|
|
||||||||



* Division of Neurosurgery and
Infectious Diseases, University of Pennsylvania, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
and TNF-
production and increased HLA-DR expression, in transfected macrophages and dendritic cells. The siRNAs induced low, but significant, levels of IFN-
in HEK293 and HaCaT cells. Secretion of these cytokines increased tremendously when HEK293 cells overexpressed Toll-like receptor 3 (TLR3), and the increased secretion of IFN-
was inhibited by coexpression of an inhibitor of TIR domain-containing adapter-inducing IFN-
, the TLR3 adaptor protein linked to IFN regulatory factor 3 signaling. Although siRNA and shRNA knockdown of genes represents a new and powerful tool, it is not without nonspecific effects, which we demonstrate are mediated in part by signaling through TLR3. | Introduction |
|---|
|
|
|---|
, and the generation of 2'-5'-oligoadenylate, which activates RNase L (1). The initial studies of RNAi in mammalian cells were complicated by the activation of not sequence specific suppression by the long dsRNA used to activate the system (2). A major breakthrough occurred when it was hypothesized that as at least 30 bp of dsRNA was required to activate these sequence-independent suppressive systems; thereby the use of 21-bp small interfering RNA (siRNA), similar in size to the products of DICER, would not produce activation (3). Two recent reports demonstrate that plasmid-delivered short hairpin RNA (shRNA) induces IFN-
(4), and extracellularly delivered siRNA induces a set of IFN-inducible genes that are dependent on PKR (5), suggesting that this hypothesis may be incorrect.
The main family of dsRNA binding domain (DRBD)-containing proteins, which exhibit an 


structure and have high homology throughout evolution, is found in many proteins with diverse functions, including host defense; cellular stress; translation activation; mRNA localization, transportation, and processing; RNA editing; and endoribosomal activities (reviewed in Refs. 6 and 7). As few as 11 bp of dsRNA can bind a DRBD, and 17 bp of dsRNA efficiently activates PKR (8, 9), a DRBD-containing protein important in antiviral defense, cellular stress, and multiple signaling pathways. Other dsRNA binding motifs have been identified, including zinc finger-containing motifs and lysine-rich regions (reviewed in Refs. 6 and 7). Toll-like receptors (TLRs) are a germline-encoded family that recognizes pathogen-associated molecular patterns and host proteins associated with danger (reviewed in Refs. 10 and 11). TLR3 is a receptor of dsRNA (12) and cellular mRNA (13). It does not contain obvious dsRNA binding motifs, but shares leucine repeat protein binding motifs with other TLR, suggesting that a dsRNA binding protein may mediate the interaction. TLR3 signals through NF-
B, PKR, and IFN regulatory factor 3 (IRF-3) pathways (14, 15, 16, 17) and is dependent on two adapter proteins for signaling; one, MyD88, is shared with all TLR, and the second, TIR domain-containing adapter-inducing IFN-
(TRIF), is used by TLR3 and TLR4 and mediates the induction of type 1 IFN through IRF-3 and activation of an antiviral response (15, 17).
The early studies of siRNA treatment of mammalian cells suggested that specific reduction of targeted mRNA was observed without nonspecific (sequence-independent) mRNA degradation or protein synthesis inhibition (3, 18). In this report we demonstrate that siRNA and shRNA signal through TLR3 and induce cellular activation, including the generation of type I IFN and TNF-
, and sequence-independent inhibition of gene expression.
| Materials and Methods |
|---|
|
|
|---|
HEK293 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 2 mM glutamine (Invitrogen, Carlsbad, CA) and 10% FCS (HyClone, Ogden, UT) (complete medium). The TLR3293 cell line, derived from 293 cells after transformation with pELAM-luciferase (luc) and pCMV6-XL5 containing human TLR3 cDNA (Origen Technologies, Rockville, MD), were grown in complete medium with zeocin (125 µg/ml) and G418 (400 µg/ml; Invitrogen). Drosophila Schneider line 2 (SL2; American Type Culture Collection) was grown in Schneiders Drosophila medium (Invitrogen) supplemented with 10% FCS. The immortalized human keratinocyte cell line, HaCaT, obtained from Prof. N. Fusenig (German Cancer Research Center, Heidelberg, Germany) (19) was cultured in complete medium containing 15 mM HEPES, 50 µg/ml gentamicin, and 2.5 mg/l fungizone (Invitrogen).
Leukopheresis samples were obtained from HIV-uninfected volunteers through an institutional review board-approved protocol. PBMC were purified by Ficoll-Hypaque density gradient purification. Monocytes were produced as described previously (20) and were cultured in AIM V serum-free medium (Life Technologies, Gaithersburg, MD) supplemented with GM-CSF (50 ng/ml) and IL-4 (100 ng/ml; R&D Systems, Minneapolis, MN) to generate immature dendritic cells (DCs). Fresh medium containing cytokines was added to the cells on days 2 and 5. The resulting DCs were used between 6 and 9 days after initial culture of monocytes.
Monocyte-derived macrophages (MDMs) were obtained by culturing monocytes in complete medium supplemented with 100 U/ml M-CSF (R&D Systems). Medium was changed every 3 days, and macrophages were used on day 6 or 7 of culture.
SiRNA and shRNA
SiRNAs and shRNAs were by made by several different methods. The same sequence for each gene target was used when methods of synthesis differed to avoid additional variance. A suffix of 1 or 2 was added to the name of the RNAs to denote their chemical or enzymatic origin, respectively. All siRNA and shRNA contained two additional nucleotides (UU) at their 3' ends. Using chemical synthesis (Dharmacon, Lafayette, CO), gE1, gag1, and luc1 siRNA, homologous to mRNAs encoding gE protein of HSV, HIV gag and firefly luciferase were generated. The sense strands of the gE1, gag1, and luc1 siRNAs correspond to (pAAUAUACGAAUCGUGUCUGUA), (pGAUGGUGCUUCAAGCUAGUAC), and (pGAAACGAUAUGGGCUGAAUAC), respectively (21). In the chemically synthesized luc1 shRNA, a UUAA loop joined the luc-specific complementary sequences. Using the T7 RNA polymerase-mediated transcription method (Silencer siRNA Construction kit; Ambion, Austin, TX), gE2, luc2, and mannose receptor (MR) 2 (MR-specific) (PCCTAATAATTATCAAAATGT) siRNAs were synthesized. When MR2 shRNA and CD4-2 shRNA (UGAAGUGGAGGACCAGAAG), which targeted to human CD4 mRNA, were transcribed, the complementary sequences were linked by an AAUU loop. SiRNAs were also generated by digesting long dsRNA, corresponding to gag and luciferase-encoding sequences, with RNase III-specific enzyme (DICER, Silencer siRNA Cocktail kit; Ambion). RNase-resistant shRNAs targeted to cleave luciferase and gag mRNAs were synthesized as previously described (21) using a Dura-Script kit (Epicentre, Madison, WI). All siRNA and shRNA, analyzed by PAGE under denaturing conditions as described previously (21), demonstrated to be of the correct length and without contamination. Following annealing, the siRNAs were reanalyzed by PAGE under nondenaturing condition and found to have the length expected if they form dsRNA.
Treatment of cells
TLR3293 (also called 293), SL2, and HaCaT cells were seeded into 96-well plates 1 day before stimulation and were cultured without antibiotics. MDM and DC were cultured in 48-well plates. Cells were stimulated with medium, lipofectin alone, ssRNA, poly(I):poly(C) dsRNA (Sigma-Aldrich, St. Louis, MO), and siRNA and shRNA (5 µg/ml;
330 nM of siRNA or shRNA depending on sequence) complexed with lipofectin (22). In certain experiments F-siRNAs were added at 50 µg/ml without lipofectin complexing. Eight or 24 h later supernatants were collected for cytokine measurement, and where indicated, cells were lysed with luciferase lysis buffer (Promega, Madison, WI) and analyzed with luciferase substrate (Promega) in an MLX luminometer (Dynatech Laboratories, Chantilly, VA).
Transient transfections
293 cells seeded into 96-well plates at 6080% confluence were transfected with pUnoTLR3 (Invivogen, San Diego, CA) and pCMV-luc (22) and pEF-BOS TRIF dominant negative (TRIFdn) (17) or pEF-BOS control expression plasmids using the FuGENE 6 reagent (Roche, Indianapolis, IN). Twenty-four hours later cells were stimulated with the indicated ligands, and supernatants were collected 8 h later for cytokine measurement.
Analysis of MDM cell surface markers
MDM were stained with MR-PE mAb (Research Diagnostics, Flanders, NJ) or HLA-DR-PE mAb and analyzed on a FACScan flow cytometer using CellQuest Pro software (BD Biosciences, Mountain View, CA).
ELISAs for cytokines
Supernatants from treated macrophages, DC, HaCaT, TLR3293, and 293 cells were collected at 8 or 24 h for cytokine measurement. IFN-
, IFN-
, TNF-
, and IL-8 (BioSource International, Camarillo, CA) were measured by sandwich ELISA. Cultures were performed in duplicate to quadruplicate and were measured in duplicate.
| Results |
|---|
|
|
|---|
|
or IFN-
. A significant increase in type I IFN was observed in all cell types (Fig. 2 and data not shown). The induction of IFN and sequence-independent suppression of both endogenous and exogenous gene expression suggested that an innate immune response was induced by externally added siRNA and shRNA, which is in agreement with a recently published paper demonstrating activation of IFN signaling pathways (5).
|
B, IRF-3, and PKR signaling pathways (14, 15, 17, 23, 24, 25). HEK293 cells stably overexpressing TLR3 were treated with siRNA. Signaling through this receptor was documented by measuring luc production from an NF-
B reporter plasmid or the induction of endogenous IL-8 (26) (Fig. 3A and data not shown), which demonstrated comparable signaling by siRNA compared with poly(I):poly(C). In comparison with 293 cells (Fig. 2A), TLR3293 cells produced much more IFN-
in response to siRNA and shRNA and poly(I):poly(C) (Fig. 3B). HEK293 cells expressed low levels of TLR3 mRNA by Northern blot (data not shown), which probably accounts for their ability to respond to extracellular siRNA. Thus, siRNA induced sequence independent suppression of endogenous and exogenous gene expression probably by signaling through TLR3.
|
similar to those observed for poly(I):poly(C) (Fig. 4B). No activation was observed with the addition of poly(C) RNA homopolymers or sense or antisense 21-bp ssRNAs used to make the siRNAs (data not shown).
|
, IFN-
, and HLA-DR up-regulation was observed (Fig. 5A and data not shown). Interestingly, poly(I):poly(C) stimulation was the most inhibited by 2-aminopurine. We hypothesize that whereas siRNA and shRNA and poly(I):poly(C) signal through TLR3, siRNA and shRNA either have a decreased ability to enter and remain active in the cell or are less efficient activators of PKR. This demonstrates that in TLR3-expressing cells, the majority of activation by siRNA and shRNA occurs independently of PKR.
|
(Fig. 5B), demonstrating that TLR3 signaling or another TRIF-using signaling system was responsible for extracellular siRNA and shRNA activation of the IFN signaling pathway.
Having identified TLR3 as a likely mediator of siRNA and shRNA activation, we next ask what role TLR3 played in the ability to specifically suppress gene expression by siRNA. SL2 insect cells, which lack TLR3 and PKR, and TLR3293 cells were treated with increasing concentrations of control and luc-specific siRNAs similar to the experiment shown in Fig. 1A. Total RNA transfected was kept constant by adding poly(C) homopolymer. SL2 cells demonstrated no suppression of luc expression by the control siRNA and a concentration-dependent silencing of luc expression by the luc2 siRNA (Fig. 6A). HEK293 cells demonstrated concentration-dependent inhibition by both control and luc-specific siRNA. The IC50 of each siRNA for each cell line was calculated. For HEK293 cells, the IC50 differed by
2 logs between control and luc-specific siRNA (Fig. 1). In TLR3293 cells, the IC50 differed by <0.5 logs (Fig. 6B).
|
| Discussion |
|---|
|
|
|---|
. The likeliest explanation for the difference in results is that the T98G cell line does not express or has very low level expression of TLR3.
For the most part, TLR do not directly bind ligands, but, instead, contain protein interaction domains that bind other molecules that bind the ligand. For most TLR, these accessory molecules have not been identified. Alexopoulou et al. (12) were the first to report that dsRNA is the specific ligand for TLR3 by demonstrating that TLR3 recognizes and responds to viral or synthetic dsRNA, but not to homopolymer ssRNA. Previous studies suggested that the dsRNA binding proteins, PKR and 2',5'-oligoadenylate synthetase, required at least 30 bp of dsRNA for efficient activation, whereas other studies suggested that as little as 17 bp of dsRNA could signal (8, 9), In this study we present evidence that TLR3 responds to siRNA and shRNA with the production of type I IFN, IL-8, and TNF-
; activation of NF-
B promoters; and induction of sequence-independent gene suppression. It is conceivable that the first component of the TLR3 signaling cascade, probably a dsRNA-binding protein that has yet to be characterized, might efficiently interact with one helical turn of dsRNA within siRNA and shRNA (
11 bp) (7, 28), as has been suggested for other dsRNA-binding proteins (7), thus allowing short segments of dsRNA to signal.
The use of siRNA and shRNA as a tool in mammalian systems is commonplace. Our results demonstrate that these reagents may have unwanted effects; induction of a sequence-independent gene suppression, cellular activation, and type I IFN and proinflammatory cytokine production need to be considered in the analysis of results. These events appear to be dependent on the level of expression of TLR3, such that nonimmune cells, such as HaCaT and 293, with low levels of TLR3 have minimal type I IFN production, but still significant sequence-independent suppression, whereas DC and macrophages, with high TLR3 expression, yield high level cytokine production, sequence-independent gene suppression, and cellular activation. The use of siRNA, delivered by expression constructs or directly as a treatment for numerous diseases, has been proposed. The observation that these therapeutics may have sequence-independent suppressive properties as well as cellular activation potentials will need to be considered in their development.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Drew Weissman, Division of Infectious Diseases, University of Pennsylvania, 522B Johnson Pavilion, Philadelphia, PA 19104. E-mail address: dreww{at}mail.med.upenn.edu ![]()
3 Abbreviations used in this paper: RNAi, RNA interference; DC, dendritic cell; DRBD, dsRNA binding domain; HEK, human embryonic kidney; IRF3, IFN regulatory factor 3; luc, luciferase; MDM, monocyte-derived macrophage; MR, mannose receptor; sh, short hairpin; si, small interfering; SL2, Drosophila Schneider line 2; TLR3, Toll-like receptor 3; PKR, RNA-dependent protein kinase; TRIF, TIR domain-containing adapter-inducing IFN-
. ![]()
Received for publication December 3, 2003. Accepted for publication March 18, 2004.
| References |
|---|
|
|
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
induction. Nat. Immunol. 4:161.[Medline]
promoter in the Toll-like receptor signaling. J. Immunol. 169:6668.
B and MAP kinases is through an IRAK-independent pathway employing signaling components TLR3-TRAF6-TAK1-TAB 2-PKR. J. Biol. Chem. 278:16713.This article has been cited by other articles:
![]() |
R. HUHN, M. S. STAEGE, M. HESSE, B. LIEBIG, and S. E.G. BURDACH Cleavage of the Ewing Tumour-specific EWSR1-FLI1 mRNA by Hammerhead Ribozymes Anticancer Res, June 1, 2009; 29(6): 1901 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. J. O'Neill, C. E. Bryant, and S. L. Doyle Therapeutic Targeting of Toll-Like Receptors for Infectious and Inflammatory Diseases and Cancer Pharmacol. Rev., June 1, 2009; 61(2): 177 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Lewin, G. Liew, P. Mitchell, T. Y. Wong, R. Allikmets, A. A. Bergen, M. Dean, R. H. Guymer, G. S. Hageman, C. C. Klaver, et al. Geographic Atrophy in Age-Related Macular Degeneration and TLR3 N. Engl. J. Med., May 21, 2009; 360(21): 2251 - 2256. [Full Text] [PDF] |
||||
![]() |
W. G. Cho, R. J. C. Albuquerque, M. E. Kleinman, V. Tarallo, A. Greco, M. Nozaki, M. G. Green, J. Z. Baffi, B. K. Ambati, M. De Falco, et al. Small interfering RNA-induced TLR3 activation inhibits blood and lymphatic vessel growth PNAS, April 28, 2009; 106(17): 7137 - 7142. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. de Almagro, S. Coma, V. Noe, and C. J. Ciudad Polypurine Hairpins Directed against the Template Strand of DNA Knock Down the Expression of Mammalian Genes J. Biol. Chem., April 24, 2009; 284(17): 11579 - 11589. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. M. Ferreira, M. C. Cheung, S. Missailidis, S. Bisland, and J. Gariepy Phototoxic aptamers selectively enter and kill epithelial cancer cells Nucleic Acids Res., February 1, 2009; 37(3): 866 - 876. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Trapp, N. R. Derby, R. Singer, A. Shaw, V. G. Williams, S. G. Turville, J. W. Bess Jr., J. D. Lifson, and M. Robbiani Double-Stranded RNA Analog Poly(I:C) Inhibits Human Immunodeficiency Virus Amplification in Dendritic Cells via Type I Interferon-Mediated Activation of APOBEC3G J. Virol., January 15, 2009; 83(2): 884 - 895. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, C. Stratton, P. J. Francis, M. E. Kleinman, P. L. Tan, D. Gibbs, Z. Tong, H. Chen, R. Constantine, X. Yang, et al. Toll-like Receptor 3 and Geographic Atrophy in Age-Related Macular Degeneration N. Engl. J. Med., October 2, 2008; 359(14): 1456 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. West and B. Damania Upregulation of the TLR3 Pathway by Kaposi's Sarcoma-Associated Herpesvirus during Primary Infection J. Virol., June 1, 2008; 82(11): 5440 - 5449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Armstrong, M. Gantier, L. Li, W. Y. Chung, A. McCann, J. A. Baugh, and S. C. Donnelly Small Interfering RNAs Induce Macrophage Migration Inhibitory Factor Production and Proliferation in Breast Cancer Cells via a Double-Stranded RNA-Dependent Protein Kinase-Dependent Mechanism J. Immunol., June 1, 2008; 180(11): 7125 - 7133. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhang, Q. Wang, Y. Xie, G. Mor, E. Sega, P. S. Low, and Y. Huang Receptor-mediated delivery of siRNAs by tethered nucleic acid base-paired interactions RNA, March 1, 2008; 14(3): 577 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Eberle, K. Giessler, C. Deck, K. Heeg, M. Peter, C. Richert, and A. H. Dalpke Modifications in Small Interfering RNA That Separate Immunostimulation from RNA Interference J. Immunol., March 1, 2008; 180(5): 3229 - 3237. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gondai, K. Yamaguchi, N. Miyano-Kurosaki, Y. Habu, and H. Takaku Short-hairpin RNAs synthesized by T7 phage polymerase do not induce interferon Nucleic Acids Res., February 11, 2008; 36(3): e18 - e18. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marshall-Clarke, J. E. Downes, I. R. Haga, A. G. Bowie, P. Borrow, J. L. Pennock, R. K. Grencis, and P. Rothwell Polyinosinic Acid Is a Ligand for Toll-like Receptor 3 J. Biol. Chem., August 24, 2007; 282(34): 24759 - 24766. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Johnson, V. Albarani, M. Nguyen, M. Goldman, F. Willems, and E. Aksoy Protein Kinase C{alpha} Is Involved in Interferon Regulatory Factor 3 Activation and Type I Interferon-beta Synthesis J. Biol. Chem., May 18, 2007; 282(20): 15022 - 15032. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jagannath and M. Wood RNA interference based gene therapy for neurological disease Brief Funct Genomic Proteomic, May 3, 2007; (2007) elm005v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. De Paula, M. V. L.B. Bentley, and R. I. Mahato Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting RNA, April 1, 2007; 13(4): 431 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Derbigny, S.-C. Hong, M. S. Kerr, M. Temkit, and R. M. Johnson Chlamydia muridarum Infection Elicits a Beta Interferon Response in Murine Oviduct Epithelial Cells Dependent on Interferon Regulatory Factor 3 and TRIF Infect. Immun., March 1, 2007; 75(3): 1280 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Bell, I. Botos, P. R. Hall, J. Askins, J. Shiloach, D. R. Davies, and D. M. Segal The molecular structure of the TLR3 extracellular domain Innate Immunity, December 1, 2006; 12(6): 375 - 378. [Abstract] [PDF] |
||||
![]() |
S. Q. Harper, P. D. Staber, C. R. Beck, S. K. Fineberg, C. Stein, D. Ochoa, and B. L. Davidson Optimization of Feline Immunodeficiency Virus Vectors for RNA Interference J. Virol., October 1, 2006; 80(19): 9371 - 9380. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Jiang and D. S. Pisetsky The Role of IFN-{alpha} and Nitric Oxide in the Release of HMGB1 by RAW 264.7 Cells Stimulated with Polyinosinic-Polycytidylic Acid or Lipopolysaccharide. J. Immunol., September 1, 2006; 177(5): 3337 - 3343. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Pawar, P. S. Patole, M. Wornle, and H.-J. Anders Microbial nucleic acids pay a Toll in kidney disease Am J Physiol Renal Physiol, September 1, 2006; 291(3): F509 - F516. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Reynolds, E. M. Anderson, A. Vermeulen, Y. Fedorov, K. Robinson, D. Leake, J. Karpilow, W. S. Marshall, and A. Khvorova Induction of the interferon response by siRNA is cell type- and duplex length-dependent RNA, June 1, 2006; 12(6): 988 - 993. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Jou, J. H. Lee, S. Y. Park, H. J. Yoon, E.-H. Joe, and E. J. Park Gangliosides Trigger Inflammatory Responses via TLR4 in Brain Glia Am. J. Pathol., May 1, 2006; 168(5): 1619 - 1630. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun, K. E. Duffy, C. T. Ranjith-Kumar, J. Xiong, R. J. Lamb, J. Santos, H. Masarapu, M. Cunningham, A. Holzenburg, R. T. Sarisky, et al. Structural and Functional Analyses of the Human Toll-like Receptor 3: ROLE OF GLYCOSYLATION J. Biol. Chem., April 21, 2006; 281(16): 11144 - 11151. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-b. Li, D. Y. M. Leung, C. F. Hall, and E. Goleva Divergent expression and function of glucocorticoid receptor {beta} in human monocytes and T cells J. Leukoc. Biol., April 1, 2006; 79(4): 818 - 827. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. de Bouteiller, E. Merck, U. A. Hasan, S. Hubac, B. Benguigui, G. Trinchieri, E. E. M. Bates, and C. Caux Recognition of Double-stranded RNA by Human Toll-like Receptor 3 and Downstream Receptor Signaling Requires Multimerization and an Acidic pH J. Biol. Chem., November 18, 2005; 280(46): 38133 - 38145. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Senn, S. Burel, and S. P. Henry Non-CpG-Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88 J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 972 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Bell, I. Botos, P. R. Hall, J. Askins, J. Shiloach, D. M. Segal, and D. R. Davies The molecular structure of the Toll-like receptor 3 ligand-binding domain PNAS, August 2, 2005; 102(31): 10976 - 10980. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Sledz and B. R. G. Williams RNA interference in biology and disease Blood, August 1, 2005; 106(3): 787 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Orinska, E. Bulanova, V. Budagian, M. Metz, M. Maurer, and S. Bulfone-Paus TLR3-induced activation of mast cells modulates CD8+ T-cell recruitment Blood, August 1, 2005; 106(3): 978 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Choe, M. S. Kelker, and I. A. Wilson Crystal Structure of Human Toll-Like Receptor 3 (TLR3) Ectodomain Science, July 22, 2005; 309(5734): 581 - 585. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Mandell, B. A. Babbin, A. Nusrat, and C. A. Parkos Junctional Adhesion Molecule 1 Regulates Epithelial Cell Morphology through Effects on {beta}1 Integrins and Rap1 Activity J. Biol. Chem., March 25, 2005; 280(12): 11665 - 11674. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Shankar, N. Manjunath, and J. Lieberman The Prospect of Silencing Disease Using RNA Interference JAMA, March 16, 2005; 293(11): 1367 - 1373. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Aksoy, C. S. Zouain, F. Vanhoutte, J. Fontaine, N. Pavelka, N. Thieblemont, F. Willems, P. Ricciardi-Castagnoli, M. Goldman, M. Capron, et al. Double-stranded RNAs from the Helminth Parasite Schistosoma Activate TLR3 in Dendritic Cells J. Biol. Chem., January 7, 2005; 280(1): 277 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang and G. G. Carmichael Effects of Length and Location on the Cellular Response to Double-Stranded RNA Microbiol. Mol. Biol. Rev., September 1, 2004; 68(3): 432 - 452. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |