The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, K.-Z.
Right arrow Articles by Spurkland, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, K.-Z.
Right arrow Articles by Spurkland, A.
The Journal of Immunology, 2004, 172: 6144-6151.
Copyright © 2004 by The American Association of Immunologists

Transcriptional Activation of the SH2D2A Gene Is Dependent on a Cyclic Adenosine 5'-Monophosphate-Responsive Element in the Proximal SH2D2A Promoter1

Ke-Zheng Dai*,§, Finn-Eirik Johansen{dagger}, Kristin Melkevik Kolltveit{ddagger}, Hans-Christian Aasheim, Zlatko Dembic{ddagger}, Frode Vartdal* and Anne Spurkland2,*,§

* Institute of Immunology and {dagger} Institute of Pathology, National University Hospital; {ddagger} Department of Oral Biology and § Institute of Anatomy, University of Oslo; and Department of Immunology, Norwegian Radium Hospital, Oslo, Norway


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The SH2D2A gene, encoding the T cell-specific adapter protein (TSAd), is rapidly induced in activated T cells. In this study we investigate the regulation of the SH2D2A gene in Jurkat T cells and in primary T cells. Reporter gene assays demonstrated that the proximal 1-kb SH2D2A promoter was constitutively active in Jurkat TAg T cells and, to a lesser extent, in K562 myeloid cells, Reh B cells, and 293T fibroblast cells. The minimal SH2D2A promoter was located between position –236 and –93 bp from the first coding ATG, and transcriptional activity in primary T cells depended on a cAMP response element (CRE) centered around position –117. Nuclear extracts from Jurkat TAg cells and activated primary T cells contained binding activity to this CRE, as observed in an EMSA. Consistent with this observation, we found that a cAMP analog was a very potent inducer of SH2D2A mRNA expression in primary T cells as measured by real-time RT-PCR. Furthermore, activation of SH2D2A expression by CD3 stimulation required cAMP-dependent protein kinase activity. Thus, transcriptional regulation of the SH2D2A gene in activated T cells is critically dependent on a CRE in the proximal promoter region.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
T cell activation is controlled by a variety of different intracellular signaling proteins, including adapter proteins that serve as scaffolds for protein-protein interactions during the signal transduction cascade (1). Proper down-regulation of T cell activation is important for the normal functioning of the immune system. Failure to turn off activated T cells may lead to lymphoproliferation and autoimmune disease, as seen in patients with mutations in genes encoding proteins related to regulation of activation-induced apoptosis in T cells (2). The importance of proper regulation of T cell activation for immune homeostasis is also exemplified by experimental animals in which the expression of regulatory proteins has been abolished by genetic engineering. As an example, mice lacking expression of the adapter protein cas-br-m murine ecotropic retroviral transforming sequence homologue (cbl), which is a negative regulator of T cell signaling, develop spontaneous autoimmunity (3).

Proteins involved in signal transduction in T cells may be ubiquitously expressed, such as phosphoinositide 3-kinase, protein kinase C, and phosphoprotein associated with glycosphingolipid-enriched microdomains. Other proteins, such as the protein tyrosine kinases Lck (4) and ZAP-70 (5) and the adapter proteins TCR-interacting molecule (6) and Src kinase-associated phosphoprotein of 55 kDa (7), are preferentially expressed in T cells or cells of lymphoid origin. Moreover, some of the proteins involved in the regulation of T cell activation are inducible or up-regulated after the initial activation of T cells. One example of the latter is the CTLA-4 gene, which encodes a membrane receptor competing with CD28 for binding to B7. CTLA-4 is induced in T cells after activation (8) and has been found to play an inhibitory role in T cell activation (9). Polymorphism in the CTLA-4 gene influencing the expression level of the protein is associated with a number of diseases with presumed autoimmune etiology (10).

We have recently cloned a novel gene, SH2D2A, that encodes the T cell-specific adapter protein (TSAd).3 TSAd inhibits early signal transduction events when overexpressed in Jurkat T cell lines (11) and is rapidly induced in activated T cells (11, 12) SH2D2A mRNA expression is observed in primary T cells 2 h after stimulation with anti-CD3, anti-CD4, or anti-CD8 Abs or after exposure to activated macrophages in vitro (12). TSAd may have multiple functions in the cell, as it is observed to translocate to the nucleus in activated Jurkat T cells (13). The murine counterpart has been cloned as a binding partner for Itk and Rlk (14) and MEKK5, a mitogen-activated protein kinase kinase (15). We have also found that a GA repeat-length polymorphism in the promoter of the SH2D2A gene is associated with multiple sclerosis (16), suggesting that TSAd dysregulation may be associated with immunological disorders. In support of this idea, it was recently observed that mice lacking the murine TSAd gene develop spontaneous autoimmune disease with age (17). TSAd may therefore represent an inducible modulator of signal transduction in activated T cells.

In this study we have examined the regulation of SH2D2A expression in more detail. Luciferase reporter gene assay demonstrated that a 1-kb fragment of the SH2D2A promoter was sufficient for tissue-specific expression. We found that the transcriptional activity of the minimal promoter in primary T cells was dependent on a cAMP response element (CRE) located around position –117 from the first ATG. Consistent with this observation, we found that a synthetic cAMP analog was a very potent inducer of SH2D2A mRNA expression in primary T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells

T cells (Jurkat TAg), B cells (Reh), and myeloid cells (K562) were grown in RPMI 1640 supplemented with 10% FCS, whereas fibroblasts (293T) were grown in RPMI 1640 supplemented with 5% FCS. Fibroblasts were kept below a cell density of 80% confluence, whereas cells in suspension were kept between 0.3 x 106 and 1 x 106/ml. Cell viability was always verified to be >95% before transfection.

Primary resting T cells for transfection studies and SH2D2A mRNA expression analysis were positively selected from buffy coats as previously described (18) using anti-CD4-coated Dynabeads (Dynal Biotech, Oslo, Norway). Primary T cells for EMSA were isolated from buffy coats by separation over nylon wool columns according to standard procedure. Cells were stimulated as described in Results using CD3 or CD3/CD28 Dynabeads (Dynal Biotech), the cAMP analog 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP), or 2 µg/ml PHA.

Reporter gene constructs

A 1-kb fragment of the SH2D2A promoter containing 23 GA repeats was subcloned. Briefly, a PCR product was obtained by amplifying the 1-kb promoter fragment from the chromosome 1-specific clone AH118a10 (LL01NC01; HGMP, Cambridge, U.K.) (19) using the following primers: primer 1, 5'-CCAGCCTGGGTGACAGAG-3'; and primer 2,5'-AACTCCATGGGGGCAGCCTC-3' to introduce a NcoI site at the first coding ATG. The blunt-ended PCR product was inserted into the pMOSBlue cloning vector (Pharmacia Biotech, Uppsala, Sweden) for sequencing. The verified insert was then moved into a luciferase reporter plasmid (pGL3-Basic, Promega, Madison, WI). This construct was designated GA23-GL3. An additional construct containing an additional 2-kb fragment 5' of the promoter as well as 13 GA repeats at position –340 was similarly cloned and was designated GA13-long-GL3.

Truncations of the promoter construct were performed using the QuikChange kit (Stratagene, La Jolla, CA) following the instructions of the manufacturer. To truncate the promoter, KpnI restriction sites were introduced at various positions in the SH2D2A promoter construct GA23-GL3, and deletions were made by digesting the generated construct with KpnI, followed by religation of the vector fragment. For mutation of the palindrome at position –96, an EcoRV site was introduced to disrupt the palindromic structure. The palindrome sequence was thus changed from 5'-CCTGCCCCCGGGGCCAGG-3' into 5'-CCTGCCCCCGATATCAGG-3'. All SH2D2A promoter constructs generated by PCR were sequenced to ascertain that spurious mutations were not included in the analysis.

Transient transfection assay

Cells in suspension (Jurkat TAg, Reh, and K562) were transfected by electroporation. Cells at a density of ~1 x 106/ml were washed twice with RPMI 1640 medium without any additives before transfection. Cells (10 x 106) were transfected with 5 µg of the reporter plasmid gene (firefly luciferase) and 1 µg of the internal control plasmid, a thymidine kinase promoter-directed Renilla luciferase plasmid (TK-RL2; Promega). Electroporation was performed with a BTX electroporator (Genetronics, San Diego, CA) using a 200 low voltage setting and 70 ms at room temperature in a 0.4-cm electroporation cuvette (BTX; Genetronics). Sixteen to 24 h after transfection, 1.5 x 106 cells from each transfection were harvested and washed twice with PBS (pH 7.4). Transfectants were resuspended in 50 µl of 1x Passive Lysis Buffer (Promega), and luciferase activity was measured (Dual-Luciferase Reporter Assay System; Promega). The promoter activity was evaluated as the relative activity between the firefly luciferase activity and the Renilla luciferase activity in each cell lysate.

Adherent cells (293T) were transfected by Lipofectamine reagent (Invitrogen, Paisley, U.K.) according to the protocol of the manufacturer with 5 µg of reporter gene plasmids and 1 µg of control plasmid for each 2 x 106 cells. After incubation with transfection solution for 12 h, cells were washed and harvested in PBS and subsequently analyzed for luciferase activity as described above.

Primary T cells were transfected using the AMAXA nucleofector (AMAXA, Cologne, Germany) according to the manufacturer’s description. Briefly, 5 x 106 cells were transfected with 3 µg of each SH2D2A-promoter reporter gene construct and 0.2 µg of the internal transfection control plasmid. The cells were then stimulated with anti-CD3/CD28-coated Dynabeads (0.5 bead/cell; Dynal Biotech) for 16 h before assaying for luciferase activity as described above.

Quantitative RT-PCR of SH2D2A transcripts

For RT-PCR, total RNA was extracted from T cells using TRIzol reagent (Life Technologies, Merlbebeke, Belgium). Slight modifications were made to the protocol (increased incubation time at all steps, the amount of isopropanol increased from 500 µl to 1 ml). cDNA was synthesized in a 20-µl reaction buffer containing 20 U/µl Moloney murine leukemia virus reverse transcriptase, 250 µg/ml oligo(dT), 10 µM dNTP (2.5 µM concentrations of each), 36 U/µl RNase inhibitor (RNAguard; Pharmacia Biotech), and 5x RT buffer by incubation for 1 h at 37°C. The enzyme was inactivated for 5 min at 90°C. The cDNA were stored at –20°C until further processing.

Quantitation of TSAd transcripts was performed by real-time PCR, using the following custom-made primers and probes specific for TSAd and Zap70, respectively: HuTSAdFW, 5'-TGCTACTTGGTGCGGTTCAG; huTSAdRV, 5'-GCAAGTCCGGCTCCTGTAAG; HuTSAd-probe, 6AGAGCGCGGTGACCTTCGTG0; HuZAP-70FW, ACACCCTCAACTCAGATGGATACA; HuZAP-70RV, TCGGCCGCGGTTTGT; HuZAP-70probe, 6CCCTGAGCCAGCACGCATAACGT0. Both probes were labeled with FAM at the 5' end and with TAMRA at the 3' end. Primers and probes were designed using Primer Express (PE Applied Biosystems, Foster City, CA) and were ordered from Sigma-Genosys (Cambridge, U.K.).

A standard curve was constructed for TSAd and ZAP-70. Serial dilutions of plasmids containing an insert with either TSAd or ZAP-70 were made containing 1000, 100, 10, and 1 fg/µl the plasmid. The quantity of TSAd was estimated relative to the quantity of ZAP-70. The choice of ZAP-70 as a housekeeping gene was based on our previous studies that showed that the amount of ZAP-70 is relatively stable during the various phases of T cell activation (16).

All PCR were performed using an ABI PRISM 7900 Sequence Detection System (PerkinElmer, PE Applied Biosystems). The reaction mixture contained the TaqMan Universal Master Mix (PerkinElmer, PE Applied Biosystems) and specific primers/probe set. The thermal cycling conditions comprised an initial denaturation step at 95°C for 10 min and 40 cycles at 95°C for 15 s and at 60°C for 1 min. Each PCR run included the four points of the standard curves and nontemplate controls. Experiments were performed in triplicate (or duplicate when indicated) for each data point.

EMSA

EMSA was performed according to standard methods (20). Nuclear extracts of Jurkat T cells were prepared by extraction of isolated nuclei in 0.3 M KCl. Radiolabeled probes generated using oligonucleotides (Table I) covering the entire minimal promoter (–246 to –47) or 45- to 65-bp parts thereof were generated using PCR amplification and inclusion of [32P]{alpha}CTP in the PCR. Probes were purified by centrifugation through Micro Spin S-400 HR columns (Amersham Pharmacia Biotech, Little Chalfont, U.K.). EMSA was performed by incubating 2 µg of nuclear extract with 1 fmol of radiolabeled probe in the presence of 1.5 µg of dIdC as a nonspecific competitor with or without 100 fmol of cold specific competitor or nonspecific competitor derived from the coding part of the SH2D2A cDNA in a 20-µl reaction buffer containing 20 mM HEPES (pH 7.9), 20% glycerol, 0.2 mM EDTA, 0.1 M KCl, 0.5 mM PMSF, 1 mM DTT, and 1 mM sodium orthovanadate for 20 min at room temperature. Binding reactions were separated on a 4.5% nondenaturing polyacrylamide gel in 1x Tris-boric acid-EDTA buffer with 10% glycerol for 2 h. The gels were dried and exposed for autoradiography.


View this table:
[in this window]
[in a new window]
  		Table I. Oligos used for generating electromobility shift probes

 
EMSA supershift analysis was performed using a rat polyclonal antiserum against aa 5–45 of CRE-binding protein 1 (CREB-1; Abcam, Cambridge, U.K.), a mouse mAb against aa 39–217 of activation transcription factor 1 (ATF1) (Santa Cruz Biotechnology, Santa Cruz, CA), a rabbit polyclonal antiserum raised against amino acids 1–96 of ATF2 (Santa Cruz) and a rabbit polyclonal antiserum raised against the C-terminal peptide of CREB-2 or ATF4 (Santa Cruz Biotechnology). Nuclear extracts were preincubated with 40 µg of antiserum or 2 µg of Ab before addition of radiolabeled probe. The binding reaction was separated by electrophoresis as described above. CREB competitor oligo was designed based on a previous report (21) as well as on the CREB consensus sequence as found in the TRANSFAC 4.0 (22). (CREB-con: 5'-CTCCTTGGCTGACGTCAGAGAGAG). An additional commercially available CRE gel shift oligonucleotides (CRE-SC: 5'-AGAGATTGCCTGACGTCAGAGAGCTAG) was obtained from Santa Cruz Biotechnology.

Prediction of the putative transcription factors binding sites in the minimal promoter

The putative transcription factors binding sites were predicted by using MatInspector Professional program (Genomatix Software GmbH, Munich, Germany; (23) or Alibaba2 (BIOBASE GmbH, Wolfenbüttel, Germany) which both use transcription factor database TRANSFAC 4.0. The DNA sequence from –236 to + 1 upstream of the first ATG of the SH2D2A promoter containing the minimal promoter was submitted to the program for analysis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Tissue specificity and inducibility of the SH2D2A promoter

We previously observed that expression of the SH2D2A gene is rapidly induced in T cells after triggering of the CD3, the CD4 or the CD8 receptor (12). To test the tissue specificity of the SH2D2A promoter we subcloned a 1 kb and a 3 kb fragment of the promoter extended to the ATG start codon into a luciferase reporter vector. These constructs contained a 23 GA repeat allele (GA23-GL3) and a 13 GA repeat allele (GA13-long-GL3) respectively, and were transfected into fibroblast cells (293T), B cells (Reh), myeloid cells (K562) and T cells (Jurkat TAg). The results showed that both SH2D2A-promoter constructs promoted luciferase expression in Jurkat T cells and K562 cells, and to a lesser extent in Reh and 293T cells (Fig. 1). The expression of the GA23-GL3 construct was only marginally influenced by stimulation of the transfected Jurkat T cells through the TCR/CD3 complex, as we observed stimulation indexes of 1.4–1.6 in repeated experiments (data not shown).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 1. SH2D2A promoter activity in various cell lines. A 1- or 3-kb SH2D2A promoter fragment was isolated from the genomic cosmid clone AH118a10 and inserted into a firefly luciferase vector to create GA23-GL3 and GA13-long-GL3 long, respectively. These constructs were transfected into cell lines representing fibroblasts (293T), B cells (Reh), T cells (Jurkat Tag), and myeloid cells (K562), respectively. The thymidine kinase promoter-driven Renilla luciferase construct (TK-RL2) was used as an internal control. Results are shown as the percentage of firefly luciferase activity normalized to Renilla luciferase activity for each cell type compared with that in Jurkat Tag cells. The results shown are the mean of two independent experiments ± SD.

 
Identification of promoter sequences influencing the expression of the SH2D2A gene

The SH2D2A gene contains no TATA box or other known regulatory elements for transcription initiation (19). To identify the minimal promoter of the SH2D2A gene, we performed a series of truncations of the GA23-GL3 constructs removing ~100 bp from the 5' end in each consecutive truncation (Fig. 2A). The constructs were tested for promoter activity in Jurkat T cells. The data showed that there are putative enhancer elements between regions –1010/-820, –630/-500 and –310/-240, and a putative silencer element in the region encompassed by –500/-310. The minimal promoter of the SH2D2A gene was found to be located proximally to position –236 upstream of the first coding ATG (Fig. 2B). We decided to first focus our interest on the minimal promoter of the SH2D2A gene.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2. Identification of promoter sequences influencing expression of the SH2D2A gene. A, Schematic diagram of GA23-GL3 and truncated versions generated as described in Materials and Methods. B, Luciferase activity was assessed in lysates of Jurkat TAg cells transiently transfected with the indicated promoter constructs and TK-RL2 as an internal control vector. Results shown are the mean of the normalized firefly luciferase activity ± SD of three independent experiments.

 
Using the MatInspector Professional and Alibaba2 programs, several putative binding sites for transcription factors were identified in the –236 to –93 fragment (data not shown). Some of these are ubiquitous transcription factors (Sp1 and OCT-1) (24, 25) whereas some are implied in expression of genes and retroviruses in T cells (NFAT, SEF and CREB) (26, 27, 28). This region contains also a nearly perfect 18 bp palindromic sequence (CCTGcCCCCGGGGcCAGG), at position –110 to –93. As the SH2D2A cDNA starts just 3' of the palindrome (12), we speculated that this palindrome could be crucial for transcription initiation of the SH2D2A gene. To test this hypothesis, SH2D2A promoter constructs where the palindrome had been mutated to a nonpalindromic sequence were analyzed as above. These mutants showed generally a higher expression of luciferase than the wild type constructs (data not shown). Moreover, additional constructs where also the putative Sp1 site in the 5' end of the palindrome had been removed showed similar expression level as the wild type constructs (data not shown). Thus, the palindrome is not necessary for the transcription initiation of the SH2D2A gene.

Identification of nuclear proteins binding to the minimal SH2D2A promoter

To identify nuclear proteins binding to the minimal promoter of the SH2D2A gene, we performed electromobility shift assay (EMSA) with a DNA fragment extending from –246 to –47 bp of the SH2D2A gene. We found that nuclear extracts from both unstimulated (Fig. 3A) and PMA/ionomycin stimulated Jurkat cells (data not shown) contained similar amounts of binding activity toward this fragment. To further characterize the nuclear binding activity, overlapping radiolabeled PCR products (~60 bp each) covering the minimal promoter were used as probes in the EMSA (Fig. 3B). We found that the overlapping 6–3, 5–3 and 4–1 probes, covering bp –171 to –66 of the SH2D2A promoter was retarded to the same extent by a factor in the nuclear extract of unstimulated Jurkat cells (Fig. 3C). Also the 6–4, the 2-R and 1-R probes displayed retarded bands, which however migrated differently from that of the probes covering the –171 to –66 segment, and was thus not pursued further in the present study. The 4–3 oligonucleotide representing the minimal shared region between the 6–3, 5–3 and 4–1 probes DNA (i.e., base pair position –138 to –94) still contained the binding activity. This oligonucleotide contained several putative binding sites for transcription factors shown in Fig. 3E. To identify more precisely the binding site on probe 4–3, we made several corresponding oligonucleotides with specific point mutations and used these as competitors in EMSA experiments (Fig. 3E and F). Mutants A, B, C, E and F competed with probe 4–3 for binding, suggesting that these mutations do not affect the binding site of this NF. Mutation D, however, did not compete with the wild-type probe, indicating that this mutation abolished a protein binding site. This mutant was located between position –119 to –115 and affected a putative cAMP response element (CRE) site. However, neither a custom made CRE consensus oligonucleotide (C-C) (data not shown), nor a commercially available CRE consensus oligonucleotide (CRE-SC, Fig. 3G) could compete for binding to probe 4–3.



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 3. Identification of nuclear proteins binding to the minimal SH2D2A promoter. A, EMSA with a radiolabeled PCR fragment, 240-R, covering the minimal SH2D2A promoter (–246 to –47). Binding activity was observed in the presence of nuclear extract from resting Jurkat T cells (NE) and was competed by a 100-fold excess of unlabeled PCR fragment, but not by an irrelevant PCR product from the coding part of the SH2D2A gene (irc). B, Schematic representation of the region –240 to the first coding ATG, showing localization of the primers ({blacksquare}; see also Table I) used to generate radiolabeled PCR fragments for EMSA. C, EMSA with radiolabeled PCR products depicted in B as probes. Binding complexes retarded to a similar extent were seen with the probes 6-3, 5-3, and 4-1. Retarded complexes may also be present with probes 6-4, 2-R, and 1-R. D, EMSA competition experiments with unlabeled PCR product 4-3 as a competitor for the complex binding to probes 6-3, 5-3, 4-1, as well as 4-3. The minimal 4-3 probe competed for binding to the four tested probes, indicating that the nuclear binding activity displayed by these four probes is the same complex. E, The sequence of the minimal oligonucleotide 4-3. The introduced mutations A–F in the minimal oligonucleotide are shown in bold. Possible binding sites for NFAT and the transcription factor Sp1 as well as the putative CRE are indicated directly on the sequence. Their corresponding consensus sites with the mutated bases in the A–F mutants of the SH2D2A promoter sequence indicated are shown below. F, EMSA competition experiments with radiolabeled PCR probe 4-3 and corresponding unlabeled PCR probes mutated as shown in E as competitors. The PCR probes harboring the D mutation did not compete with the wild-type probe for binding. G, EMSA competition and supershifting experiment with radiolabeled PCR probe 4-3. Commercially available consensus CRE oligonucleotide (CRE-SC or cre in the figure) failed to compete out binding to the 4-3 probe. None of the four Abs against CRE binding transcription factors (Ab 1, anti-CREB1; Ab 2, anti-ATF1; Ab 3, anti-ATF2; Ab 4, anti-ATF4) supershifted or inhibited binding to the 4-3 probe.

 
Several transcription factors are known to promote transcription of genes by binding to CREs (29). We therefore incubated the DNA-binding reaction with antiserum against CRE binding protein (CREB1), activating transcription factor 1 (ATF1), ATF2, and ATF4. However, none of these four Abs displayed inhibition or supershifting of binding activity to probe 4-3 (Fig. 3G).

Role of CRE in SH2D2A expression in primary T cells

To test whether the putative CRE at position –117 was important for the expression of SH2D2A in primary T cells, we introduced the same mutation as in mutant D into the GA23-GL3 and 240 Kp-GL3 constructs. These two mutants, their corresponding wild-type reporter genes, and the 110Kp-GL3 reporter gene were individually transfected into primary human T cells that were left unstimulated or stimulated by CD3 ligation for 16 h. We found that reporter gene activity in CD3-stimulated primary T cells transfected with the two mutated constructs was markedly reduced compared with that in the wild-type constructs (Fig. 4A), indicating that the CRE is important for transcription of the SH2D2A gene. In an additional series of experiments, stimulation of transfected primary T cells with a synthetic cAMP analog (8-CPT-cAMP) induced expression of the GA23-GL3 and the 240 Kp-GL3 luciferase reporter constructs, whereas expression of the corresponding mutated constructs was induced to a much lesser extent (Fig. 4B). Taken together these data indicate that the putative CRE at –117 in the SH2D2A promoter is cAMP responsive and important for transcription of the SH2D2A gene.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 4. The D mutation abolishes SH2D2A promoter activity in primary T cells. A, Luciferase activity was assessed in lysates of primary T cells transiently transfected with the indicated promoter constructs and TK-RL2 as an internal control vector. Cells were unstimulated or stimulated with anti-CD3 Ab coupled to magnetic beads for 16 h. The normalized luciferase activity in each set of experiments was related to the activity obtained for the unstimulated cells transfected with the GA23 construct, which was set at 1. Results shown are the mean of five experiments ± SD. B, The experiment was performed as described above. Cells were unstimulated or stimulated with 100 µM 8-CPT or anti-CD3 Ab on magnetic beads for 16 h. Results shown are the mean of three experiments ± SD.

 
Of note is that the D mutation also affected the basal activity of the reporter constructs in primary T cells, suggesting that the CRE-binding factor is present in resting T cells. We therefore examined whether nuclear extracts from resting primary T cells display binding activity to the 240-R probe representing the minimal SH2D2A promoter or the 4-3 probe containing the CRE. In freshly isolated primary T cells (isolated through passage through a nylon column), nuclear binding activity to the 240-R probe (–246 to –47 bp) was observed in EMSA (data not shown). However, in T cells kept in complete medium without stimulation overnight, no binding activity to the 240-R probe and only weak binding activity to the 4-3 probe were observed, whereas binding activity to both probes could be induced after 2 h of stimulation with PHA (Fig. 5, A and B, respectively). This result suggests that the NF binding to the CRE in the SH2D2A promoter becomes rapidly activated in T cells that are manipulated in vitro. This may explain some of the basal activity observed in primary T cells in our in vitro reporter gene experiments.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 5. Resting T cells contain only minimal nuclear binding activity to the CRE. A, EMSA using radiolabeled 240-R probe representing the minimal SH2D2A promoter (–246 to –47). Binding activity was observed in the presence of nuclear extract from primary T cells activated for 2 h with PHA and was competed by a 100-fold excess of unlabeled PCR product or unlabeled 4-3 probe, but not by an unlabeled irrelevant PCR product from the coding part of the SH2D2A gene (irc). No binding activity was observed in the presence of nuclear extract from the corresponding unstimulated primary T cells. B, EMSA using radiolabeled 4-3 probe containing the putative CRE. Binding activity was observed in the presence of nuclear extract from primary T cells activated for 2 h with PHA and was competed by a 100-fold excess of unlabeled 4-3 probe. Only weak binding activity was observed in the presence of nuclear extract from the corresponding unstimulated primary T cells.

 
Cyclic AMP analogs induces SH2D2A mRNA expression in primary T cells

Having found that the putative CRE in the proximal SH2D2A promoter is crucial for transcription of the SH2D2A reporter gene construct, we examined whether expression of the SH2D2A gene could be induced by cAMP analogues. Primary resting T cells were incubated with increasing concentrations 8-CPT-cAMP, and the amount of SH2D2A mRNA expression relative to ZAP-70 mRNA expression was evaluated using quantitative PCR. The cAMP analog induced a high level of SH2D2A expression at physiological concentrations (100 µM for 8-CPT) compared with that obtained in T cells stimulated with anti-CD3 magnetic beads (Fig. 6A). cAMP mediates much of its effects through activation of protein kinase A (PKA). The synthetic kinase inhibitor H89 will inhibit PKA at low concentrations. To determine whether cAMP-mediated activation of SH2D2A mRNA expression is mediated via PKA or another kinase that is inhibited by H89, we incubated primary T cells for 20 min in medium containing 10 µM H89 before stimulation with 100 µM 8-CPT. Under these conditions, H89 completely blocked the cAMP-mediated induction of SH2D2A mRNA expression (Fig. 6B). When the TCR/CD3 complex is triggered, the level of intracellular cAMP increases in the T cell (30). To examine whether induction of mRNA expression of TSAd after stimulation of T cells is dependent on cAMP signals, we preincubated primary resting T cells with H89 at different concentrations for 45 min before CD3 stimulation. H-89 treatment of primary T cells reduced SH2D2A mRNA expression induction from 35- to 4-fold in anti-CD3-stimulated cells at the lowest concentration of H89 used (0.4 µM), whereas higher concentrations of H89 completely abolished CD3-mediated induction of SH2D2A mRNA expression (Fig. 6C). Taken together, our data indicate that the CD3-mediated signal inducing SH2D2A mRNA expression is at least partly mediated by a cAMP-responsive kinase and by NF binding at a putative CRE at –117 in the SH2D2A promoter.



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 6. The cAMP analogues induce SH2D2A mRNA expression. A, Primary T cells were incubated with the indicated concentrations of 8-CPT-cAMP, and SH2D2A (i.e., TSAd) mRNA expression was assessed using quantitative PCR. Results shown are the level of TSAd mRNA expression relative to ZAP70 mRNA expression normalized to the level observed in resting T cells. Results shown are mean of triplicate determinations from one representative experiment. B, Primary T cells were or were not preincubated in medium containing 10 µM H89 for 20 min before stimulation with 100 µM 8-CPT-cAMP. TSAd mRNA expression was measured and shown as described above. Results shown are the mean of duplicate determinations from one representative experiment. C, Primary T cells were preincubated for 45 min with the indicated concentration of H89 and then stimulated with anti-CD3 magnetic beads (two beads per cell). TSAd mRNA expression was measured and shown as described above. Results shown are mean of triplicate determinations from one representative experiment.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study we demonstrated that the proximal 1-kb promoter of the SH2D2A gene harbors information for tissue-specific expression and up-regulation by TCR activation. The minimal promoter of the SH2D2A gene is located between –236 and –93 bp upstream of the first coding ATG, and contains a CRE at position –117 that is essential for transcriptional activity of the SH2D2A promoter as well as for binding of nuclear factors to the SH2D2A promoter. Consistent with this, SH2D2A mRNA expression was found to be induced by synthetic cAMP analogues, and CD3 induced SH2D2A mRNA expression could be abolished by inhibition of cAMP responsive kinase activity.

The initial characterization of the SH2D2A promoter was performed with the Jurkat TAg T cell line. In this cell line the SH2D2A promoter was transcriptionally active both in nonstimulated and CD3-stimulated cells. This could be due to lack of the appropriate regulatory sequences in the promoter fragment studied. However, it could also be explained by the fact that Jurkat T cells are to some extent already activated (31). Binding activity to the CRE at –117 was found in nuclear extracts of Jurkat cells independent of prior stimulation of the cells. Binding activity to the CRE at –117 was also observed in nuclear extracts from activated primary T cells, but not at all or only weakly in nuclear extracts from resting primary T cells, which do not express SH2D2A mRNA. Thus, we favor the idea the transcriptional activity of the SH2D2A promoter in resting Jurkat cells is due to the partially activated status of these cells.

We identified the minimal promoter of the SH2D2A gene to be between –236 and –93 bp 5' of the first coding ATG. The SH2D2A promoter contains no TATA box or other well-known regulatory elements necessary for initiation of transcription (19). Thus, there must be other elements in this minimal promoter that direct transcriptional initiation of the gene.

In TATA less promoters, an initiator element may compensate for the lacking TATA box to direct transcriptional initiation (32). However, in promoters lacking both TATA and an initiator element, GC-rich sequences have been shown to provide Sp1 sites that may be sufficient for transcription initiation (33, 34) In such promoters, however, there is not a precise start site for transcription (35). A palindromic sequence in the SH2D2A sequence located between positions –110 and –93 in the promoter contains two putative overlapping Sp1 sites. The removal of one or both of these Sp1 sites did not adversely influence the gene expression, suggesting that an as yet unidentified element directs transcriptional initiation of the SH2D2A gene. Moreover, in EMSA experiments, no binding activity to an oligonucleotide containing the palindrome was observed. Thus, we failed to demonstrate participation of this palindrome in transcription initiation of the SH2D2A gene.

In EMSA experiments we observed nuclear binding activity to a putative CRE centered on position –117 upstream of the first ATG. Consistent with the involvement of this CRE, SH2D2A gene expression in primary T cells was rapidly induced by cAMP analogues. Moreover, the kinase inhibitor H89 inhibited cAMP as well as CD3-induced SH2D2A mRNA expression. H89 is a well-known inhibitor of cAMP-activated kinase (PKA), but also inhibits a number of other kinases (36). Thus, the role of PKA in the regulation of SH2D2A gene expression needs to be further elucidated.

Taken together, our present observations fit well with our earlier observations that T cells in the presence of monocytes exposed to plastic display high levels of SH2D2A mRNA expression (12). Monocytes exposed to plastic will rapidly adhere, become activated, and secrete mediators such as PGs, which, in turn, may induce cAMP production in the T cells.

We were not able to demonstrate the identity of the CRE binding activity in the nuclear extracts from Jurkat T cells. Abs against four different CRE binding transcription factors failed to inhibit or supershift the binding activity in EMSA, nor did two different CRE consensus primers with different flanking sequences compete out the binding activity. The core CRE consensus sequence is the palindromic octamer TGACGTCA. The CRE found in the SH2D2A promoter contains only five of these eight bases: aGgCGaCA. Thus, it is possible that the complex binding to the SH2D2A CRE has a different binding specificity from proteins binding to the consensus CRE. Further work to demonstrate the identity of the protein(s) binding to the SH2D2A minimal promoter is therefore clearly needed.

In conclusion, we have demonstrated that the tissue-specific expression of the SH2D2A gene is in part determined by the proximal 1-kb SH2D2A promoter. Moreover, we have identified a putative CRE in the minimal promoter of the SH2D2A gene that was crucial for TCR/CD3-mediated activation of SH2D2A-derived reporter genes in primary T cells. An important role of cAMP in the regulation of this gene was further demonstrated by activation of the endogenous gene in primary T cells by cAMP analogues and inhibition of cAMP or CD3-induced expression by an inhibitor of cAMP-activated kinases. Thus, transcriptional regulation of the SH2D2A gene in activated T cells is critically dependent on a CRE in the proximal promoter region.


   Acknowledgments
 
The technical assistance of Lise Berven is acknowledged.


   Footnotes
 
1 This work was supported by the Norwegian Research Council, the Norwegian Cancer Society, the Odd Fellow Fund for Multiple Sclerosis, The Anders Jahre Foundation, and Medinnova. Back

2 Address correspondence and reprint requests to Dr. Anne Spurkland, Institute of Anatomy, Faculty of Medicine, University of Oslo, Postboks 1105, Blindern, 0317 Oslo, Norway. E-mail address: anne.spurkland{at}basalmed.uio.no Back

3 Abbreviations used in this paper: TSAd, T cell-specific adapter protein; ATF, activation transcription factor; 8-CPT-cAMP, 8-(4-chlorophenylthio)-cAMP; CRE, cAMP response element; CREB, CRE-binding protein; PKA, protein kinase A. Back

Received for publication May 29, 2003. Accepted for publication February 27, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Leo, A., B. Schraven. 2001. Adapters in lymphocyte signalling. Curr. Opin. Immunol. 13:307.[Medline]
  2. Rieux-Laucat, F., F. Le Deist, A. Fischer. 2003. Autoimmune lymphoproliferative syndromes: genetic defects of apoptosis pathways. Cell Death. Differ. 10:124.[Medline]
  3. Bachmaier, K., C. Krawczyk, I. Kozieradzki, Y. Y. Kong, T. Sasaki, A. Oliveira-dos-Santos, S. Mariathasan, D. Bouchard, A. Wakeham, A. Itie, et al 2000. Negative regulation of lymphocyte activation and autoimmunity by the molecular adaptor Cbl-b. Nature 403:211.[Medline]
  4. Perlmutter, R. M., J. D. Marth, D. B. Lewis, R. Peet, S. F. Ziegler, C. B. Wilson. 1988. Structure and expression of lck transcripts in human lymphoid cells. J. Cell Biochem. 38:117.[Medline]
  5. Chan, A. C., M. Iwashima, C. W. Turck, A. Weiss. 1992. ZAP-70: a 70 kd protein-tyrosine kinase that associates with the TCR {zeta} chain. Cell 71:649.[Medline]
  6. Bruyns, E., A. Marie-Cardine, H. Kirchgessner, K. Sagolla, A. Shevchenko, M. Mann, F. Autschbach, A. Bensussan, S. Meuer, B. Schraven. 1998. T cell receptor (TCR) interacting molecule (TRIM), a novel disulfide-linked dimer associated with the TCR-CD3-{zeta} complex, recruits intracellular signaling proteins to the plasma membrane. J. Exp. Med. 188:561.[Abstract/Free Full Text]
  7. Marie-Cardine, A., E. Bruyns, C. Eckerskorn, H. Kirchgessner, S. C. Meuer, B. Schraven. 1997. Molecular cloning of SKAP55, a novel protein that associates with the protein tyrosine kinase p59fyn in human T-lymphocytes. J. Biol. Chem. 272:16077.[Abstract/Free Full Text]
  8. Freeman, G. J., D. B. Lombard, C. D. Gimmi, S. A. Brod, K. Lee, J. C. Laning, D. A. Hafler, M. E. Dorf, G. S. Gray, H. Reiser. 1992. CTLA-4 and CD28 mRNA are coexpressed in most T cells after activation: expression of CTLA-4 and CD28 mRNA does not correlate with the pattern of lymphokine production. J. Immunol. 149:3795.[Abstract]
  9. Egen, J. G., M. S. Kuhns, J. P. Allison. 2002. CTLA-4: new insights into its biological function and use in tumor immunotherapy. Nat. Immunol. 3:611.[Medline]
  10. Kristiansen, O. P., Z. M. Larsen, F. Pociot. 2000. CTLA-4 in autoimmune diseases: a general susceptibility gene to autoimmunity?. Genes Immun. 1:170.[Medline]
  11. Sundvold, V., K. M. Torgersen, N. H. Post, F. Marti, P. D. King, J. A. Rottingen, A. Spurkland, T. Lea. 2000. Cutting edge: T cell-specific adapter protein inhibits T cell activation by modulating Lck activity. J. Immunol. 165:2927.[Abstract/Free Full Text]
  12. Spurkland, A., J. E. Brinchmann, G. Markussen, F. Pedeutour, E. Munthe, T. Lea, F. Vartdal, H. C. Aasheim. 1998. Molecular cloning of a T cell-specific adapter protein (TSAd) containing an Src homology (SH) 2 domain and putative SH3 and phosphotyrosine binding sites. J. Biol. Chem. 273:4539.[Abstract/Free Full Text]
  13. Marti, F., N. H. Post, E. Chan, P. D. King. 2001. A transcription function for the T cell-specific adapter (TSAd) protein in T cells: critical role of the TSAd Src homology 2 domain. J. Exp. Med. 193:1425.[Abstract/Free Full Text]
  14. Rajagopal, K., C. L. Sommers, D. C. Decker, E. O. Mitchell, U. Korthauer, A. I. Sperling, C. A. Kozak, P. E. Love, J. A. Bluestone. 1999. RIBP, a novel Rlk/Txk- and itk-binding adaptor protein that regulates T cell activation. J. Exp. Med. 190:1657.[Abstract/Free Full Text]
  15. Sun, W., K. Kesavan, B. C. Schaefer, T. P. Garrington, M. Ware, N. L. Johnson, E. W. Gelfand, G. L. Johnson. 2001. MEKK2 associates with the adapter protein Lad/RIBP and regulates the MEK5-BMK1/ERK5 pathway. J. Biol. Chem. 276:5093.[Abstract/Free Full Text]
  16. Dai, K. Z., H. F. Harbo, E. G. Celius, A. Oturai, P. S. Sorensen, L. P. Ryder, P. Datta, A. Svejgaard, J. Hillert, S. Fredrikson, et al 2001. The T cell regulator gene SH2D2A contributes to the genetic susceptibility of multiple sclerosis. Genes Immun. 2:263.[Medline]
  17. Drappa, J., L. A. Kamen, E. Chan, M. Georgiev, D. Ashany, F. Marti, P. D. King. 2003. Impaired T cell death and lupus-like autoimmunity in T cell-specific adapter protein-deficient mice. J. Exp. Med. 198:809.[Abstract/Free Full Text]
  18. Rasmussen, A. M., E. B. Smeland, B. K. Erikstein, L. Caignault, S. Funderud. 1992. A new method for detachment of Dynabeads from positively selected B lymphocytes. J. Immunol. Methods 146:195.[Medline]
  19. Dai, K. Z., G. Vergnaud, A. Ando, H. Inoko, A. Spurkland. 2000. The SH2D2A gene encoding the T cell specific adapter protein (TSAd) is localized centromeric to the CD1 gene cluster on chromosome 1. Immunogenetics 51:179.[Medline]
  20. Carey, M., S. T. Smale. 2000. Modes of regulating mRNA abundance. M. Carey, and S. T. Smale, eds. Transcriptional Regulation in Eukaryotes. Concepts, Strategies and Techniques 65.-96. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  21. Michael, M. D., L. F. Michael, E. R. Simpson. 1997. A CRE-like sequence that binds CREB and contributes to cAMP-dependent regulation of the proximal promoter of the human aromatase P450 (CYP19) gene. Mol. Cell. Endocrinol. 134:147.[Medline]
  22. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. E. Kel, O. V. Kel, E. V. Ignatieva, E. A. Ananko, O. A. Podkolodnaya, F. A. Kolpakov, et al 1998. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res. 26:362.[Abstract/Free Full Text]
  23. Quandt, K., K. Frech, H. Karas, E. Wingender, T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878.[Abstract/Free Full Text]
  24. Philipsen, S., G. Suske. 1999. A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res. 27:2991.[Abstract/Free Full Text]
  25. Hsieh, C. L., R. Sturm, W. Herr, U. Francke. 1990. The gene for the ubiquitous octamer-binding protein Oct-1 is on human chromosome 1, region cen-q32, and near Ly-22 and Ltw-4 on mouse chromosome 1. Genomics 6:666.[Medline]
  26. Serfling, E., F. Berberich-Siebelt, S. Chuvpilo, E. Jankevics, S. Klein-Hessling, T. Twardzik, A. Avots. 2000. The role of NF-AT transcription factors in T cell activation and differentiation. Biochim. Biophys. Acta 1498:1.[Medline]
  27. Amtoft, H. W., A. B. Sorensen, C. Bareil, J. Schmidt, A. Luz, F. S. Pedersen. 1997. Stability of AML1 (core) site enhancer mutations in T lymphomas induced by attenuated SL3–3 murine leukemia virus mutants. J. Virol. 71:5080.[Abstract]
  28. Zhang, W., J. W. Nisbet, B. Albrecht, W. Ding, F. Kashanchi, J. T. Bartoe, M. D. Lairmore. 2001. Human T-lymphotropic virus type 1 p30(II) regulates gene transcription by binding CREB binding protein/p300. J. Virol. 75:9885.[Abstract/Free Full Text]
  29. Hai, T., M. G. Hartman. 2001. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene 273:1.[Medline]
  30. Ledbetter, J. A., M. Parsons, P. J. Martin, J. A. Hansen, P. S. Rabinovitch, C. H. June. 1986. Antibody binding to CD5 (Tp67) and Tp44 T cell surface molecules: effects on cyclic nucleotides, cytoplasmic free calcium, and cAMP-mediated suppression. J. Immunol. 137:3299.[Abstract]
  31. Astoul, E., C. Edmunds, D. A. Cantrell, S. G. Ward. 2001. PI 3-K and T-cell activation: limitations of T-leukemic cell lines as signaling models. Trends Immunol. 22:490.[Medline]
  32. Zenzie-Gregory, B., A. O’Shea-Greenfield, S. T. Smale. 1992. Similar mechanisms for transcription initiation mediated through a TATA box or an initiator element. J. Biol. Chem. 267:2823.[Abstract/Free Full Text]
  33. Emami, K. H., T. W. Burke, S. T. Smale. 1998. Sp1 activation of a TATA-less promoter requires a species-specific interaction involving transcription factor IID. Nucleic Acids Res. 26:839.[Abstract/Free Full Text]
  34. Soravia, E., A. Grebe, P. De Luca, K. Helin, T. T. Suh, J. L. Degen, F. Blasi. 1995. A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene. Blood 86:624.[Abstract/Free Full Text]
  35. Lin, Y., T. A. Ince, K. W. Scotto. 2001. Optimization of a versatile in vitro transcription assay for the expression of multiple start site TATA-less promoters. Biochemistry 40:12959.[Medline]
  36. Davies, S. P., H. Reddy, M. Caivano, P. Cohen. 2000. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J. 351:95.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Granum, T. C. B. Andersen, M. Sorlie, M. Jorgensen, L. Koll, T. Berge, T. Lea, B. Fleckenstein, A. Spurkland, and V. Sundvold-Gjerstad
Modulation of Lck Function through Multisite Docking to T Cell-specific Adapter Protein
J. Biol. Chem., August 8, 2008; 283(32): 21909 - 21919.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. E. Lapinski, J. A. Oliver, L. A. Kamen, E. D. Hughes, T. L. Saunders, and P. D. King
Genetic Analysis of SH2D4A, a Novel Adapter Protein Related to T Cell-Specific Adapter and Adapter Protein in Lymphocytes of Unknown Function, Reveals a Redundant Function in T Cells
J. Immunol., August 1, 2008; 181(3): 2019 - 2027.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dai, K.-Z.
Right arrow Articles by Spurkland, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dai, K.-Z.
Right arrow Articles by Spurkland, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS