|
|
||||||||

* Department of Molecular Immunology, German Cancer Research Center, Heidelberg, Germany; and
Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Promising candidates are unmethylated ssDNA sequences,so-called cytosine-phosphorothioate-guanine (CpG) containing oligodeoxynucleotides (ODN), which are derived from bacillus Calmette-Guerin DNA. This reagent can replace microbial stimuli by activating APCs such as dentritic cells (DCs), B cells, and macrophages through its interaction with Toll-like receptor-9 (4). Consequently, multiple cytokines, including IL-12 and IFN-
, are released that indirectly promote T cell-mediated immune responses, and therefore CpG-ODN may be classified as a potent adjuvant (5, 6). Recognizing the potential of CpG-ODNs for immunization against tumor Ags, a variety of experiments have been performed in tumor transplantation models (7). As an in vitro adjuvant, CpG-ODN induces DC maturation and enhances antitumor T cell responses upon DC transfer (8, 9). In combination with irradiated tumor cells or tumor Ag, CpG-ODN shows antitumor efficacy that is, however, most prominent in a prophylactic setting (10, 11). Direct stimulation of antitumor immunity by injection of CpG-ODN in the tumor periphery is even more attractive because this treatment regimen does not require identification of tumor-specific Ags. Indeed, we and others have demonstrated that peritumoral application of CpG-ODN is sufficient to cure established, s.c. growing tumors (12, 13, 14). The tumor-directed immune response has been mainly attributed to the activation of NK and CTLs, and its efficacy correlates with the antigenicity of the tumor (13). In these murine tumor models, CpG-ODN-mediated direct or indirect effects on the tumor microenvironment itself have not been studied. Although attractive in its simplicity, peritumoral or intratumoral injection of CpG-ODN appears to be difficult in a clinical setting unless a locally defined, nonmetastatic tumor with relatively easy access is treated (15).
In the past, numerous antitumor strategies with very encouraging results have been described in animal models, but subsequent translation into the clinic has proven to be difficult. This discrepancy can, in part, be explained by the use of transplantation tumor models and the fact that most tumor vaccines are efficient in tumor growth prevention, but lose efficacy when confronted with a progressively growing tumor mass. Once a tumor is established, the tumor may evade immune destruction by inducing tolerance. In some tumor models, however, there is evidence for the presence of functional tumor-specific T cells (16). But even if antitumor effector cells are successfully activated, the tumor may become refractory to lymphocyte penetration. Hence, the real challenge for tumor therapeutic compounds are autochthonous, solid tumors, as evident in cancer patients. In RIP1-Tag5 mice, tumors arise spontaneously in the adult mouse and develop over well-characterized stages into highly vascularized solid tumors (17). Due to the delayed onset of transgene expression, an autoimmune response against Tag is observed that has, however, no impact on the progressive tumor growth (18). Facing immune surveillance that is inefficient in preventing tumor formation, we studied the therapeutic efficacy of CpG-ODN in RIP1-Tag5 mice. Toward this goal, we tested the adjuvant effect of CpG during tumor progression as well as the impact of systemic CpG-ODN application on the immune system of the tumor-bearing host and the tumor microenvironment. Understanding the potential and limitations of CpG-ODN in the treatment of an autochthonously growing tumor, we were able to define a CpG-ODN-based combination therapy with preactivated Tag-specific effector cells that dramatically extends the life span of tumor-bearing RIP1-Tag5 mice.
| Materials and Methods |
|---|
|
|
|---|
RIP1-Tag5 mice express Tag on pancreatic
cells beginning at the age of 810 wk (17) (kindly provided by D. Hanahan, University of California, San Francisco, CA) and were generated in the C3HeBFe background. In indicated experiments, the F1 generation of RIP1-Tag5/C3H mice and C57BL/6 mice was used. Tumor progression and life span in these F1 transgenic mice are identical with RIP1-Tag5 mice on the C3HeBFe genetic background. Mice transgenic for a TCR that recognizes Tag presented by the MHC class I molecule H-2Kk (19) (kindly provided by T. Geiger, St. Jude Childrens Research Hospital, Memphis, TN and R. Flavell, Yale University, New Haven, CT) are referred to as TCRCD8+. TCRCD8+ mice were backcrossed on the C3HeBFe background for 14 generations. TagTCR1 mice express the I-A-restricted TCR for Tag (20) (kindly provided by I. Förster, Technical University, Munich, Germany) and were backcrossed on C3HeBFe for >30 generations. Target spleen cells for in vivo NK activity were derived from TAP1/ mice, which were bred in the C57BL/6 background (21) (kindly provided by H.-G. Ljunggren, Karolinska Institute, Stockholm, Sweden). Blood glucose levels were monitored using the ONE Touch-II system (LifeScan, Neckargemünd, Germany). All mice were kept under specific pathogen-free conditions at the German Cancer Research Center.
Oligonucleotides
Phosphothioate-stabilized CpG-ODN 1668 (TCCATGACGTTCCTGATGCT) and ODN 1720 (TCCATGAGCTTCCTGATCCT) were synthesized at TIB-MOLBIOL (Berlin, Germany). The 5' Cy3-labeled, phosphothioate-stabilized CpG-ODN 1668 was purchased from Sigma-Aldrich (Taufkirchen, Germany). Oligonucleotides were injected in PBS.
Vaccination studies
Tag was purified from High Five insect cells infected with a baculovirus expressing SV40 early region (22). Mice were primed with a single s.c. injection (tailbase) of 50 µg of Tag protein mixed with 50 µg of CpG-ODN 1668 in 200 µl of PBS or 50 µg of Tag protein in CFA (Sigma-Aldrich) in a total volume of 200 µl (v/v 1:1). Thereafter, CpG-ODN treatment groups were injected with 50 µg of Tag protein mixed with 50 µg of CpG-ODN 1668 i.p. every second week. CFA treatment groups were boosted every second week by i.p. injections of 50 µg of Tag protein in 200 µl of PBS. Control mice were injected with PBS only.
In vivo proliferation
In vivo proliferation of CSFE-labeled T cells was performed, as described (23, 24). Briefly, 1 x 107 cells derived from lymph nodes of TCRCD8+ mice or TagTCR1 mice crossed on the RAG1/ background were labeled in 1 ml of serum-free RPMI 1640 medium in a final concentration of 1 µM CSFE (Molecular Probes, Leiden, The Netherlands) for 10 min at 37°C/5% CO2. Cells were washed four times in ice-cold RPMI 1640 medium containing 10% FCS. A total of 1.5 x 107 cells was transferred i.v. into recipient mice. Forty-six hours after transfer, single cell suspensions were prepared from pancreatic lymph nodes, which represent the tumor-draining lymph nodes in RIP1-Tag5 mice. For FACS analysis, cells were gated on V
8.1, 8.2 TCR/CD8+ cells (BD PharMingen, Heidelberg, Germany) for transferred TCRCD8+ cells or on anti-clonotype (TagTCR Ab 9H5; from I. Förster) (20)/CD4+ cells (BD PharMingen) for transferred TagTCR1 cells. Ten thousand events were recorded.
Adoptive transfers
In short-term treatment groups, mice were injected with 25 µg of CpG-ODN 1668 or 1720 i.v. in 100 µl of PBS at days 1, 5, and 9. If indicated, the same group of mice received adoptive transfers of 2.5 x 106 activated lymphocytes on days 0 and 10. Mice were sacrificed at day 12 and analyzed by histology. In long-term experiments, mice were injected, as described, for short-term treatment groups. CpG-ODN injections and adoptive transfers were repeated every 10 days. For adoptive transfers, TCRCD8+ splenocytes or TagTCR1 lymph node cells were activated in vitro for 3 days in RPMI 1640 medium supplemented with 10% FCS, 2 nM glutamine, 100 U/ml penicillin/100 µg/ml streptomycin, 0.05 mM 2-ME, 10 U of rIL-2/ml, and 25 nM Tag peptide 560568 (SEFLLEKRI for TCRCD8+ cells) or 25 nM Tag peptide 362384 (TNRFNDLLDRMDIMFGSTGSADI for TagTCR1 cells). C3H-derived spleen cells were activated with 1 µg/ml Con A (Sigma-Aldrich).
In vivo CTL activity
The in vivo CTL assay was performed, as described (25, 26). Briefly, spleen cell suspensions from C3H x C57BL/6 F1 mice were depleted for erythrocytes and adjusted to a concentration of 1 x 107 cells/ml ice-cold PBS. Splenocytes were loaded with the H2-Kb-restricted Tag peptide IV (404411, VVYDFLKL) in a final concentration of 1 µM or left without peptide for 15 min at 37°C. Subsequently, targets were labeled with CSFE in a final concentration of 0.75 µM (CFSEhigh population) or 0.075 µM (CFSElow population), respectively, for 15 min at room temperature. Cells were washed once in ice-cold RPMI 1640 medium with 10% FCS and twice in ice-cold PBS. A total of 1 x 107 cells of each target population was injected i.v. into recipient mice. CTL activity was assessed 18 h after the adoptive transfer using FACS analysis (FACSCalibur; BD Biosciences, Heidelberg, Germany). Killing in nontransgenic, immunized controls is 0%. For the calculation of specific kill, the following formula was used: ratio = (percentage of CFSElow/percentage of CFSEhigh). Percentage of specific kill = (1 (ratio unprimed/ratio primed) x 100) (26).
In vivo NK activity
Splenocytes from TAP1/ and C57BL/6 mice were labeled as CFSEhigh and CFSElow populations, respectively, as described in the in vivo CTL assay. In some experiments, NK cells were depleted in vivo by injecting 1 mg of TM
1 mAb (27) i.p. on 2 consecutive days, 6 days before the transfer of CFSE-labeled target cells. NK activity was assessed 4 h after the adoptive transfer using FACS analysis. Because TAP1/ cells are to a limited extent sensitive to NK-mediated kill in resting mice (1015%), the ratio of TAP1/ cells to C57BL/6 cells transferred into recipient mice was set to 0% kill.
Pancreatic histology
To assess the degree of insulitis, pancreata were embedded in OCT compound (Tissue Tek, Vogel, Germany), and 7-µm serial sections were stained with H&E. A total of 2030 individual islets was scored for each pancreas. Immunohistochemistry was performed on 7-µm sections, as described (2). Sections were stained with the following Abs: anti-CD4 (GK1.5, 10 µg/ml, BD PharMingen), anti-CD8 (Ly-2, 10 µg/ml; BD PharMingen), anti-Tag (rabbit polyclonal, 1/1000; from D. Hanahan), anti-ICAM (YN1/1.7.4, 10 µg/ml; American Type Culture Collection, LGC Promochem, Middlesex, U.K.), and anti-VCAM (429, 10 µg/ml; BD PharMingen). To monitor in vivo uptake of CpG-ODN, mice were injected i.v. with 100 µg of Cy3-labeled CpG-ODN. Two hours later, mice were heart perfused with 4% paraformaldehyde/PBS. Pancreata were excised, immersion fixed in 4% paraformaldehyde/PBS for 2 h at 4°C, and embedded in OCT compound. Tissue was sectioned at 10 µm thickness, blocked with PBS/5% normal goat serum/1% BSA/0.1% Triton X-100, stained with the anti-macrosialin Ab FA/11 (28) (culture supernatant 1:5) in PBS/2% normal goat serum/1% BSA/0.1% Triton X-100, and incubated with FITC-conjugated IgG F(ab')2 goat anti-rat (3 µg/ml; Dianova, Hamburg, Germany) in PBS/1% BSA/0.1% Triton X-100.
| Results |
|---|
|
|
|---|
Expression of Tag in RIP1-Tag5 mice starts in adult life, at
10 wk, and subsequent multistage tumorigenesis has been studied in detail (17, 29, 30) (for schematic summary, see Fig. 1A). At 6 wk of age, Tag expression is not evident in transgenic mice. Later, all
cells express Tag protein, and the first signs of malignant transformation become apparent at
16 wk. At this stage, there is only a minor increase in islet size, but neovascularization is initiated and first aberrant features of the vasculature develop (30). At 23 wk, solid tumors are present and the expression of Tag protein is dramatically enhanced (3). To test the antitumor efficacy of a standard vaccination treatment, mice of all three age groups were immunized s.c. with purified Tag protein in combination with the classical murine adjuvant, CFA, or with CpG-ODN as adjuvant. The initial treatment was followed by biweekly i.p. injections of Tag in PBS or Tag mixed with CpG-ODN, respectively. Blood glucose levels were measured throughout the experiment to monitor islet destruction/diabetes or tumor formation (Fig. 1, C and E). Due to the overproduction of insulin and subsequent hypoglycemia, untreated RIP1-Tag5 transgenic mice succumb to insulinomas between 30 and 35 wk. Immunization as early as at 68 wk of age resulted in a dramatic increase in the life span of transgenic mice. A combination of Tag with CpG-ODN is significantly more efficient than a combination of Tag and CFA (p = 0.0001). The experiment was terminated when 80% of surviving mice in the Tag/CpG-ODN group were 56 wk old (Fig. 1B). Three of 12 mice died before 56 wk. Repetitive CpG-ODN i.p. injections induce pancreatitis and weight loss in C3H mice, which were the most likely causes for premature death. Efficacy of Tag/CpG-ODN vaccination decreased by half, when treatment was started at 16 wk (Fig. 1D). It was inefficient when treatment was started at 23 wk of age (Fig. 1F). To investigate whether vaccination efficacy correlated with the capacity to prime an endogenous cytotoxic T cell response, RIP1-Tag5 (C3H x C57 BL/6)F1 transgenic mice of different age groups were immunized with Tag protein and CpG-ODN. Subsequently, the elimination of Tag peptide IV-pulsed target cells was monitored in vivo. The H2-Kb-restricted peptide IV is a naturally presented Ag, and peptide IV-specific CTL responses can be primed by the endogenous Tag tumor Ag (31). Fig. 2A demonstrates that Tag-specific CTL activity was induced in vivo at all stages during tumor progression. Histological examination of 56-wk-old, surviving mice revealed that lymphocytes infiltrate Tag+ islets and prevent tumor formation without evidence for complete
cell destruction and diabetes (Fig. 2B). Tumor growth as indicated by a drop in glucose level was not observed (Fig. 1C). In contrast, in the late treatment groups, corresponding to survival curves shown in Fig. 1, D and F, mice succumb to insulinomas, which did not show a significant T cell infiltrate (Figs. 1, E and G, and 2C). These results imply that the lack of therapeutic success of Tag/CpG-ODN vaccination is not due to the induction of systemic tolerance by the growing tumor, but a failure of effector cells to eradicate solid tumors.
|
|
We have previously shown that repetitive, peritumoral injection of CpG-ODN alone leads to rejection of a variety of transplantation tumors. This effect is mainly mediated by induction of NK- and tumor-specific CD8+ T cells (13). It is not known, however, whether repeated i.v. injections of CpG-ODN as single agent would impact the growth of spontaneously arising tumors at different stages during tumor progression. In RIP1-Tag5 mice, CFSE-labeled, naive MHC class I (TCRCD8+)- and class II-restricted (TagTCR1) transgenic TCR T cells specific for Tag are primed in the pancreatic lymph nodes upon transfer (Fig. 3A). This demonstrates that Tag tumor Ag is presented in the draining lymph node of the pancreas throughout tumorigenesis. But is the amount of endogenously presented tumor Ag sufficient to prime an effective anti-Tag CTL response in vivo upon CpG-ODN stimulation? To address this question, different age groups of RIP1-Tag5 (C3H x C57 BL/6)F1 mice were injected i.v. with 25 µg of CpG-ODN (three times within 2 wk), and CTL activity against peptide IV was measured in vivo. Although specific lysis was induced in a Tag/CpG-ODN-based vaccination regimen (Fig. 2A), CpG-ODN as a single agent was not sufficient to prime anti-Tag killer cells (Fig. 3B). In contrast, NK cytotoxic activity in vivo was readily detectable after a single i.v. injection of CpG-ODN and remained high after repetitive injections (Fig. 3, C and D). This observed NK cell activity, however, was not sufficient to reject tumors. Thus, systemic CpG-ODN application is effective at activating innate immune responses, but fails to elicit intrinsic anti-Tag immunity. This result is consistent with the absence of infiltrating CD4+ and CD8+ T cells in Langerhans islets after repetitive CpG-ODN i.v. injections (Fig. 4A). Consequently, systemic application of CpG-ODN as a single agent in therapeutic studies has no impact on the survival of transgenic mice (see below).
|
|
Even though CpG-ODN monotherapy fails to activate Tag-specific CTLs, it is a potent proinflammatory stimulus capable of eliciting strong NK cell activity and may be able to support an ongoing adoptive immune response. Therefore, we postulated that systemic CpG-ODN application may have therapeutic value in the treatment of established tumors when combined with preactivated antitumor effector cells. To test the hypothesis, islet infiltration in 23-wk-old RIP1-Tag5 mice was assessed after short-term treatment with CpG-ODN alone or in combination with adoptive transfers of activated Tag-specific T cells (three i.v. injections of CpG-ODN with or without two adoptive transfers). Pancreata of 23-wk-old transgenic mice display a range of normal, hyperproliferative, and angiogenic islets as well as solid tumors. Our initial histological examination focused on Tag-expressing Langerhans islets because the degree of infiltration can be easily scored. This evaluation method turned out to be an excellent prognostic parameter for subsequent long-term therapeutic studies (see below). Fig. 4A shows that transfer of ex vivo activated Tag-specific effector cells led to a low-grade peri-islet infiltration, but did not dramatically infiltrate islets. In contrast, combination of Tag-specific T cells with CpG-ODN resulted in massive lymphocyte influx into islets with up to 90% of Langerhans islets being taken over by T cells. Fig. 4B shows a pancreatic islet after TCRCD8+ transfer alone or in combination with CpG-ODN. It demonstrates that T cells infiltrate islets only in the presence of CpG-ODN. Infiltrating CD4+ T cells are possibly cotransferred cells or host cells, which are recruited after TCRCD8+ transfer. Islet histology after transfer of TagTCR1 cells in combination with CpG-ODN shows a similar degree of CD4+ and CD8+ T cell infiltration (data not shown). These results demonstrate that i.v. injection of CpG-ODN renders Tag-expressing islets accessible for the entry of Ag-specific, activated T cells.
CpG-ODN changes the organ microenvironment
CpG-ODN express a wide range of biological activities that include the triggering of innate immune responses. In addition, our data indicate that i.v. applied CpG-ODN also exerts some direct or indirect effects on the tissue microenvironment. Lymphocyte penetration into tissue is a well-coordinated process, which in the first instance requires interactions of adhesion molecules on endothelial cells with their corresponding ligands on lymphocytes. Therefore, we examined the expression of ICAM-1 and VCAM-1 in Langerhans islets after CpG-ODN injection. Pancreatic sections of PBS-treated controls were compared with short-term CpG-ODN-treated transgenic mice. In control mice, a basal level of ICAM and VCAM expression was detectable in the vasculature of the endocrine pancreas (Fig. 5A). The basic expression level increased dramatically after i.v. injection of CpG-ODN. This effect was observed independently of a cotransfer of activated effector cells, but could be responsible for the massive infiltration of effector cells into islets, as documented in Fig. 4B. Enhanced ICAM and VCAM expression was also seen in solid tumors on the same pancreatic sections (data not shown). To investigate whether the up-regulation of ICAM and VCAM is a direct or indirect effect of CpG-ODN, the tissue distribution of i.v. injected CpG-ODN tagged with a red fluorescent dye was monitored in vivo. There was no evidence for CpG-ODN uptake by endothelial cells in pancreatic tissue. However, the majority of CpG-ODN colocalized with FA/11 (Fig. 5B), a mAb to macrosialin, which predominantly stains tissue macrophages and to some extent DCs (28). These FA/11-positive cells were scattered throughout the pancreatic tissue, including insulinomas (data not shown). Because activated cells of the innate immune system secrete a variety of cytokines and chemokines, it is likely that the up-regulation of adhesion molecules is caused by CpG-ODN-stimulated tissue macrophages. These results suggest that uptake of CpG-ODN by tissue resident cells changes the tissue microenvironment to support effector cell extravasation.
|
Systemic application of CpG-ODN activates NK cells and opens pancreatic islets for infiltration by activated effector cells. To translate these findings into a therapeutic antitumor strategy, we used CpG-ODN in combination with different effector cell populations in a long-term treatment regimen. Notably, treatment was started when RIP1-Tag5 mice were 23 wk old and had already developed solid tumors. Repetitive treatment with CpG-ODN alone was compared with CpG-ODN combined with activated, Tag-specific CD4+ or CD8+ T cells or a combination of both effector cell populations, CD4+ and CD8+ (Fig. 6, A, C, and E). We have previously shown that repeated adoptive transfers of TagTCR1 cells have no impact on tumor growth (3). In this study, we obtained similar results with repetitive transfers of activated TCRCD8+ effector cells, which were unable to extravasate into tumor tissue (Fig. 6C). Consistent with our results on transplantation tumors (13), CD4+ T cells were not the main players in CpG-ODN-triggered tumor rejection. However, tumor growth was significantly delayed compared with CpG-ODN treatment alone (p = 0.0011; Fig. 6A). All mice succumbed to insulinomas before the age of 45 wk, which is reflected in low blood glucose levels (Fig. 6B). In contrast, combination therapy of CpG-ODN with CD8+ effector cells resulted in a dramatic survival advantage of tumor-bearing mice (Fig. 6, C and D). Sixty percent of treated mice were still alive at 46 wk when the experiment was terminated. Tumors, which grew in these treatment group, were massively infiltrated by CD8+ T cells and to a lesser extent by CD4+ T cells (data not shown). The most effective antitumor therapy, however, was achieved with a combination of CpG-ODN and Tag-specific CD4+ and CD8+ T cells, which resulted in 90% survivors at 46 wk (Fig. 6E). At the endpoint of the experiment, no tumors were visible and blood glucose levels remained at a normal level (Fig. 6F). This antitumor effect was Ag specific because Con A-activated C3H-derived lymphocytes in combination with CpG-ODN were unable to prevent tumor growth (Fig. 6E). Thus, our results demonstrate that neither CpG-ODN alone nor persistently high numbers of antitumor T cells impact tumor growth. In contrast, a combination of CpG-ODN and CD4+/CD8+ effector cells leads to massive tumor infiltration and dramatically prolongs the life of tumor-bearing transgenic mice.
|
| Discussion |
|---|
|
|
|---|
cells in check, whereas once tumors arise, infiltrating cells are barely detectable in the malignant tissue. Therefore, we favor as an alternative explanation for the lack of therapeutic efficacy, that cancer vaccines can elicit antitumor CTL responses in vivo, but activated effectors fail to extravasate into clinically manifest tumors in numbers sufficient for tumor eradication. As we have demonstrated in RIP1-Tag5 mice, changes in the islet microenvironment start very early during multistage tumorigenesis (even before 16 wk) and an aberrant microvascular system precedes the expansion of the tumor mass. Interestingly, this angiogenic switch, as an early event during tumor formation, directly affects leukocyte extravasation into malignant tissue (30) and may also be responsible for the limited access of effectors in late vaccination groups. CpG-ODN as a single agent has been shown to be therapeutically effective when applied peritumorally (12, 13, 14). In tumor-bearing RIP1-Tag5 mice, however, systemic i.v. injection of CpG-ODN alone has no impact on tumor growth. Tag is presented in the draining lymph node of the pancreas and tumor growth correlates with an enhanced capacity for cross-presentation (Fig. 3A). Nonetheless, CpG-ODN monotherapy is not sufficient to activate a Tag-specific intrinsic immune response in transgenic mice with low or advanced tumor burdens. Similarly, in s.c. growing tumor models, injection in direct vicinity of the tumor is more effective than injections into the tumor-free flank (13, 14). Thus, the therapeutic success experienced in transplantation models is critically dependent on the CpG-ODN injection site, local concentration, and frequency of application. It may also reflect a fundamental difference between transplanted and autochthonous tumors and the site of tumor development (36). Consistent with our findings, systemic injection of CpG-ODN in transgenic mice developing spontaneous mammary adenocarcinoma showed some efficacy in preventing tumor growth, but is ineffective once tumors are established (37).
Although the proinflammatory effect of CpG-ODN as a single agent was not sufficient to cure endogenous tumors in RIP1-Tag5 mice, a combination of CpG-ODN with preactivated, tumor-specific CD4+ and CD8+ T cells leads to massive infiltration into tumors and a striking therapeutic efficacy. Notably, repeated infusions of Tag-specific, activated effector cells alone do not infiltrate tumors and have no impact on progressive tumor growth. Hence, effector cells are crucially dependent on CpG-ODN to overcome the tumors intrinsic barrier to infiltration. As we and others have demonstrated, CpG-ODN is a potent inducer of innate immunity and thus provides a favorable cytokine milieu even in the absence of measurable CTL activity. But more importantly, CpG-ODN acts on the tissue microenvironment, where it is taken up by resident cells, mainly macrosialin-positive macrophages (Fig. 5B). This finding implies that i.v. injected CpG-ODN acts locally as a proinflammatory stimulus within pancreatic islets and tumors. Consequently, adhesion molecules are up-regulated on endothelia that, among other factors, facilitate extravasation of effector cells into tumor tissue. In a model for T cell-mediated autoaggression against liver, CpG-ODN-induced inflammation has similar effects on the liver microenvironment, which includes up-regulation of adhesion molecules on endothelial cells, followed by infiltration and subsequent liver damage (38). In addition, enhanced expression of adhesion and costimulatory molecules on hepatocytes correlated with T cell activation in the CpG-ODN-stimulated liver. Uptake of CpG-ODN by islet macrophages may also increase Ag presentation within the pancreas and further enhance effector function of adoptively transferred T cells.
Based on the results reported in this work, protein vaccination with CpG-ODN as adjuvant following classical protocols or systemic treatment with CpG-ODN alone is not promising for the cure of cancer. In contrast, CpG-ODN was most effective as a proinflammatory factor in T cell-based immunotherapy, in which it activates innate immunity and acts on the tumor microenvironment to increase accessibility for effector cell infiltration. A crucial difference between vaccination with Tag/CpG-ODN and adoptive transfers/CpG-ODN is the route and frequency of CpG-ODN application, indicating that the inflammatory effect of CpG-ODN is self-limiting and repetitive i.v. injections are required for maximal efficacy. Moreover, the endogenously primed CTL response after vaccination might be relatively weak compared with adoptive transfers of two million highly primed CD4+ and CD8+ effector cells. It will be interesting to investigate the vaccination efficiency in a scenario in which CpG-ODN is directly conjugated to the tumor Ag (39).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ruth Ganss, Department of Molecular Immunology, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany. E-mail address: r.ganss{at}dkfz.de ![]()
3 Abbreviations used in this paper: RIP, rat insulin promoter; CpG, cytosine-phosphorothioate-guanine; DC, dendritic cell; ODN, oligodeoxynucleotide; Tag, SV40 T Ag. ![]()
Received for publication October 9, 2003. Accepted for publication February 27, 2004.
| References |
|---|
|
|
|---|
or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo. J. Immunol. 165:6278.
-cell tumors in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 315:115.[Medline]
cell neo-antigen. Immunity 2:573.[Medline]
-cell antigen and transcription of endogenous pancreatic genes in thymus. Proc. Natl. Acad. Sci. USA 91:6707.
chain monoclonal antibody in mice. J. Exp. Med. 178:1103.Related articles in The JI:
This article has been cited by other articles:
![]() |
J. Kohlmeyer, M. Cron, J. Landsberg, T. Bald, M. Renn, S. Mikus, S. Bondong, D. Wikasari, E. Gaffal, G. Hartmann, et al. Complete Regression of Advanced Primary and Metastatic Mouse Melanomas following Combination Chemoimmunotherapy Cancer Res., August 1, 2009; 69(15): 6265 - 6274. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hamzah, J. G. Altin, T. Herringson, C. R. Parish, G. J. Hammerling, H. O'Donoghue, and R. Ganss Targeted Liposomal Delivery of TLR9 Ligands Activates Spontaneous Antitumor Immunity in an Autochthonous Cancer Model J. Immunol., July 15, 2009; 183(2): 1091 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wei, S. Wang, D. Zhang, S. Hou, W. Qian, B. Li, H. Guo, G. Kou, J. He, H. Wang, et al. Targeted Delivery of Tumor Antigens to Activated Dendritic Cells via CD11c Molecules Induces Potent Antitumor Immunity in Mice Clin. Cancer Res., July 15, 2009; 15(14): 4612 - 4621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Epardaud, K. G. Elpek, M. P. Rubinstein, A.-r. Yonekura, A. Bellemare-Pelletier, R. Bronson, J. A. Hamerman, A. W. Goldrath, and S. J. Turley Interleukin-15/Interleukin-15R{alpha} Complexes Promote Destruction of Established Tumors by Reviving Tumor-Resident CD8+ T Cells Cancer Res., April 15, 2008; 68(8): 2972 - 2983. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. J. Wong, R. Bos, and L. A. Sherman Tumor-Specific CD4+ T Cells Render the Tumor Environment Permissive for Infiltration by Low-Avidity CD8+ T Cells J. Immunol., March 1, 2008; 180(5): 3122 - 3131. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Currie, R. G. van der Most, S. A. Broomfield, A. C. Prosser, M. G. Tovey, and B. W. S. Robinson Targeting the Effector Site with IFN-{alpha}{beta}-Inducing TLR Ligands Reactivates Tumor-Resident CD8 T Cell Responses to Eradicate Established Solid Tumors J. Immunol., February 1, 2008; 180(3): 1535 - 1544. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Otahal, B. B. Knowles, S. S. Tevethia, and T. D. Schell Anti-CD40 Conditioning Enhances the TCD8 Response to a Highly Tolerogenic Epitope and Subsequent Immunotherapy of Simian Virus 40 T Antigen-Induced Pancreatic Tumors J. Immunol., November 15, 2007; 179(10): 6686 - 6695. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Paulos, A. Kaiser, C. Wrzesinski, C. S. Hinrichs, L. Cassard, A. Boni, P. Muranski, L. Sanchez-Perez, D. C. Palmer, Z. Yu, et al. Toll-like Receptors in Tumor Immunotherapy Clin. Cancer Res., September 15, 2007; 13(18): 5280 - 5289. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Wall, K. Milne, M. L. Martin, P. H. Watson, P. Theiss, and B. H. Nelson Spontaneous Mammary Tumors Differ Widely in Their Inherent Sensitivity to Adoptively Transferred T Cells Cancer Res., July 1, 2007; 67(13): 6442 - 6450. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Reibke, N. Garbi, R. Ganss, G. J. Hammerling, B. Arnold, and T. Oelert CD8+ regulatory T cells generated by neonatal recognition of peripheral self-antigen PNAS, October 10, 2006; 103(41): 15142 - 15147. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nelson and R. Ganss Tumor growth or regression: powered by inflammation J. Leukoc. Biol., October 1, 2006; 80(4): 685 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Otahal, T. D. Schell, S. C. Hutchinson, B. B. Knowles, and S. S. Tevethia Early Immunization Induces Persistent Tumor-Infiltrating CD8+ T Cells against an Immunodominant Epitope and Promotes Lifelong Control of Pancreatic Tumor Progression in SV40 Tumor Antigen Transgenic Mice. J. Immunol., September 1, 2006; 177(5): 3089 - 3099. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. de Witte, M. Coccoris, M. C. Wolkers, M. D. van den Boom, E. M. Mesman, J.-Y. Song, M. van der Valk, J. B. A. G. Haanen, and T. N. M. Schumacher Targeting self-antigens through allogeneic TCR gene transfer Blood, August 1, 2006; 108(3): 870 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Tormo, A. Ferrer, P. Bosch, E. Gaffal, E. Basner-Tschakarjan, J. Wenzel, and T. Tuting Therapeutic Efficacy of Antigen-Specific Vaccination and Toll-Like Receptor Stimulation against Established Transplanted and Autochthonous Melanoma in Mice. Cancer Res., May 15, 2006; 66(10): 5427 - 5435. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Garbe, B. Vermeer, J. Gamrekelashvili, R. v. Wasielewski, F. R. Greten, A. M. Westendorf, J. Buer, R. M. Schmid, M. P. Manns, F. Korangy, et al. Genetically Induced Pancreatic Adenocarcinoma Is Highly Immunogenic and Causes Spontaneous Tumor-Specific Immune Responses Cancer Res., January 1, 2006; 66(1): 508 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Limmer, R Ganss, N Garbi, B Arnold, and G J Hammerling Stimulation of autoimmunity by toll-like receptor ligands Ann Rheum Dis, November 1, 2005; 64(suppl_4): iv15 - iv17. [Full Text] [PDF] |
||||
![]() |
K. Mahnke, Y. Qian, S. Fondel, J. Brueck, C. Becker, and A. H. Enk Targeting of Antigens to Activated Dendritic Cells In vivo Cures Metastatic Melanoma in Mice Cancer Res., August 1, 2005; 65(15): 7007 - 7012. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Lugade, J. P. Moran, S. A. Gerber, R. C. Rose, J. G. Frelinger, and E. M. Lord Local Radiation Therapy of B16 Melanoma Tumors Increases the Generation of Tumor Antigen-Specific Effector Cells That Traffic to the Tumor J. Immunol., June 15, 2005; 174(12): 7516 - 7523. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gough, M. Crittenden, U. Thanarajasingam, L. Sanchez-Perez, J. Thompson, D. Jevremovic, and R. Vile Gene Therapy to Manipulate Effector T Cell Trafficking to Tumors for Immunotherapy J. Immunol., May 1, 2005; 174(9): 5766 - 5773. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guiducci, A. P. Vicari, S. Sangaletti, G. Trinchieri, and M. P. Colombo Redirecting In vivo Elicited Tumor Infiltrating Macrophages and Dendritic Cells towards Tumor Rejection Cancer Res., April 15, 2005; 65(8): 3437 - 3446. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lyman, C. T. Nugent, K. L. Marquardt, J. A. Biggs, E. G. Pamer, and L. A. Sherman The Fate of Low Affinity Tumor-Specific CD8+ T Cells in Tumor-Bearing Mice J. Immunol., March 1, 2005; 174(5): 2563 - 2572. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |