (22). The fact that only exogenously added HN showed cell protection indicates a requirement for the peptide to be transported into the cells through a cell surface protein, or alternatively, to compete for a receptor with which A peptides may interact. Our present study demonstrates that FPRL1 is a receptor shared by both HN and A₄₂ on mononuclear phagocytes and neuronal cell lines, and more importantly, FPRL1 may act as a receptor on neuronal cells through which HN protects the cells from A₄₂-elicited apoptotic signaling cascade. Nevertheless, at this stage, the potential involvement of other cell surface receptors should not be excluded (39), and further research is warranted to fully elucidate the mechanistic basis of the interaction of HN with its target cells.

The pathophysiological significance of neuroprotection by HN is supported by observations showing that immunoreactive HN is detected with an antiserum in intact neurons in the occipital lobe of an AD brain, but not in neurons of other regions or in age-matched control brain (23). This may explain a relatively rare occurrence of AD lesions in the occipital lobe due to the presence of a protective molecule. However, reactive glia in hippocampus of AD brain also showed abundant HN immunoreactivity (23), suggesting that HN production is inducible both in neurons of selected brain regions and in glial cells under pathological conditions. Therefore, the outcome of the disease process may well be dependent on a dynamic balance between pathogenic and protective factors. Further understanding the regulation of HN expression in the brain and its mechanisms of function may provide very useful means of preventing or retarding the progression of AD.

	Acknowledgments

 
We thank Dr. Joost J. Oppenheim for reviewing the manuscript, and Drs. Philip Murphy and Ji-Liang Gao for kindly providing HEK293 cells transfected with human FPRL1. The technical support from Dr. Victor J. Ferrans and Nancy Dunlop, as well as secretarial assistance from Cheryl Fogle and Cheryl Nolan, are gratefully acknowledged.

	Footnotes

 
¹ The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. government. The publisher or recipient acknowledges right of the U.S. government to retain a nonexclusive, royalty-free license in and to any copyright covering the article. This project has been funded in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract NO1-CO-12400. Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication 86-23, 1985).

² Address correspondence and reprint requests to Dr. Ji Ming Wang, Laboratory of Molecular Immunoregulation, Center for Cancer Research, National Cancer Institute at Frederick, Building 560, Room 31-40, Frederick, MD 21702. E-mail address: wangji{at}mail.ncifcrf.gov

³ Abbreviations used in this paper: A, amyloid ; AD, Alzheimer’s disease; ERK, extracellular signal-regulated kinase; fMLF, formyl-methionyl-leucyl-phenylalanine; FPR, formylpeptide receptor; FPRL1, FPR-like-1; HN, Humanin; MAPK, mitogen-activated protein kinase; PI, propidium iodide; RT, room temperature; W pep, W peptide; p-ERK, phospho-ERK.

Received for publication January 20, 2004. Accepted for publication March 23, 2004.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Selkoe, D. J.. 1999. Translating cell biology into therapeutic advances in Alzheimer’s disease. Nature 399:(Suppl. A23):6738.
2. Lambert, M. P., A. K. Barlow, B. A. Chromy, C. Edwards, R. Freed, M. Liosatos, T. E. Morgan, I. Rozovsky, B. Trommer, K. L. Viola, et al 1998. Diffusible, nonfibrillar ligands derived from A_1–42 are potent central nervous system neurotoxins. Proc. Natl. Acad. Sci. USA 95:6448.[Abstract/Free Full Text]
3. Hartley, D. M., D. M. Walsh, C. P. Ye, T. Diehl, S. Vasquez, P. M. Vassilev, D. B. Teplow, D. J. Selkoe. 1999. Protofibrillar intermediates of amyloid -protein induce acute electrophysiological changes and progressive neurotoxicity in cortical neurons. J. Neurosci. 19:8876.[Abstract/Free Full Text]
4. Lorenzo, A., B. A. Yankner. 1994. -amyloid neurotoxicity requires fibril formation and is inhibited by congo red. Proc. Natl. Acad. Sci. USA 91:12243.[Abstract/Free Full Text]
5. Klein, W. L., G. A. Krafft, C. E. Finch. 2001. Targeting small A oligomers: the solution to an Alzheimer’s disease conundrum?. Trends Neurosci. 24:219.[Medline]
6. Pachter, J. S.. 1997. Inflammatory mechanisms in Alzheimer disease: the role of -amyloid/glial interactions. Mol. Psychiatry 2:91.[Medline]
7. London, J. A., D. Biegel, J. S. Pachter. 1996. Neurocytopathic effects of -amyloid-stimulated monocytes: a potential mechanism for central nervous system damage in Alzheimer disease. Proc. Natl. Acad. Sci. USA 93:4147.[Abstract/Free Full Text]
8. Neuroinflammation Working Group. 2000. Inflammation and Alzheimer’s disease. Neurobiol. Aging 21:383.[Medline]
9. Yazawa, H., Z. X. Yu, K. Takeda, Y. Le, W. Gong, V. J. Ferrans, J. J. Oppenheim, C. C. Li, J. M. Wang. 2001. amyloid peptide (A₄₂) is internalized via the G-protein-coupled receptor FPRL1 and forms fibrillar aggregates in macrophages. FASEB J. 15:2454.[Abstract/Free Full Text]
10. Yan, S. D., X. Chen, J. Fu, M. Chen, H. Zhu, A. Roher, T. Slattery, L. Zhao, M. Nagashima, J. Morser, et al 1996. RAGE and amyloid- peptide neurotoxicity in Alzheimer’s disease. Nature 382:685.[Medline]
11. El Khoury, J., S. E. Hickman, C. A. Thomas, J. D. Loike, S. C. Silverstein. 1998. Microglia, scavenger receptors, and the pathogenesis of Alzheimer’s disease. Neurobiol. Aging 19:(Suppl. 1):S81.[Medline]
12. Wang, H. Y., D. H. Lee, M. R. D’Andrea, P. A. Peterson, R. P. Shank, A. B. Reitz. 2000. -Amyloid(1–42) binds to 7 nicotinic acetylcholine receptor with high affinity: implications for Alzheimer’s disease pathology. J. Biol. Chem. 275:5626.[Abstract/Free Full Text]
13. LaDu, M. J., J. A. Shah, C. A. Reardon, G. S. Getz, G. Bu, J. Hu, L. Guo, L. J. van Eldik. 2000. Apolipoprotein E receptors mediate the effects of -amyloid on astrocyte cultures. J. Biol. Chem. 275:33974.[Abstract/Free Full Text]
14. Liu, Q., H. Kawai, D. K. Berg. 2001. -Amyloid peptide blocks the response of 7-containing nicotinic receptors on hippocampal neurons. Proc. Natl. Acad. Sci. USA 98:4734.[Abstract/Free Full Text]
15. Xie, L., E. Helmerhorst, K. Taddei, B. Plewright, W. Van Bronswijk, R. Martins. 2002. Alzheimer’s -amyloid peptides compete for insulin binding to the insulin receptor. J. Neurosci. 22:RC221.[Abstract/Free Full Text]
16. Dechant, G., Y. A. Barde. 2002. The neurotrophin receptor p75(NTR): novel functions and implications for diseases of the nervous system. Nat. Neurosci. 5:1131.[Medline]
17. Le, Y., W. Gong, H. L. Tiffany, A. Tumanov, S. Nedospasov, W. Shen, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. J. Oppenheim, J. M. Wang. 2001. Amyloid ()42 activates a G-protein-coupled chemoattractant receptor, FPR-like-1. J. Neurosci. 21:RC123.
18. Tiffany, H. L., M. C. Lavigne, Y. H. Cui, J. M. Wang, T. L. Leto, J. L. Gao, P. M. Murphy. 2001. Amyloid- induces chemotaxis and oxidant stress by acting at formylpeptide receptor 2, a G protein-coupled receptor expressed in phagocytes and brain. J. Biol. Chem. 276:23645.[Abstract/Free Full Text]
19. Prossnitz, E. R., R. D. Ye. 1997. The N-formyl peptide receptor: a model for the study of chemoattractant receptor structure and function. Pharmacol. Ther. 74:73.[Medline]
20. Le, Y., P. M. Murphy, J. M. Wang. 2002. Formyl-peptide receptors revisited. Trends Immunol. 23:541.[Medline]
21. Cui, Y. H., Y. Le, W. Gong, P. Proost, J. Van Damme, W. J. Murphy, J. M. Wang. 2002. Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine microglial cells. J. Immunol. 168:434.[Abstract/Free Full Text]
22. Hashimoto, Y., T. Niikura, H. Tajima, T. Yasukawa, H. Sudo, Y. Ito, Y. Kita, M. Kawasumi, K. Kouyama, M. Doyu, et al 2001. A rescue factor abolishing neuronal cell death by a wide spectrum of familial Alzheimer’s disease genes and A. Proc. Natl. Acad. Sci. USA 98:6336.[Abstract/Free Full Text]
23. Tajima, H., T. Niikura, Y. Hashimoto, Y. Ito, Y. Kita, K. Terashita, K. Yamazaki, A. Koto, S. Aiso, I. Nishimoto. 2002. Evidence for in vivo production of Humanin peptide, a neuroprotective factor against Alzheimer’s disease-related insults. Neurosci. Lett. 324:227.[Medline]
24. Le, Y., W. Gong, B. Li, N. M. Dunlop, W. Shen, S. B. Su, R. D. Ye, J. M. Wang. 1999. Utilization of two seven-transmembrane, G protein-coupled receptors, formyl peptide receptor-like 1 and formyl peptide receptor, by the synthetic hexapeptide WKYMVm for human phagocyte activation. J. Immunol. 163:6777.[Abstract/Free Full Text]
25. Hu, J. Y., Y. Le, W. Gong, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. M. Wang. 2001. Synthetic peptide MMK-1 is a highly specific chemotactic agonist for leukocyte FPRL1. J. Leukocyte Biol. 70:155.[Abstract/Free Full Text]
26. Su, S. B., W. Gong, J. L. Gao, W. Shen, M. C. Grimm, X. Deng, P. M. Murphy, J. J. Oppenheim, J. M. Wang. 1999. T20/DP178, an ectodomain peptide of human immunodeficiency virus type 1 gp41, is an activator of human phagocyte N-formyl peptide receptor. Blood 93:3885.[Abstract/Free Full Text]
27. Cui, Y. H., Y. Le, X. Zhang, W. Gong, K. Abe, R. Sun, J. Van Damme, P. Proost, J. M. Wang. 2002. Up-regulation of FPR2, a chemotactic receptor for amyloid 1–42 (A₄₂), in murine microglial cells by TNF. Neurobiol. Dis. 10:366.[Medline]
28. Le, Y., J. Hu, W. Gong, W. Shen, B. Li, N. M. Dunlop, D. O. Halverson, D. G. Blair, J. M. Wang. 2000. Expression of functional formyl peptide receptors by human astrocytoma cell lines. J. Neuroimmunol. 111:102.[Medline]
29. Wei, W., X. Wang, J. W. Kusiak. 2002. Signaling events in amyloid -peptide-induced neuronal death and insulin-like growth factor I protection. J. Biol. Chem. 277:17649.[Abstract/Free Full Text]
30. Deng, X., H. Ueda, S. B. Su, W. Gong, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. M. Wang. 1999. A synthetic peptide derived from human immunodeficiency virus type 1 gp120 down-regulates the expression and function of chemokine receptors CCR5 and CXCR4 in monocytes by activating the 7-transmembrane G-protein-coupled receptor FPRL1/LXA4R. Blood 94:1165.[Abstract/Free Full Text]
31. Su, S. B., J. L. Gao, W. Gong, N. M. Dunlop, P. M. Murphy, J. J. Oppenheim, J. M. Wang. 1999. T21/DP107, a synthetic leucine zipper-like domain of the HIV-1 envelope gp41, attracts and activates human phagocytes by using G-protein-coupled formyl peptide receptors. J. Immunol. 162:5924.[Abstract/Free Full Text]
32. Le, Y., H. Yazawa, W. Gong, Z. Yu, V. J. Ferrans, P. M. Murphy, J. M. Wang. 2001. The neurotoxic prion peptide fragment PrP_106–126 is a chemotactic agonist for the G protein-coupled receptor formyl peptide receptor-like 1. J. Immunol. 166:1448.[Abstract/Free Full Text]
33. Su, S. B., W. Gong, J. L. Gao, W. Shen, P. M. Murphy, J. J. Oppenheim, J. M. Wang. 1999. A seven-transmembrane, G protein-coupled receptor, FPRL1, mediates the chemotactic activity of serum amyloid A for human phagocytic cells. J. Exp. Med. 189:395.[Abstract/Free Full Text]
34. Cui, Y. H., Y. Le, H. Yazawa, W. Gong, J. M. Wang. 2002. Potential role of the formyl peptide receptor-like 1 (FPRL1) in inflammatory aspects of Alzheimer’s disease. J. Leukocyte Biol. 72:628.[Abstract/Free Full Text]
35. Hashimoto, Y., T. Niikura, Y. Ito, H. Sudo, M. Hata, E. Arakawa, Y. Abe, Y. Kita, I. Nishimoto. 2001. Detailed characterization of neuroprotection by a rescue factor Humanin against various Alzheimer’s disease-relevant insults. J. Neurosci. 21:9235.[Abstract/Free Full Text]
36. Kariya, S., N. Takahash, N. Ooba, M. Kawahara, H. Nakayama, S. Ueno. 2002. Humanin inhibits cell death of serum-deprived PC12h cells. NeuroReport 13:903.[Medline]
37. Mamiya, T., M. Ukai. 2001. [Gly¹⁴]-Humanin improved the learning and memory impairment induced by scopolamine in vivo. Br. J. Pharmacol. 134:1597.[Medline]
38. Guo, B., D. Zhai, E. Cabezas, K. Welsh, S. Nouraini, A. C. Satterthwait, J. C. Reed. 2003. Humanin peptide suppresses apoptosis by interfering with Bax activation. Nature 423:456.[Medline]
39. Tsukamoto, E., Y. Hashimoto, K. Kanekura, T. Niikura, S. Aiso, I. Nishimoto. 2003. Characterization of the toxic mechanism triggered by Alzheimer’s amyloid- peptides via p75 neurotrophin receptor in neuronal hybrid cells. J. Neurosci. Res. 73:627.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 172: 6511-6512. [Full Text]  

This article has been cited by other articles:

				F. N. E. Gavins, J. Dalli, R. J. Flower, D. N. Granger, and M. Perretti Activation of the annexin 1 counter-regulatory circuit affords protection in the mouse brain microcirculation FASEB J, June 1, 2007; 21(8): 1751 - 1758. [Abstract] [Full Text] [PDF]

				Z. Miao, B. A. Premack, Z. Wei, Y. Wang, C. Gerard, H. Showell, M. Howard, T. J. Schall, and R. Berahovich Proinflammatory Proteases Liberate a Discrete High-Affinity Functional FPRL1 (CCR12) Ligand from CCL23 J. Immunol., June 1, 2007; 178(11): 7395 - 7404. [Abstract] [Full Text] [PDF]

				J.-L. Gao, A. Guillabert, J. Hu, Y. Le, E. Urizar, E. Seligman, K. J. Fang, X. Yuan, V. Imbault, D. Communi, et al. F2L, a Peptide Derived from Heme-Binding Protein, Chemoattracts Mouse Neutrophils by Specifically Activating Fpr2, the Low-Affinity N-Formylpeptide Receptor J. Immunol., February 1, 2007; 178(3): 1450 - 1456. [Abstract] [Full Text] [PDF]

				K. Chen, P. Iribarren, J. Huang, L. Zhang, W. Gong, E. H. Cho, S. Lockett, N. M. Dunlop, and J. M. Wang Induction of the Formyl Peptide Receptor 2 in Microglia by IFN-{gamma} and Synergy with CD40 Ligand J. Immunol., February 1, 2007; 178(3): 1759 - 1766. [Abstract] [Full Text] [PDF]

				C. Prat, J. Bestebroer, C. J. C. de Haas, J. A. G. van Strijp, and K. P. M. van Kessel A New Staphylococcal Anti-Inflammatory Protein That Antagonizes the Formyl Peptide Receptor-Like 1 J. Immunol., December 1, 2006; 177(11): 8017 - 8026. [Abstract] [Full Text] [PDF]

				K. Chen, P. Iribarren, J. Hu, J. Chen, W. Gong, E. H. Cho, S. Lockett, N. M. Dunlop, and J. M. Wang Activation of Toll-like Receptor 2 on Microglia Promotes Cell Uptake of Alzheimer Disease-associated Amyloid beta Peptide J. Biol. Chem., February 10, 2006; 281(6): 3651 - 3659. [Abstract] [Full Text] [PDF]

P. Iribarren, K. Chen, J. Hu, X. Zhang, W. Gong, and J. M. Wang IL-4 Inhibits the Expression of Mouse Formyl Peptide Receptor 2, a Receptor for Amyloid {beta}1-42, in TNF-{alpha}-Activated Microglia J. Immunol., November 1, 2005; 175(9): 6100 - 6106. [Abstract] [Full Text] [PDF]