The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Didierlaurent, A.
Right arrow Articles by Sirard, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Didierlaurent, A.
Right arrow Articles by Sirard, J.-C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2004, 172: 6922-6930.
Copyright © 2004 by The American Association of Immunologists

Flagellin Promotes Myeloid Differentiation Factor 88-Dependent Development of Th2-Type Response1

Arnaud Didierlaurent*,{dagger}, Isabel Ferrero{ddagger}, Luc A. Otten{dagger}, Bertrand Dubois§, Monique Reinhardt*, Harald Carlsen, Rune Blomhoff, Shikuo Akira||, Jean-Pierre Kraehenbuhl*,{dagger} and Jean-Claude Sirard2,*

* Swiss Institute for Experimental Cancer Research and {dagger} Institute of Biochemistry, University of Lausanne, Epalinges, Switzerland; {ddagger} Ludwig Institute for Cancer Research, Epalinges, Switzerland; § Institut National de la Santé et de la Recherche Médicale, Unité 404, Lyon, France; Institute for Nutrition Research, University of Oslo, Oslo, Norway; and || Department of Host Defense, Osaka University, Osaka, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of dendritic cells (DC) by microbial products via Toll-like receptors (TLR) is instrumental in the induction of immunity. In particular, TLR signaling plays a major role in the instruction of Th1 responses. The development of Th2 responses has been proposed to be independent of the adapter molecule myeloid differentiation factor 88 (MyD88) involved in signal transduction by TLRs. In this study we show that flagellin, the bacterial stimulus for TLR5, drives MyD88-dependent Th2-type immunity in mice. Flagellin promotes the secretion of IL-4 and IL-13 by Ag-specific CD4+ T cells as well as IgG1 responses. The Th2-biased responses are associated with the maturation of DCs, which are shown to express TLR5. Flagellin-mediated DC activation requires MyD88 and induces NF-{kappa}B-dependent transcription and the production of low levels of proinflammatory cytokines. In addition, the flagellin-specific response is characterized by the lack of secretion of the Th1-promoting cytokine IL-12 p70. In conclusion, this study suggests that flagellin and, more generally, TLR ligands can control Th2 responses in a MyD88-dependent manner.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Dendritic cells (DC)3 play a key role in immune surveillance and have the unique capacity among APCs to stimulate naive T cells and differentiation of Th1- and Th2-type CD4+ T lymphocytes (1, 2, 3). DC activation is controlled by conserved signature molecules of microbes, called pathogen-associated molecular patterns (PAMP) (4). PAMP interaction with pattern recognition receptors (PRR), such as members of the Toll-like receptor (TLR) family, triggers the signal transduction required for coordinated activation of innate and adaptive immunities. In particular, recognition of PAMPs by PRRs can configure DCs to instruct the most appropriate Th cell response for protection (5).

TLRs (TLR1 to TLR10) share common characteristics in the signal transduction machinery, including the myeloid differentiation factor 88 (MyD88) adapter molecule and the NF-{kappa}B transcriptional activator (4). MyD88-deficient mice develop a Th2-biased response after immunization with adjuvants containing TLR activators, such as CFA or the soluble Toxoplasma Ag (6, 7, 8). Thus, MyD88-dependent TLR signaling is probably dedicated to the induction of Th1-biased responses (5). In contrast, Th2 commitment is assumed to depend on DC activation via PRR unrelated to TLR, such as Schistosoma egg Ags. However, recent studies propose that TLR signaling contributes to the induction of Th2-type differentiation by control of DC activation (9, 10, 11, 12, 13). In particular, Kaisho et al. (11) showed that MyD88-independent rather that TLR-independent DC activation seems to be involved in Th2 development.

Monomeric flagellin is a PAMP that mediates signal transduction in mammals via TLR5 and MyD88 (14, 15). Flagellin is the structural protein subunit of the flagellum, the motility apparatus of bacteria. Flagellin is known to elicit, in the absence of any adjuvant, a strong and sustained Ab response, which is a hallmark of Th2-type immune responses (for review, see Ref. 16). These pioneer studies of flagellin were particularly instrumental to establish the paradigm of Th1/Th2 differentiation. More recent work in mice has reported that flagellin can potentate the priming of Th1-type CD4+ T cells specific for the OVA Th peptide, OVA323–339 (17). Flagellin was also shown to instruct human DCs to stimulate Th1 responses in an in vitro model (13). The development of Th1 immunity was correlated with the secretion of IL-12 p70 by activated DC. However, these data were not supported by the study by Means et al. (18), which showed that flagellin-activated human DCs do not produce IL-12 p70. Similarly, activation of mouse DC by flagellin was not observed in all conditions (17, 18). In contrast, the potency of flagellin as an adjuvant has been established in rats and mice (16). In this study we assessed both in vitro and in vivo the effects of flagellin on DC maturation and T cell differentiation using conventional mice and mice deficient for MyD88. We show that flagellin from Salmonella typhimurium induces MyD88-dependent development of Th2 responses. Although flagellin induces NF-{kappa}B-dependent transcription and production of IL-12 p40, flagellin-mediated DC activation is not associated with the secretion of the Th1-polarizing cytokine IL-12 p70 or high levels of proinflammatory cytokines. Our observations suggest that flagellin has a specific, MyD88-dependent role in adaptive immunity by activating DC to instruct the development of Th2-biased responses.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Flagellin purification and reagents

S. typhimurium produces two flagellins: FliC and FljB. Isogenic FliC-producing strain SIN22 (fljB5001::MudJ) and flagellin-deficient SIN41 (fliC5050::MudJ fljB5001::Mud-Cam) were obtained by phage transduction using strains TH714 and TH2795 as donors and ATCC14028 (American Type Culture Collection, Manassas, VA) as recipient (19). Flagellin FliC was prepared from SIN22. Briefly, flagella were sheared from surface, concentrated by ultracentrifugation, and heated for 30 min at 65°C to release FliC monomers (5 mg/l culture). FliC was depleted of endotoxin using Detoxi-Gel affinity columns (Pierce, Rockford, IL). Protein concentration was determined by the Bradford microassay (Bio-Rad, Hercules, CA), and endotoxin levels (<20 pg/µg FliC) were determined by Limulus pyrochrome assay (Associates of Cape Cod, Falmouth, MA). Similar preparations from SIN41 without endotoxin depletion were made. When specified, FliC was digested at 37°C for 30 min with 0.05% trypsin/0.02% EDTA (Biochrom, Berlin, Germany), followed by 1-h inactivation at 70°C. OVA (Sigma-Aldrich, St. Louis, MO) and hen egg lysozyme (HEL; Appligen, Strasbourg, France) were detoxified (<20 pg endotoxin/µg protein). S. typhimurium LPS (L-6511) or phosphorothioate CpG oligonucleotide (TCCATGACGTTCCTGATGCT) were obtained from Sigma-Aldrich and Eurogentec (Brussels, Belgium).

Mice

Six- to 16-wk-old mice (BALB/c (H-2d), C57BL/6 (H-2b), C3H/HeJ (H-2k), Naval Medical Research Institute (NMRI) outbred mice, DO11.10 SCID transgenic for OVA-specific TCR, MyD88–/– on C57BL/6 background, and (C57BL/6J x CBA/J)F1 transgenic for a transcriptional fusion between promoter containing NF-{kappa}B sites from the Ig{kappa} L chain and the firefly luciferase (3x-{kappa}B-luc)) were purchased from Harlan (Indianapolis, IN) or were bred in our animal facility (6, 20).

DC preparation

Cell cultures were performed in RPMI 1640 containing 5% FCS (RPMI-5) or in IMDM containing 10% FCS (IMDM-10) and supplements (Life Technologies). Bone marrow (BM) DC precursors were obtained from femoral and tibial bones (21). Briefly, BM cells were plated at 2 x 105 cells/ml with 10 ng/ml GM-CSF (BioSource International, Camarillo, CA) in IMDM-10 and supplemented 3 days later with GM-CSF-containing medium. On day 6, BM-derived DCs (BMDCs) were stimulated for 18 h and analyzed. Splenic DCs were prepared as previously described (22). Briefly, spleens were incubated with 0.5 mg/ml collagenase D and 40 µg/ml DNase I (Roche, Indianapolis, IN) in RPMI-5 for 10 min at 37°C. After mechanical dissociation, splenic DCs were enriched by centrifugation in cold iso-osmotic Optiprep (Nycomed, Oslo, Norway).

Immunizations

OVA-specific CD4+ T cells were isolated from spleen and lymph nodes of DO11.10 mice using MACS CD4 beads (Miltenyi Biotech, Auburn, CA) with a purity >98%. The cells were stained with 5 µM CFSE (Molecular Probes, Eugene, OR), and 4–5 x 106 cells were injected i.v. into recipient BALB/c mice. One day later, mice were injected i.v. with OVA with or without various stimuli. CD4+ V{beta}8+ splenocytes or lymph node cells were analyzed 72 h later. OVA-specific T cell responses were analyzed in conventional mice immunized s.c. Ten days later, 2–5 x 106 lymph node cells mixed with 2–5 x 106 irradiated splenocytes were incubated for 72 h with RPMI-5 with or without OVA to measure the secretion of IL-4, IL-13, and IFN-{gamma}. Animals were immunized s.c. once or twice on days 0 and 21 with FliC and/or OVA, and the systemic Ab response was analyzed on day 28.

Luciferase assays

BMDC or CD11c+ cells sorted from BMDC derived from 3x-{kappa}B-luc mice were stimulated for 30 min to 3 h. Luciferase activity was measured in cell extracts using the luciferase assay system (Promega, Madison, WI). HeLa S3 cells were transfected with ELAM-luc with or without pEF6/V5-TOPO-hTLR5 (1 µg of each plasmid) using Lipofectin (Invitrogen, Carlsbad, CA) and incubated for 6 h with 100 ng/ml flagellin, and cell lysates were tested in luciferase assays.

Abs and flow cytometry

The following mAbs conjugated to FITC, PE, CyChrome, or biotin were used: CD11c (HL3), MHC class II (HB11.54.3), B220 (RA3.6B2), CD8{alpha} (53.6.7), CD4 (LT4), CD80 (16-10A1), CD86 (GL-1), CD40 (3/23 and FGK-45), CD62L (MEL-14), CD44 (IM-7), F4/80 (F4/80), HEL46–61 loaded in I-Ak (C4H3), and mAb isotype controls (from BD PharMingen, San Diego, CA; or homemade) (23). Biotinylated Ab were revealed with streptavidin conjugated to CyChrome (BD PharMingen) or allophycocyanin (Molecular Probes). For all staining, FcR were blocked by incubating cells with mAb anti-CD32 (2.4G2). Flow cytometry was performed using FACSCalibur and CellQuest, and sorting was performed using FACStar (BD Biosciences, Mountain View, CA).

Quantitative RT-PCR

Total RNA was treated with DNase I (Qiagen, Chatsworth, CA) and reverse transcribed using Superscript II (Invitrogen). Quantitative PCR was then performed with an ABI 5700 thermocycler (Applied Biosystems, Foster City, CA) using the SYBR Green PCR assay and the primers specific for TLR5 (CGCACGGCTTTATCTTCTCC and GGCAAGGTTCAGCATCTTCAA) and 18S ribosomal RNA (TTGGCAAATGCTTTCGCTT and CGCCGCTAGAGGTGAAATTC). Relative mRNA levels were determined using 18S RNA as a reference. The expression of IL-4 and IFN-{gamma} was measured using a Light Cycler (Roche) and the following primers: Porphobilinogen deaminase (GAAG GATG TGCC TACC ATAC TACC TC and GGTT TTCC CGTTTGCA GATG), IFN-{gamma} (GGATGCATTCATGAGTATTG and CTTTTCCGCTTCCTGAGG), and IL-4 (CGGAGATGGATGTGCCAAAC and AGCCCTACAGACGAGCTCACTC). Amplification plots were analyzed using the second derivative method with LC data analysis 3.5 software (Roche).

ELISA

Cytokines were quantified by ELISA kits (IFN-{gamma}, IL-12 p40, IL-12 p70, and TNF-{alpha} from BD PharMingen; IL-4, IL-6, and IL-13 from R&D Systems, Minneapolis, MN). IL-4 secretion was also checked by bioassays using the CTL44 cell line (24). For detection of FliC- and OVA-specific Ab, sera were analyzed by ELISA using microplates (Maxisorp; Nunc, Naperville, IL) coated with 100 ng of FliC or 1 µg of OVA/well in PBS. Detection of Ab was performed using peroxidase-conjugated goat anti-mouse IgG (Bio-Rad), and titers were expressed as the reciprocal of the highest dilution that yielded an OD492 of 0.1. Quantification of IgG1 and IgG2a titers was performed using biotin-conjugated goat anti-mouse IgG1 and IgG2a (Caltag, San Francisco, CA). Student’s t test was used to determine statistics.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Flagellin triggers DC activation

The regulation of adaptive immunity by TLR agonists is dependent on stimulation of DCs (4). TLRs are expressed by DCs, and their contribution to DC activation is established for TLR2, -3, -4, -6, -7, and -9 (4). The expression of TLR5, the flagellin-specific TLR, was previously detected in spleen or splenic macrophages (18, 25, 26). To determine whether mouse splenic DCs can respond to flagellin as previously suggested (17), the expression of TLR5 was assessed by real-time RT-PCR and normalized to TLR5 expression in total splenocytes (Fig. 1a). The specificity of the assay was checked by analysis of melting curves of various samples and by sequencing of the PCR product. TLR5 transcript levels in splenic DCs were ~10-fold higher than those in whole splenic cells. We confirmed that TLR5 transcripts are found in splenic macrophages at a lower level than in splenic DCs, but not at all in B lymphocytes (data not shown). These data identified DCs as the main in vivo TLR5-expressing splenic APCs and are in agreement with recent observations (27). The expression of TLR5 in BMDCs was consistently ~10-fold less than that in splenic DCs (i.e., 0.6–1.6 relative expression level compared with total splenocytes; Fig. 1a). In conclusion, mouse DCs express TLR5 and are therefore equipped to respond to flagellin.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 1. Flagellin-mediated activation of DC. a, Splenic DCs from naive mice were isolated by FACS sorting as F4/80–/low CD11c+ cells population. BMDC were isolated by CD11c-specific MACS sorting. TLR5 RNA levels were quantified by real-time RT-PCR, normalized with respect to 18S RNA and presented as the fold increase compared with values observed in total splenocytes. b, Flagellin preparations from S. typhimurium (2 µg or equivalent/lane) were analyzed on SDS-PAGE, followed by gel staining with Coomassie Blue (left) or immunoblotting using FliC-specific Ab (right). Lane 1, Flagellin FliC; lane 2, preparation from flagellin-deficient strain; lane 3, trypsin-treated FliC. Preparation purity was assayed by immunoblot with FliC-specific serum generated in C57BL/6 and BALB/c mice immunized with 40 µg FliC and CFA, followed by 20 µg FliC and IFA. Coomassie Blue staining and immunoblot revealed a unique 52-kDa band corresponding to FliC. c, The effect of FliC on DCs was investigated in C3H/HeJ mice injected i.v. with PBS (dotted line), a preparation of flagellin-deficient S. typhimurium (thin line; equivalent to 20 µg of FliC), or 1 µg of FliC (bold line). Six hours later splenic DCs were analyzed by flow cytometry for the indicated activation markers. Histograms represent data for F4/80–/low CD11c+ gated cells. Similar results were obtained in C57BL/6 mice. d, C3H/HeJ BMDCs were incubated for 20 h with medium alone (dotted line), 1 µg/ml FliC (bold line), or trypsin-treated FliC (thin line; equivalent to 1 µg/ml FliC). Diagrams represent flow cytometric analysis of CD11c+ cells. Results are representative of five experiments. The gray diagrams correspond to staining with an isotype control antibody. e, BMDCs from C3H/HeJ mice were incubated for 20 h with 0.5 mg/ml HEL, 1 µg/ml FliC, and trypsin-treated FliC (equivalent to 1 µg/ml), alone or in combination. The median fluorescence of CD11c+ cells was measured by staining with C4H3 and MHC II-specific Abs (left). C4H3-specific median fluorescence was normalized to MHC II-specific fluorescence and was expressed as a percentage of the ratio for mock-treated DCs (right). The results shown are representative of two experiments.

 
A major concern in the analysis of bacterial product activity on mammalian cells, in particular on DC, is contamination by a low concentration of stimulatory signals, such as LPS or lipopeptides. To investigate the effect of flagellin on DCs, monomeric flagellin FliC was purified from S. typhimurium, and endotoxin contaminants were removed. Coomassie Blue staining and immunoblot revealed a unique 52-kDa band corresponding to FliC (Fig. 1b). To rule out any activity of protein and nonprotein contaminants, two controls were included: trypsin-treated detoxified FliC and preparation from flagellin-deficient S. typhimurium (Fig. 1b). We first verified that FliC preparations were able to activate mammalian cells responding exclusively to flagellin. All flagellin FliC preparations used in the study, in contrast to controls, up-regulated the transcription of IL-8 and CCL20 genes in epithelial intestinal cell lines as described previously (data not shown) (19, 28, 29). Similarly, NF-{kappa}B luciferase fusion was up-regulated in HeLa cells transfected with human TLR5 expression plasmid upon incubation with flagellin (data not shown). Therefore, our preparations induce signaling in mammalian cells via flagellin, the TLR5-stimulating ligand. We then investigated DC activation in vivo 6 h after i.v. injection of mice with flagellin (Fig. 1c). Flagellin enhanced the surface expression of the costimulatory molecules CD40, CD80, and CD86 as well as the expression of MHC class II in splenic DCs. Activation was effective at FliC doses as low as 100 ng (i.e., 2 pmol), but was not observed after injection of trypsin-treated FliC or preparation from flagellin-deficient S. typhimurium (Fig. 1c and data not shown). A flagellin-specific effect on splenic DCs was observed in LPS-hyporesponsive (C3H/HeJ), TLR2–/–, or conventional inbred animals (C57BL6 and BALB/c; Figs. 1c and 2a) (A. Didierlaurent and T. Roger, unpublished observations). In addition, splenic B lymphocytes did not proliferate or induce MHC class II expression upon incubation with flagellin, in contrast to other TLR activators such as peptidoglycan (TLR2 and TLR6), poly(I-C) (TLR3), LPS (TLR4), or unmethylated CpG DNA (TLR9) (A. Didierlaurent, K. Burns, and B. Brissoni, unpublished observations). Thus, our findings indicate that the stimulatory activity of flagellin preparations is independent of contaminants signaling through TLR2, TLR3, TLR4, TLR6, and TLR9. These observations also show that responsiveness to flagellin correlates with TLR5 expression at the transcriptional level. Together, our data show that splenic DCs, a major source of TLR5 in the spleen, are specifically stimulated by flagellin.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. MyD88-dependent activation of DC. a, The activation of splenic DCs was characterized in MyD88–/– and C57BL/6 mice injected i.v. with PBS (dotted line) or 1 µg of FliC or LPS (bold line). Six hours later, splenic DCs were analyzed by flow cytometry for the indicated markers. Histograms represent data for F4/80–/low CD11c+ gated cells. b, BMDCs derived from MyD88–/– or C57BL/6 were incubated for 20 h with medium alone (dotted line), FliC (1 µg/ml), LPS (1 µg/ml), or CpG (10 µg/ml). Diagrams represent flow cytometric analysis of CD11c+ cells. Results are representative of three experiments. c, BMDCs derived from 3x-{kappa}B-luc transgenic mice were incubated for 2 h with medium alone, FliC, CpG, or LPS. Luciferase activity was assayed in cell extracts and normalized to activity in mock-treated BMDC. The results shown are representative of two experiments.

 
To determine whether flagellin was able to induce DC maturation in the absence of other cell types, DCs were derived from BM precursors. As observed for splenic DCs, flagellin induced the up-regulation of MHC class II and costimulatory molecules on BMDCs (Fig. 1d). Trypsin-treated FliC had no effect, and a dose-response analysis showed that flagellin was active at concentrations as low as 10 ng/ml (data not shown). These experiments demonstrate that flagellin induces a direct activation of DC. zsn increase in Ag processing and presentation functions is also an important feature of DC activation. The capacity of flagellin to potentate processing and presentation of whole HEL was evaluated using C4H3 mAb specific for I-Ak loaded with HEL46–61 peptide (Fig. 1e) (23). As described previously, HEL alone was presented by BMDCs, in contrast to mock-treated cells. Incubation of BMDCs with HEL and FliC resulted in 2-fold enhancement of HEL presentation. Together these data indicate that flagellin induces the functional maturation of DC.

Maturation of DC by flagellin requires MyD88

To provide evidence that TLR5 may participate in flagellin effect, experiments were conducted in MyD88-deficient mice (6, 14). LPS was used as a control for MyD88-independent DC activation (30). Splenic DCs and BMDCs from MyD88–/– mice were not activated by flagellin or CpG in contrast to LPS (Fig. 2, a and b). Flagellin-mediated signaling in DC is therefore strictly dependent on the adapter molecule MyD88. TLR signaling pathways are invariably associated with transcriptional activation of NF-{kappa}B-dependent genes. BMDC derived from transgenic mice harboring a NF-{kappa}B-responsive luciferase fusion were incubated with LPS, CpG, and FliC at various concentrations before monitoring luciferase activity (Fig. 2c) (20). The kinetics of NF-{kappa}B activation were similar for all TLRs tested, with maximal activity 2 h after addition of stimuli. Flagellin at concentrations as low as 1 ng/ml enhanced NF-{kappa}B transcription by ~10-fold, whereas the increase with CpG and LPS was significantly higher. These observations establish that DC activation by flagellin is mediated by MyD88 and results in NF-{kappa}B induction, as expected for a TLR5-dependent mechanism.

We next investigated the pattern of cytokine secretion in flagellin-activated DCs. The heterodimeric cytokine IL-12 p70 (formed of IL-12 p40 and IL-12 p35) is produced upon stimulation of DCs via various TLRs (31). Interestingly, flagellin did not stimulate any IL-12 p70 secretion in BMDCs in contrast to CpG (Fig. 3a). However, flagellin induced a significant increase in IL-12 p40 production that is fully dependent on MyD88. Only small quantities of the proinflammatory cytokines IL-6 and TNF-{alpha} were produced by DCs upon incubation with flagellin compared with CpG (Fig. 3a). In addition, CpG, but not flagellin, triggered systemic IL-12 p70 production after i.v. injection, whereas significant levels of IL-12 p40 were measured with flagellin (Fig. 3b). This cytokine pattern was not modified by flagellin dose or costimulation, as assessed by treatment with anti-CD40 mAb (Fig. 3b and data not shown). Although flagellin induces MyD88-specific signaling, mouse DC activation both in vitro and in vivo is not associated with secretion of the Th1-polarizing cytokine IL-12 p70 and a strong proinflammatory response.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Flagellin-mediated cytokine secretion in BMDCs and in vivo. a, BMDCs derived from C57BL/6 or MyD88–/– mice were incubated for 20 h with medium alone, FliC, or CpG (1 and 10 µg/ml, respectively). The secretion of IL-12 p40, IL-12 p70, TNF-{alpha}, or IL-6 was measured by ELISA. Similar results were obtained with BMDC from 3x-{kappa}B-luc transgenic and C3H/HeJ mice. b, C3H/HeJ mice (n = 4) were injected i.v. with PBS, FliC (10 µg), and CpG (50 µg), supplemented or not with anti-CD40 mAb (50 µg) as indicated. Serum concentrations of IL-12 p40 and IL-12 p70 were determined 6 h later.

 
Flagellin induces the development of Th2-type responses

The cytokine IL-12 p70 plays an important role in the development of Th1 responses (31). The TLR5 ligand flagellin has been proposed to elicit either Th1- or Th2-type immunity in mice (16, 17). Based on the observations that mouse DCs did not produce any IL-12 p70 upon flagellin stimulation, we investigated whether flagellin would promote Th2-biased responses. Mice were immunized s.c. with FliC, OVA, and OVA supplemented with FliC or CpG oligonucleotide as a Th1-promoting TLR9-dependent adjuvant (32). Ten days later the secretion of IL-4, IL-13, and IFN-{gamma} was measured in OVA-stimulated lymph node cells (Fig. 4a). T cells from FliC-immunized animals did not induce any cytokine release when incubated in vitro with OVA. As expected, immunization with CpG resulted in Th1 polarization, characterized by the secretion of IFN-{gamma}, but not IL-4 or IL-13. The production of IL-4 and IL-13, cytokines specific for Th2 responses, was only detected in T cells from animals immunized with FliC and OVA (Fig. 4a). As reported for other Th2-type inducing stimuli (33), significant production of IFN-{gamma} was found in the group treated with FliC and OVA. The mouse genotype did not influence the T cell response, as C57BL/6 mice behaved similarly to BALB/c mice (Fig. 5a). These data demonstrate that flagellin promotes the development of Th2 cytokine-producing T cells in vivo.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 4. Flagellin promotes the development of Th2-type immune responses in vivo. a, BALB/c mice (n = 3) were immunized s.c. with FliC (10 µg), OVA (10 µg), or CpG (100 µg) as indicated. Ten days later cells from lymph nodes were incubated for 72 h with OVA, and the concentrations of IL-4, IL-13, and IFN-{gamma} in supernatants were measured in triplicate. Results are representative of three experiments and are similar to those for spleen. b, BALB/c mice were adoptively transferred with CFSE-labeled, OVA-specific CD4+ T cells. On day 1 mice (n = 2) were injected with PBS, FliC (10 µg), OVA (100 µg), or CpG (100 µg). Three days later the CFSE fluorescence of cells from peripheral lymph nodes was analyzed by flow cytometry. Absolute numbers of transgenic OVA-specific CD4+ T cells (x106) are indicated on the histograms. The results shown are representative of three experiments and are similar to those obtained with splenocytes. c, The mRNA levels of IL-4, and IFN-{gamma} genes were quantified by real-time RT-PCR in OVA-specific CD4+ T cells sorted on day 3 from animals injected as described in b. IL-4 and IFN-{gamma} levels were normalized with respect to the porphobilinogen deaminase gene and are presented as arbitrary expression units. n.d., not detected. The results shown are representative of two experiments.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 5. MyD88-dependent stimulation of immunity by flagellin. C57BL/6 (a and c) or MyD88–/– (b and d) mice (n = 3–5) were immunized s.c. on days 0 and 21 with OVA (10 µg) in combination with PBS, FliC (10 µg), trypsin-treated FliC (equivalent to 10 µg), CpG (50 µg), or CFA as indicated. a and b, Seven days after boosting, cells from lymph nodes cells were incubated for 72 h with medium ({square}) or 500 µg/ml OVA ({blacksquare}), and the concentrations of IL-4, IL-13, and IFN-{gamma} in supernatants were measured. Similar results were found with splenocytes. c and d, Total OVA-specific IgG in serum were analyzed by ELISA on day 28. Results are expressed as the reciprocal geometric mean of Ab titers.

 
To further characterize the T cell response, CFSE-labeled, OVA-specific, transgenic CD4+ T cells were transferred into naive animals and then injected i.v. with PBS, FliC, OVA alone, or OVA in combination with FliC or CpG (Fig. 4b). Three days later the proliferation of CFSE-positive cells in spleen or lymph nodes was analyzed by flow cytometry. Neither FliC nor PBS induced proliferation of transferred CD4+ T cells, indicating that flagellin has no direct effect on OVA-specific T cells. A limited number of cells underwent divisions in animals treated with OVA alone in contrast to the study performed with OVA323–339 Th peptide (17). In contrast, coadministration of OVA with flagellin resulted in a dramatic increase in OVA-specific CD4+ T cell proliferation similar to that observed with CpG and OVA. The absolute number of transgenic T cells was also markedly increased. These experiments indicate that flagellin potentates the in vivo activation of Ag-specific CD4+ T cells. OVA-specific CD4+ T cells were further isolated from spleens of immunized animals to analyze IL-4 and IFN-{gamma} gene expression by real-time RT-PCR (Fig. 4c). Injection of OVA with CpG resulted in Th1 polarization, i.e., IFN-{gamma} expression, but no IL-4 expression. Although IFN-{gamma} was similarly expressed in all groups, IL-4 expression was dramatically enhanced in transgenic CD4+ T cells isolated from animals injected with FliC and OVA. Together our observations indicate that flagellin promotes the production of IL-4 by CD4+ T cells, the signature cytokine of a Th2-type response.

Flagellin adjuvant effect requires MyD88

The importance of TLR signaling in Th1 induction is mostly based on the observation that MyD88-deficient mice are unable to mount Th1 responses when CFA, which contains TLR agonists, is used as adjuvant (7). Experiments were conducted to define the role of MyD88 in the adjuvant properties of flagellin (Fig. 5). MyD88-deficient animals and their wild-type counterparts, C57BL/6, were immunized as described above. As observed with BALB/c mice, flagellin triggered OVA-specific Th2-biased responses, whereas CpG elicited Th1 responses (Fig. 5a). In MyD88 animals, flagellin, like CpG, did not trigger any response in knockout animals (Fig. 5b). In contrast, CFA stimulated the secretion of IL-4 and IL-13, thereby inducing Th2-type responses (Fig. 5b). We then investigated the Ab response associated with T cell priming in immunized animals. Indeed, when flagellin was coinjected with OVA, the OVA-specific serum IgG response increased >20-fold (Fig. 4c). This effect was effective at doses of flagellin ranging from 100 ng to 30 µg/animal, but was totally abolished when flagellin was digested by trypsin before injection (Figs. 5 and 6). In addition, flagellin caused a marked increase in anti-OVA IgG1 titers without significantly increasing the anti-OVA IgG2a response in various mouse genetic backgrounds, such as C57BL/6, BALB/c, C3H/HeJ, and NMRI (Fig. 6). In MyD88 animals, flagellin did not potentate any OVA-specific responses compared with CFA (Fig. 5d). As reported for innate immunity (14), the effect of flagellin on adaptive immunity, especially on the development of Th2-biased responses, was therefore strictly dependent on the adapter molecule MyD88.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. Development of IgG1 response does not depend on Ag dose or flagellin dose. a, Dose response of OVA. BALB/c mice (n = 3) were immunized s.c. on days 0 and 21 with OVA (10–100 µg) alone or in combination with FliC (30 µg) as indicated. Similar results were obtained with C57BL/6 animals. b, Dose response of flagellin. BALB/c mice (n = 3) were immunized s.c. on days 0 and 21, and NMRI mice were immunized once with OVA (10 µg), alone or in combination with various doses of FliC as indicated. IgG1 and IgG2a responses specific for OVA (a and b) and flagellin (a) were analyzed by ELISA on day 28. Cross-reactivity between IgG2c and IgG2a was used to specifically detect IgG2c Abs, the signature isotype for Th2-biased response in C57BL/6 mouse. Histograms correspond to absorbance values obtained with a 1/1000 serum dilution. Individual animals are represented by circles, and geometric means are shown by horizontal bars.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DCs are instrumental for the development of Th cell responses (2, 3). In particular, it has been postulated that MyD88-dependent TLR activators promote Th1 responses (7, 8). In this study we provide evidence that flagellin induces Th2-biased responses in a MyD88-dependent manner. We observed that flagellin induces MyD88-dependent maturation of DCs both in vivo and in vitro. In vivo, flagellin induces the development of IL-4-producing CD4+ T cells, a hallmark of Th2 polarization. This effect is associated with the lack of Th1-polarizing cytokine IL-12 p70 production by flagellin-stimulated DCs.

A major concern in analysis of PRR stimulatory activity is contamination of the PAMP preparation by unrelated ligands, especially for in vivo studies or studies with DCs. Our flagellin preparations were first characterized for the presence of bioactive flagellin using intestinal epithelial cells as reported previously (19, 28). Although gangliosides have been reported to contribute to signaling, the flagellin-mediated effect is essentially dependent on TLR5 stimulation and MyD88 (14, 29, 34, 35). To rule out any direct contribution of ligands for TLR2, TLR3, TLR4, TLR6, and TLR9 in the flagellin preparation, we used endotoxin-depleted purified flagellin combined with B cell activation assays, which can detect these elicitors (data not shown). In addition, flagellin was fully effective at inducing maturation of splenic DC in mice with impaired TLR2 and TLR4 signaling. Together these data strongly support the idea that the bacterial product responsible for biological activity on DCs and adaptive immunity is flagellin, the TLR5 ligand. Although we determined that flagellin promotes Th2 responses in a MyD88-dependent manner. TLR5-deficient mice should be assayed to define the unique and specific role of TLR5 in this process.

The most striking finding is that Th2-biased differentiation is associated with MyD88-dependent activation of DCs. Although CpG and flagellin both induce the production of IFN-{gamma} by OVA-specific T cells, only flagellin promotes the secretion of Th2-specific cytokines, IL-4 and IL-13. How can signaling in DC via distinct TLRs give rise to different CD4+ T cell polarizations? Several mechanisms, including cell subsets, state of maturation, and cytokine release, could account for such a difference. CD8{alpha} DCs have been proposed to be involved in Th2 priming (36). Our experiments suggest that flagellin-programmed Th2-type differentiation is not controlled by a specific DC subset, as the whole DC population is activated in vivo (Figs. 1c and 2a). Th2 development has been associated with strong costimulatory signals provided by activated DCs (3). After injection of flagellin, splenic DCs were activated, with the level of costimulatory molecules higher than that after CpG injection (data not shown). CpG and flagellin have similar capacities to prime OVA-specific T cells, but have distinct effects on T cell polarization (Fig. 5). The role of costimulatory molecules in flagellin-mediated, Th2-type responses is therefore not conclusive and will require further investigations. Th1/Th2 development can be influenced by the Ag dose provided to DCs. In the study by McSorley et al. (17), flagellin administration with the Th peptide OVA323–339 also resulted in IFN-{gamma} production by CD4 T cells, but IL-4 production was not reported. This Th1-type promoting effect of flagellin, which diverges from our data, suggests that either the dose of Ag or the processing and presentation of whole OVA provide essential information for T cell polarization. The doses of whole OVA used in our work are 220-fold lower than the dose of peptide used by McSorley et al. (17), assuming that each OVA molecule will generate a Th peptide. We also observed a lower activation of DO11.10 cells with OVA compared with that obtained with OVA323–339 peptide, which alone triggers a strong proliferation without any microbial stimuli. This discrepancy in Th1/Th2 balance could therefore be attributed to an Ag dose effect in which a high Ag dose favors Th1 responses. Alternatively, flagellin activity on Ag processing and presentation in DCs such as occurs during immunization with a complete Ag may change the context in which T cell polarization occurs. Finally, the commitment to a Th1/Th2 phenotype depends on a specific pattern of cytokines released by DCs. The TLR stimuli tested to date (i.e., LPS, peptidoglycan, dsRNA, and CpG) promote and/or enhance the development of Th1-type responses as well as IL-12 p70 secretion by DCs (31, 32, 37, 38). The lack of IL-12 p70 secretion and the low levels of IL-6 and TNF-{alpha} appear to be unique to flagellin signaling and probably to TLR5 (Fig. 3a). Interestingly, flagellin-mediated activation of human DCs is also characterized by a distinct cytokine pattern compared with LPS-mediated activation, including lack of IL-12 p70 secretion (18). This singularity was already suggested by the moderate signs of inflammation triggered by flagellin compared with other TLR ligands (26, 39). The failure of DC to produce IL-12 p70 or other Th1-promoting cytokines, such as the cytokines IL-23 and IL-27, during T cell sensitization could directly impair Th1 development, expansion, or maintenance. Flagellin-dependent Th2 commitment could also rely on Th1-suppressive mechanisms, such as secretion of IL-10 or TGF-{beta} or production of Th2-inducing cytokines (31).

This study challenges the observations of Means et al. (18) concerning stimulation of isolated splenic mouse DC. Nevertheless, we also found that splenic DCs incubated ex vivo with flagellin were not stimulated. Sorted DCs undergo spontaneous maturation that masks subsequent flagellin activation. It is known that any treatment of DCs is sufficient to induce their spontaneous maturation, in particular magnetic beads or FACS sorting, collagenase treatment, movement of culture dishes, or dislodgment of DC clusters (40, 41). Therefore, DC activation was analyzed directly in vivo after i.v. injection of flagellin or on BMDCs (Figs. 1 and 2). In our study splenic DCs as well as BMDCs express TLR5 and are fully activated by flagellin in a MyD88-dependent process. In addition, B lymphocytes that do not have any TLR5 transcripts are totally unresponsive to flagellin (data not shown). The recent study by Agrawal et al. (13) proposes that flagellin-activated human DC express IL-12-p70, in contrast to Means’s work (18). The cellular and molecular mechanisms of these differences remain to be elucidated. To shed light on the controversial studies of flagellin activity on Th responses, several cues should be explored, including the purity of flagellin preparations, the influence of Ag (OVA peptide, self-Ag for mixed lymphocyte reactions, or OVA protein), the relevance of readouts (in vivo or in vitro), the phenotype of DCs (in vitro- or in vivo-derived DCs, as well as the level of TLR5 expression), and host specificity (rodent vs human).

Recent reports proposed that TLR2 and TLR4 play a role in Th2 differentiation (9, 10, 11, 12). These studies propose that MyD88-independent mechanisms and the dose of TLR agonists contribute to Th2 polarization. Thus, the difference in T cell differentiation induced by flagellin compared with TLR stimuli may reside in distinct quantitative and qualitative signals. Our data show that in DC the factors that constitute the core TLR-specific signaling pathway, i.e., MyD88, NF-{kappa}B, and IL-12 p40 expression, are conserved in TLR5 if we assume that flagellin-mediated signaling totally depends on TLR5 activation as described by others (14, 29, 42, 43). We assessed whether the level of DC activation could explain the difference between CpG and flagellin. Upon flagellin injection, DCs are activated, and IL-12 p40 is secreted as for TLR-activating signals, suggesting a similar intensity of signaling. In addition, the outcome of activation is independent of flagellin dose, suggesting that TLR5 per se may be sufficient for instructing Th2-biased differentiation. The unique property of flagellin is probably due to a qualitative difference in the signaling machinery. For instance, TLRs have individual specificities, characterized by specific signaling complexes composed of MyD88 and accessory adapter molecules (such as Toll/IL-1R domain-containing adapter protein (TIRAP), Toll-interacting protein, and Toll/IL-1R domain-containing adapter-inducing IFN-{beta}), which define the specificity of TLR2, TLR3, and TLR4 signaling (44, 45, 46). TLR5 does not require TIRAP(45), but whether other adaptors can modulate signal transduction through TLR5 is yet not known. The host cell glycolipid asialo-ganglioside monosialic acid 1 can bind flagellin and induce specific signaling, including mobilization of calcium and activation of mitogen-activated protein kinase (extracellular signal-regulated kinase 1/2) (34). We show that MyD88-dependent processes are essential for the development of flagellin-promoted Th2-type immunity, but TLR5 cooperation with PRRs such as asialo-GM1 may modulate the outcome of the response, as described recently for TLR2 and dectin-1 (47). Flagellin therefore represents a unique model to dissect TLR-associated signaling machinery specialized in development of Th2-biased responses.

How pathogens influence Th2 differentiation is poorly characterized and has consequently been classified as a default pathway. In this study flagellin was unambiguously shown to be the PAMP responsible for Th2 commitment. Usually, products used to study Th1/Th2 balance are composed of a mixture of microbial structures. For instance, CFA, Toxoplasma extract, or Schistosoma egg Ags are probably composed of several PAMPs that individually signal through PRRs promoting Th1 or Th2 responses. Similarly, commercial Ags or PAMP preparations that are considered pure PAMPs undoubtedly contain microbial contaminants, especially LPS. Under these conditions, a hierarchy between the various PRR signals may account for the preferential instruction of Th1 or Th2 responses. Such a model is supported by recent observations showing that Th1-promoting TLR-specific signals appear to predominate over MyD88-independent Th2-promoting signals (8).

In conclusion, our observations support a broader importance of TLRs in immune responses against pathogens. The combination of TLRs stimulated by the various PAMPs displayed by microbes might result in the fine-tuning of adaptive immune responses.


    Acknowledgments
 
We thank Drs. F. Niedergang, D. Finke, M. Rumbo, R. Voyle, M. Corbett, and H. Acha-Orbea for helpful discussions, and P. Zaech, I. Surbeck, and F. Hoegger for excellent technical assistance. We are grateful to Drs. A. Aguzzi and M. Prinz (Institute of Neuropathology, Zurich, Switzerland) for MyD88–/– mice, to Dr. K. Hughes (University of Washington, Seattle, WA) for Salmonella strains, to Dr. A. Aderem for hTLR5 expression plasmid (Institute for Systems Biology, Seattle, WA), to Prof. J. Louis and Dr. H. Voigt (World Health Organization, Epalinges, Switzerland) for the IL-4 bioassay, to Prof. R. Steinman (Yale University, New Haven, CT) for the C4H3 Ab, to Dr. B. Valsazina (Biochemistry Institute, Epalinges, Switzerland) for DO11.10 SCID mice, and to Dr. A. Wilson (Ludwig Institute, Epalinges, Switzerland) for Abs.


    Footnotes
 
1 This work was supported by grants from Institut National de la Santé et de la Recherche Médicale (Program AVENIR R02344ES), the Région Nord Pas de Calais (ARCir émergence), the Fondation pour la Recherche Médicale (to J.C.S.), the Swiss National Science Foundation (3100-067926.02 and PRN Molecular Oncology; to J.P.K.), the European Union (QLRT-PL1999-01321 and OFES 99.041-1 and -2; to J.P.K. and J.C.S.), and Grant 31-59165-99 (to L.A.O.). Back

2 Address correspondence and reprint requests to Dr. Jean-Claude Sirard, Institut de Biologie de Lille, Groupe AVENIR, Institut National de la Santé et de la Recherche Médicale, d’Immunité Anti-Microbienne des Muqueuses, E0364, 1 rue du Professeur Calmette, BP 447, 59021 Lille Cedex, France. E-mail address: jean-claude.sirard{at}ibl.fr Back

3 Abbreviations used in this paper: DC, dendritic cell; BM, bone marrow; BMDC, BM-derived DC; MyD88, myeloid differentiation factor 88; HEL, hen egg lysozyme; PAMP, pathogen-associated molecular pattern; PRR, pattern recognition receptor; RPMI-5, RPMI 1640 containing 5% FCS; TLR, Toll-like receptor. Back

Received for publication December 5, 2003. Accepted for publication March 23, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  2. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1:199.[Medline]
  3. Jankovic, D., Z. Liu, W. C. Gause. 2001. Th1- and Th2-cell commitment during infectious disease: asymmetry in divergent pathways. Trends Immunol. 22:450.[Medline]
  4. Janeway, C. A., Jr, R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. Immunol. 20:197.[Medline]
  5. Barton, G. M., R. Medzhitov. 2002. Control of adaptive immune responses by Toll-like receptors. Curr. Opin. Immunol. 14:380.[Medline]
  6. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11:115.[Medline]
  7. Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira, R. Medzhitov. 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2:947.[Medline]
  8. Jankovic, D., M. C. Kullberg, S. Hieny, P. Caspar, C. M. Collazo, A. Sher. 2002. In the absence of IL-12, CD4+ T cell responses to intracellular pathogens fail to default to a Th2 pattern and are host protective in an IL-10–/– setting. Immunity 16:429.[Medline]
  9. Re, F., J. L. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem. 276:37692.[Abstract/Free Full Text]
  10. Pulendran, B., P. Kumar, C. W. Cutler, M. Mohamadzadeh, T. Van Dyke, J. Banchereau. 2001. Lipopolysaccharides from distinct pathogens induce different immune responses in vivo. J. Immunol. 167:5067.[Abstract/Free Full Text]
  11. Kaisho, T., K. Hoshino, T. Iwabe, O. Takeuchi, T. Yasui, S. Akira. 2002. Endotoxin can induce MyD88-deficient dendritic cells to support Th2 cell differentiation. Int. Immunol. 14:695.[Abstract/Free Full Text]
  12. Eisenbarth, S. C., D. A. Piggott, J. W. Huleatt, I. Visintin, C. A. Herrick, K. Bottomly. 2002. Lipopolysaccharide-enhanced, Toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J. Exp. Med. 196:1645.[Abstract/Free Full Text]
  13. Agrawal, S., A. Agrawal, B. Doughty, A. Gerwitz, J. Blenis, T. Van Dyke, B. Pulendran. 2003. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein c-Fos. J. Immunol. 171:4984.[Abstract/Free Full Text]
  14. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099.[Medline]
  15. Smith, K. D., E. Andersen-Nissen, F. Hayashi, K. Strobe, M. A. Bergman, S. L. Barrett, B. T. Cookson, A. Aderem. 2003. Toll-like receptor 5 recognizes a conserved site on flagellin protofilament formation and bacterial motility. Nat. Immunol. 16:16.
  16. Parish, C. R.. 1996. Immune deviation: a historical perspective. Immunol. Cell. Biol. 74:449.[Medline]
  17. McSorley, S. J., B. D. Ehst, Y. Yu, A. T. Gewirtz. 2002. Bacterial flagellin is an effective adjuvant for CD4+ T cells in vivo. J. Immunol. 169:3914.[Abstract/Free Full Text]
  18. Means, T. K., F. Hayashi, K. D. Smith, A. Aderem, A. D. Luster. 2003. The Toll-like receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells. J. Immunol. 170:5165.[Abstract/Free Full Text]
  19. Sierro, F., B. Dubois, A. Coste, D. Kaiserlian, J. P. Kraehenbuhl, J. C. Sirard. 2001. Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of dendritic cells. Proc. Natl. Acad. Sci. USA 98:13722.[Abstract/Free Full Text]
  20. Carlsen, H., J. O. Moskaug, S. H. Fromm, R. Blomhoff. 2002. In vivo imaging of NF-{kappa}B activity. J. Immunol. 168:1441.[Abstract/Free Full Text]
  21. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223:77.[Medline]
  22. Anjuere, F., P. Martin, I. Ferrero, M. L. Fraga, G. M. del Hoyo, N. Wright, C. Ardavin. 1999. Definition of dendritic cell subpopulations present in the spleen, Peyer’s patches, lymph nodes, and skin of the mouse. Blood 93:590.[Abstract/Free Full Text]
  23. Reis e Sousa, C., R. N. Germain. 1999. Analysis of adjuvant function by direct visualization of antigen presentation in vivo: endotoxin promotes accumulation of dendritic cells in the T cell areas of lymphoid tissue. J. Immunol. 162:6552.[Abstract/Free Full Text]
  24. Favre, N., P. Erb. 1993. Use of the CTL44 cell line, a derivative of CTL/L cells, to identify and quantify mouse interleukin-4 by bioassay. J. Immunol. Methods 164:213.[Medline]
  25. Sebastiani, G., G. Leveque, L. Lariviere, L. Laroche, E. Skamene, P. Gros, D. Malo. 2000. Cloning and characterization of the murine Toll-like receptor 5 (Tlr5) gene: sequence and mRNA expression studies in Salmonella-susceptible MOLF/Ei mice. Genomics 64:230.[Medline]
  26. Renshaw, M., J. Rockwell, C. Engleman, A. Gewirtz, J. Katz, S. Sambhara. 2002. Impaired Toll-like receptor expression and function in aging. J. Immunol. 169:4697.[Abstract/Free Full Text]
  27. Edwards, A. D., S. S. Diebold, E. M. Slack, H. Tomizawa, H. Hemmi, T. Kaisho, S. Akira, C. Reis e Sousa. 2003. Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8{alpha}+ DC correlates with unresponsiveness to imidazoquinolines. Eur. J. Immunol. 33:827.[Medline]
  28. Gewirtz, A. T., P. O. Simon, C. K. Schmitt, L. J. Taylor, C. H. Hagedorn, A. D. O’Brien, A. S. Neish, J. L. Madara. 2001. Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response. J. Clin. Invest. 107:99.[Medline]
  29. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, J. L. Madara. 2001. Bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J. Immunol. 167:1882.[Abstract/Free Full Text]
  30. Kaisho, T., O. Takeuchi, T. Kawai, K. Hoshino, S. Akira. 2001. Endotoxin-induced maturation of MyD88-deficient dendritic cells. J. Immunol. 166:5688.[Abstract/Free Full Text]
  31. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3:133.[Medline]
  32. Chu, R. S., O. S. Targoni, A. M. Krieg, P. V. Lehmann, C. V. Harding. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.[Abstract/Free Full Text]
  33. Launois, P., I. Maillard, S. Pingel, K. G. Swihart, I. Xenarios, H. Acha-Orbea, H. Diggelmann, R. M. Locksley, H. R. MacDonald, J. A. Louis. 1997. IL-4 rapidly produced by V{beta}4V{alpha}8 CD4+ T cells instructs Th2 development and susceptibility to Leishmania major in BALB/c mice. Immunity 6:541.[Medline]
  34. McNamara, N., A. Khong, D. McKemy, M. Caterina, J. Boyer, D. Julius, C. Basbaum. 2001. ATP transduces signals from ASGM1, a glycolipid that functions as a bacterial receptor. Proc. Natl. Acad. Sci. USA 98:9086.[Abstract/Free Full Text]
  35. Ogushi, K. I., A. Wada, T. Niidome, T. Okuda, R. Llanes, M. Nakayama, Y. Nishi, H. Kurazono, K. D. Smith, A. Aderem, et al 2004. Gangliosides act as co-receptors for Salmonella enteritidis FliC and promote FliC-induction of human {beta}-defensin-2 expression in Caco-2 cells. J. Biol. Chem. 279:12213.[Abstract/Free Full Text]
  36. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8{alpha}+ and CD8{alpha} subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.[Abstract/Free Full Text]
  37. Edwards, A. D., S. P. Manickasingham, R. Sporri, S. S. Diebold, O. Schulz, A. Sher, T. Kaisho, S. Akira, E. S. C. Reis. 2002. Microbial recognition via Toll-like receptor-dependent and -independent pathways determines the cytokine response of murine dendritic cell subsets to CD40 triggering. J. Immunol. 169:3652.[Abstract/Free Full Text]
  38. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y. J. Liu, A. O’Garra. 2003. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation. J. Exp. Med. 197:101.[Abstract/Free Full Text]
  39. Liaudet, L., K. G. Murthy, J. G. Mabley, P. Pacher, F. G. Soriano, A. L. Salzman, C. Szabo. 2002. Comparison of inflammation, organ damage, and oxidant stress Salmonella enterica serovar Muenchen flagellin and serovar lipopolysaccharide. Infect. Immun. 70:192.[Abstract/Free Full Text]
  40. Gatti, E., M. A. Velleca, B. C. Biedermann, W. Ma, J. Unternaehrer, M. W. Ebersold, R. Medzhitov, J. S. Pober, I. Mellman. 2000. Large-scale culture and selective maturation of human Langerhans cells from granulocyte colony-stimulating factor-mobilized CD34+ progenitors. J. Immunol. 164:3600.[Abstract/Free Full Text]
  41. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787.[Medline]
  42. Moors, M. A., L. Li, S. B. Mizel. 2001. Activation of interleukin-1 receptor-associated kinase by Gram-negative flagellin. Infect. Immun. 69:4424.[Abstract/Free Full Text]
  43. Weinmann, A. S., D. M. Mitchell, S. Sanjabi, M. N. Bradley, A. Hoffmann, H. C. Liou, S. T. Smale. 2001. Nucleosome remodeling at the IL-12 p40 promoter is a TLR-dependent, Rel-independent event. Nat. Immunol. 2:51.[Medline]
  44. Zhang, G., S. Ghosh. 2002. Negative regulation of Toll-like receptor-mediated signaling by Tollip. J. Biol. Chem. 277:7059.[Abstract/Free Full Text]
  45. Horng, T., G. M. Barton, R. A. Flavell, R. Medzhitov. 2002. The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors. Nature 420:329.[Medline]
  46. Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa, T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-{beta} induction. Nat. Immunol. 4:161.[Medline]
  47. Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira, D. M. Underhill. 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J. Exp. Med. 197:1107.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. T. Bates, S. Uematsu, S. Akira, and S. B. Mizel
Direct Stimulation of tlr5+/+ CD11c+ Cells Is Necessary for the Adjuvant Activity of Flagellin
J. Immunol., June 15, 2009; 182(12): 7539 - 7547.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B.-Z. Wang, F.-S. Quan, S.-M. Kang, J. Bozja, I. Skountzou, and R. W. Compans
Incorporation of Membrane-Anchored Flagellin into Influenza Virus-Like Particles Enhances the Breadth of Immune Responses
J. Virol., December 1, 2008; 82(23): 11813 - 11823.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Nempont, D. Cayet, M. Rumbo, C. Bompard, V. Villeret, and J.-C. Sirard
Deletion of Flagellin's Hypervariable Region Abrogates Antibody-Mediated Neutralization and Systemic Activation of TLR5-Dependent Immunity
J. Immunol., August 1, 2008; 181(3): 2036 - 2043.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. J. Sanders, D. A. Moore III, I. R. Williams, and A. T. Gewirtz
Both Radioresistant and Hemopoietic Cells Promote Innate and Adaptive Immune Responses to Flagellin
J. Immunol., June 1, 2008; 180(11): 7184 - 7192.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. Simon, D. M. Heithoff, M. J. Mahan, and C. E. Samuel
Comparison of Tissue-Selective Proinflammatory Gene Induction in Mice Infected with Wild-Type, DNA Adenine Methylase-Deficient, and Flagellin-Deficient Salmonella enterica
Infect. Immun., December 1, 2007; 75(12): 5627 - 5639.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. Fransen, C. J. Boog, J. P. van Putten, and P. van der Ley
Agonists of Toll-Like Receptors 3, 4, 7, and 9 Are Candidates for Use as Adjuvants in an Outer Membrane Vaccine against Neisseria meningitidis Serogroup B
Infect. Immun., December 1, 2007; 75(12): 5939 - 5946.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R.-M. Salazar-Gonzalez, A. Srinivasan, A. Griffin, G. Muralimohan, J. M. Ertelt, R. Ravindran, A. T. Vella, and S. J. McSorley
Salmonella Flagellin Induces Bystander Activation of Splenic Dendritic Cells and Hinders Bacterial Replication In Vivo
J. Immunol., November 1, 2007; 179(9): 6169 - 6175.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Kato, W. Lu, H. Kai, and K. C. Kim
Phosphoinositide 3-kinase is activated by MUC1 but not responsible for MUC1-induced suppression of Toll-like receptor 5 signaling
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L686 - L692.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. K. Wong, P. F. Y. Cheung, W. K. Ip, and C. W. K. Lam
Intracellular Signaling Mechanisms Regulating Toll-Like Receptor-Mediated Activation of Eosinophils
Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 85 - 96.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. T. Gewirtz
TLRs in the Gut. III. Immune responses to flagellin in Crohn's disease: good, bad, or irrelevant?
Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G706 - G710.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
P. Winkler, D. Ghadimi, J. Schrezenmeir, and J.-P. Kraehenbuhl
Molecular and Cellular Basis of Microflora-Host Interactions
J. Nutr., March 1, 2007; 137(3): 756S - 772S.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. J. Sanders, Y. Yu, D. A. Moore III, I. R. Williams, and A. T. Gewirtz
Humoral immune response to flagellin requires T cells and activation of innate immunity.
J. Immunol., September 1, 2006; 177(5): 2810 - 2818.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Feuillet, S. Medjane, I. Mondor, O. Demaria, P. P. Pagni, J. E. Galan, R. A. Flavell, and L. Alexopoulou
Involvement of Toll-like receptor 5 in the recognition of flagellated bacteria
PNAS, August 15, 2006; 103(33): 12487 - 12492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Sfondrini, A. Rossini, D. Besusso, A. Merlo, E. Tagliabue, S. Menard, and A. Balsari
Antitumor Activity of the TLR-5 Ligand Flagellin in Mouse Models of Cancer.
J. Immunol., June 1, 2006; 176(11): 6624 - 6630.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Caron, L. Lariviere, M. Nacache, M. Tam, M. M. Stevenson, C. McKerly, P. Gros, and D. Malo
Influence of Slc11a1 on the Outcome of Salmonella enterica Serovar Enteritidis Infection in Mice Is Associated with Th Polarization.
Infect. Immun., May 1, 2006; 74(5): 2787 - 2802.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Didierlaurent, B. Brissoni, D. Velin, N. Aebi, A. Tardivel, E. Kaslin, J. C. Sirard, G. Angelov, J. Tschopp, and K. Burns
Tollip Regulates Proinflammatory Responses to Interleukin-1 and Lipopolysaccharide
Mol. Cell. Biol., February 1, 2006; 26(3): 735 - 742.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. N. Honko, N. Sriranganathan, C. J. Lees, and S. B. Mizel
Flagellin Is an Effective Adjuvant for Immunization against Lethal Respiratory Challenge with Yersinia pestis
Infect. Immun., February 1, 2006; 74(2): 1113 - 1120.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. E. Lee, S. Y. Kim, B. C. Jeong, Y. R. Kim, S. J. Bae, O. S. Ahn, J.-J. Lee, H.-C. Song, J. M. Kim, H. E. Choy, et al.
A Bacterial Flagellin, Vibrio vulnificus FlaB, Has a Strong Mucosal Adjuvant Activity To Induce Protective Immunity
Infect. Immun., January 1, 2006; 74(1): 694 - 702.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
O. Pino, M. Martin, and S. M. Michalek
Cellular Mechanisms of the Adjuvant Activity of the Flagellin Component FljB of Salmonella enterica Serovar Typhimurium To Potentiate Mucosal and Systemic Responses
Infect. Immun., October 1, 2005; 73(10): 6763 - 6770.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Tsujimoto, T. Uchida, P. A. Efron, P. O. Scumpia, A. Verma, T. Matsumoto, S. K. Tschoeke, R. F. Ungaro, S. Ono, S. Seki, et al.
Flagellin enhances NK cell proliferation and activation directly and through dendritic cell-NK cell interactions
J. Leukoc. Biol., October 1, 2005; 78(4): 888 - 897.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. H. Rhee, E. Im, M. Riegler, E. Kokkotou, M. O'Brien, and C. Pothoulakis
Pathophysiological role of Toll-like receptor 5 engagement by bacterial flagellin in colonic inflammation
PNAS, September 20, 2005; 102(38): 13610 - 13615.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. E. Applequist, E. Rollman, M. D. Wareing, M. Liden, B. Rozell, J. Hinkula, and H.-G. Ljunggren
Activation of Innate Immunity, Inflammation, and Potentiation of DNA Vaccination through Mammalian Expression of the TLR5 Agonist Flagellin
J. Immunol., September 15, 2005; 175(6): 3882 - 3891.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Freeman, M. Hewison, S. V. Hughes, K. N. Evans, D. Hardie, T. K. Means, and R. Chakraverty
Expression of 11{beta}-hydroxysteroid dehydrogenase type 1 permits regulation of glucocorticoid bioavailability by human dendritic cells
Blood, September 15, 2005; 106(6): 2042 - 2049.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-L. Chu and C. A. Lowell
The Lyn Tyrosine Kinase Differentially Regulates Dendritic Cell Generation and Maturation
J. Immunol., September 1, 2005; 175(5): 2880 - 2889.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Sundquist and M. J. Wick
TNF-{alpha}-Dependent and -Independent Maturation of Dendritic Cells and Recruited CD11cintCD11b+ Cells during Oral Salmonella Infection
J. Immunol., September 1, 2005; 175(5): 3287 - 3298.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Kaiserlian, N. Cerf-Bensussan, and A. Hosmalin
The mucosal immune system: from control of inflammation to protection against infections
J. Leukoc. Biol., August 1, 2005; 78(2): 311 - 318.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Caron, D. Duluc, I. Fremaux, P. Jeannin, C. David, H. Gascan, and Y. Delneste
Direct Stimulation of Human T Cells via TLR5 and TLR7/8: Flagellin and R-848 Up-Regulate Proliferation and IFN-{gamma} Production by Memory CD4+ T Cells
J. Immunol., August 1, 2005; 175(3): 1551 - 1557.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. R. Hawn, H. Wu, J. M. Grossman, B. H. Hahn, B. P. Tsao, and A. Aderem
A stop codon polymorphism of Toll-like receptor 5 is associated with resistance to systemic lupus erythematosus
PNAS, July 26, 2005; 102(30): 10593 - 10597.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Pulendran
Variegation of the Immune Response with Dendritic Cells and Pathogen Recognition Receptors
J. Immunol., March 1, 2005; 174(5): 2457 - 2465.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Didierlaurent, A.
Right arrow Articles by Sirard, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Didierlaurent, A.
Right arrow Articles by Sirard, J.-C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS