The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garbi, N.
Right arrow Articles by Ganss, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garbi, N.
Right arrow Articles by Ganss, R.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Pancreatic Cancer
The Journal of Immunology, 2004, 172: 5861-5869.
Copyright © 2004 by The American Association of Immunologists

CpG Motifs as Proinflammatory Factors Render Autochthonous Tumors Permissive for Infiltration and Destruction1

Natalio Garbi*, Bernd Arnold*, Siamon Gordon{dagger}, Günter J. Hämmerling* and Ruth Ganss2,*

* Department of Molecular Immunology, German Cancer Research Center, Heidelberg, Germany; and {dagger} Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In a transgenic mouse model expressing SV40 T Ag (Tag) as a de novo tumor Ag, immune surveillance fails and islet cell carcinomas grow progressively. To develop an anticancer strategy that would be effective in eradicating solid, autochthonously growing tumors, we evaluated the effectiveness of immunostimulatory oligodeoxynucleotides (ODN) with cytosine-guanine-rich (CpG) motifs (CpG-ODN). In a classical vaccination protocol, Tag was administered with CpG-ODN as adjuvant. The antitumor vaccination, however, was only effective in a prophylactic setting, despite the successful activation of a Tag-specific CTL response in vivo. Histological examination demonstrated that even primed immune cells failed to infiltrate tumors once a malignant environment was established. To ensure that effector cells were not limiting, highly activated tumor Ag-specific T cells were transferred into tumor-bearing mice. However, this treatment also failed to result in tumor infiltration and rejection. Therefore, we further tested the efficacy of CpG-ODN as a proinflammatory agent in combination with the transfer of preactivated Tag-specific CD4+ and CD8+ T cells. Indeed, this combination therapy proved to be highly effective, because CpG-ODN rendered insulinomas permissive for massive infiltration and destruction. The opening of tumor tissue correlated with uptake of CpG-ODN by tissue-resident macrophages and a strong up-regulation of adhesion molecules such as ICAM and VCAM on blood vessel endothelia. These data demonstrate that systemic application of proinflammatory reagents drastically enhances extravasation of effector cells into tumor tissue, an observation that is of general importance for immunotherapy of solid tumors in a clinical setting.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antitumor immunity is tightly regulated by the innate and adaptive immune systems as well as by the microenvironment of the tumor itself. In addition, inflammation can boost the host responses to tumor and somehow changes the tumor microenvironment for enhanced Ag presentation and tissue access (1). In a transgene-induced tumor model, we have recently demonstrated that effective tumor therapy requires a proinflammatory microenvironment that permits effector cells to extravasate and reject the tumor (2, 3). In this rat insulin promoter (RIP)3-T Ag (Tag) tumor model, SV40 large Tag-induced insulinomas are refractory to infiltration by activated antitumor lymphocytes. However, irradiation as an inflammatory stimulus renders solid tumors accessible for infiltration by adoptively transferred effector cells and results in complete tumor regression. In this study, our goal was to define specific inflammatory mediators, which are able to simultaneously activate the host’s intrinsic immune system and trigger T cell infiltration.

Promising candidates are unmethylated ssDNA sequences,so-called cytosine-phosphorothioate-guanine (CpG) containing oligodeoxynucleotides (ODN), which are derived from bacillus Calmette-Guerin DNA. This reagent can replace microbial stimuli by activating APCs such as dentritic cells (DCs), B cells, and macrophages through its interaction with Toll-like receptor-9 (4). Consequently, multiple cytokines, including IL-12 and IFN-{gamma}, are released that indirectly promote T cell-mediated immune responses, and therefore CpG-ODN may be classified as a potent adjuvant (5, 6). Recognizing the potential of CpG-ODNs for immunization against tumor Ags, a variety of experiments have been performed in tumor transplantation models (7). As an in vitro adjuvant, CpG-ODN induces DC maturation and enhances antitumor T cell responses upon DC transfer (8, 9). In combination with irradiated tumor cells or tumor Ag, CpG-ODN shows antitumor efficacy that is, however, most prominent in a prophylactic setting (10, 11). Direct stimulation of antitumor immunity by injection of CpG-ODN in the tumor periphery is even more attractive because this treatment regimen does not require identification of tumor-specific Ags. Indeed, we and others have demonstrated that peritumoral application of CpG-ODN is sufficient to cure established, s.c. growing tumors (12, 13, 14). The tumor-directed immune response has been mainly attributed to the activation of NK and CTLs, and its efficacy correlates with the antigenicity of the tumor (13). In these murine tumor models, CpG-ODN-mediated direct or indirect effects on the tumor microenvironment itself have not been studied. Although attractive in its simplicity, peritumoral or intratumoral injection of CpG-ODN appears to be difficult in a clinical setting unless a locally defined, nonmetastatic tumor with relatively easy access is treated (15).

In the past, numerous antitumor strategies with very encouraging results have been described in animal models, but subsequent translation into the clinic has proven to be difficult. This discrepancy can, in part, be explained by the use of transplantation tumor models and the fact that most tumor vaccines are efficient in tumor growth prevention, but lose efficacy when confronted with a progressively growing tumor mass. Once a tumor is established, the tumor may evade immune destruction by inducing tolerance. In some tumor models, however, there is evidence for the presence of functional tumor-specific T cells (16). But even if antitumor effector cells are successfully activated, the tumor may become refractory to lymphocyte penetration. Hence, the real challenge for tumor therapeutic compounds are autochthonous, solid tumors, as evident in cancer patients. In RIP1-Tag5 mice, tumors arise spontaneously in the adult mouse and develop over well-characterized stages into highly vascularized solid tumors (17). Due to the delayed onset of transgene expression, an autoimmune response against Tag is observed that has, however, no impact on the progressive tumor growth (18). Facing immune surveillance that is inefficient in preventing tumor formation, we studied the therapeutic efficacy of CpG-ODN in RIP1-Tag5 mice. Toward this goal, we tested the adjuvant effect of CpG during tumor progression as well as the impact of systemic CpG-ODN application on the immune system of the tumor-bearing host and the tumor microenvironment. Understanding the potential and limitations of CpG-ODN in the treatment of an autochthonously growing tumor, we were able to define a CpG-ODN-based combination therapy with preactivated Tag-specific effector cells that dramatically extends the life span of tumor-bearing RIP1-Tag5 mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

RIP1-Tag5 mice express Tag on pancreatic {beta} cells beginning at the age of 8–10 wk (17) (kindly provided by D. Hanahan, University of California, San Francisco, CA) and were generated in the C3HeBFe background. In indicated experiments, the F1 generation of RIP1-Tag5/C3H mice and C57BL/6 mice was used. Tumor progression and life span in these F1 transgenic mice are identical with RIP1-Tag5 mice on the C3HeBFe genetic background. Mice transgenic for a TCR that recognizes Tag presented by the MHC class I molecule H-2Kk (19) (kindly provided by T. Geiger, St. Jude Children’s Research Hospital, Memphis, TN and R. Flavell, Yale University, New Haven, CT) are referred to as TCRCD8+. TCRCD8+ mice were backcrossed on the C3HeBFe background for 14 generations. TagTCR1 mice express the I-A-restricted TCR for Tag (20) (kindly provided by I. Förster, Technical University, Munich, Germany) and were backcrossed on C3HeBFe for >30 generations. Target spleen cells for in vivo NK activity were derived from TAP1–/– mice, which were bred in the C57BL/6 background (21) (kindly provided by H.-G. Ljunggren, Karolinska Institute, Stockholm, Sweden). Blood glucose levels were monitored using the ONE Touch-II system (LifeScan, Neckargemünd, Germany). All mice were kept under specific pathogen-free conditions at the German Cancer Research Center.

Oligonucleotides

Phosphothioate-stabilized CpG-ODN 1668 (TCCATGACGTTCCTGATGCT) and ODN 1720 (TCCATGAGCTTCCTGATCCT) were synthesized at TIB-MOLBIOL (Berlin, Germany). The 5' Cy3-labeled, phosphothioate-stabilized CpG-ODN 1668 was purchased from Sigma-Aldrich (Taufkirchen, Germany). Oligonucleotides were injected in PBS.

Vaccination studies

Tag was purified from High Five insect cells infected with a baculovirus expressing SV40 early region (22). Mice were primed with a single s.c. injection (tailbase) of 50 µg of Tag protein mixed with 50 µg of CpG-ODN 1668 in 200 µl of PBS or 50 µg of Tag protein in CFA (Sigma-Aldrich) in a total volume of 200 µl (v/v 1:1). Thereafter, CpG-ODN treatment groups were injected with 50 µg of Tag protein mixed with 50 µg of CpG-ODN 1668 i.p. every second week. CFA treatment groups were boosted every second week by i.p. injections of 50 µg of Tag protein in 200 µl of PBS. Control mice were injected with PBS only.

In vivo proliferation

In vivo proliferation of CSFE-labeled T cells was performed, as described (23, 24). Briefly, 1 x 107 cells derived from lymph nodes of TCRCD8+ mice or TagTCR1 mice crossed on the RAG1–/– background were labeled in 1 ml of serum-free RPMI 1640 medium in a final concentration of 1 µM CSFE (Molecular Probes, Leiden, The Netherlands) for 10 min at 37°C/5% CO2. Cells were washed four times in ice-cold RPMI 1640 medium containing 10% FCS. A total of 1.5 x 107 cells was transferred i.v. into recipient mice. Forty-six hours after transfer, single cell suspensions were prepared from pancreatic lymph nodes, which represent the tumor-draining lymph nodes in RIP1-Tag5 mice. For FACS analysis, cells were gated on V{beta}8.1, 8.2 TCR/CD8+ cells (BD PharMingen, Heidelberg, Germany) for transferred TCRCD8+ cells or on anti-clonotype (TagTCR Ab 9H5; from I. Förster) (20)/CD4+ cells (BD PharMingen) for transferred TagTCR1 cells. Ten thousand events were recorded.

Adoptive transfers

In short-term treatment groups, mice were injected with 25 µg of CpG-ODN 1668 or 1720 i.v. in 100 µl of PBS at days –1, 5, and 9. If indicated, the same group of mice received adoptive transfers of 2.5 x 106 activated lymphocytes on days 0 and 10. Mice were sacrificed at day 12 and analyzed by histology. In long-term experiments, mice were injected, as described, for short-term treatment groups. CpG-ODN injections and adoptive transfers were repeated every 10 days. For adoptive transfers, TCRCD8+ splenocytes or TagTCR1 lymph node cells were activated in vitro for 3 days in RPMI 1640 medium supplemented with 10% FCS, 2 nM glutamine, 100 U/ml penicillin/100 µg/ml streptomycin, 0.05 mM 2-ME, 10 U of rIL-2/ml, and 25 nM Tag peptide 560–568 (SEFLLEKRI for TCRCD8+ cells) or 25 nM Tag peptide 362–384 (TNRFNDLLDRMDIMFGSTGSADI for TagTCR1 cells). C3H-derived spleen cells were activated with 1 µg/ml Con A (Sigma-Aldrich).

In vivo CTL activity

The in vivo CTL assay was performed, as described (25, 26). Briefly, spleen cell suspensions from C3H x C57BL/6 F1 mice were depleted for erythrocytes and adjusted to a concentration of 1 x 107 cells/ml ice-cold PBS. Splenocytes were loaded with the H2-Kb-restricted Tag peptide IV (404–411, VVYDFLKL) in a final concentration of 1 µM or left without peptide for 15 min at 37°C. Subsequently, targets were labeled with CSFE in a final concentration of 0.75 µM (CFSEhigh population) or 0.075 µM (CFSElow population), respectively, for 15 min at room temperature. Cells were washed once in ice-cold RPMI 1640 medium with 10% FCS and twice in ice-cold PBS. A total of 1 x 107 cells of each target population was injected i.v. into recipient mice. CTL activity was assessed 18 h after the adoptive transfer using FACS analysis (FACSCalibur; BD Biosciences, Heidelberg, Germany). Killing in nontransgenic, immunized controls is 0%. For the calculation of specific kill, the following formula was used: ratio = (percentage of CFSElow/percentage of CFSEhigh). Percentage of specific kill = (1 – (ratio unprimed/ratio primed) x 100) (26).

In vivo NK activity

Splenocytes from TAP1–/– and C57BL/6 mice were labeled as CFSEhigh and CFSElow populations, respectively, as described in the in vivo CTL assay. In some experiments, NK cells were depleted in vivo by injecting 1 mg of TM{beta}1 mAb (27) i.p. on 2 consecutive days, 6 days before the transfer of CFSE-labeled target cells. NK activity was assessed 4 h after the adoptive transfer using FACS analysis. Because TAP1–/– cells are to a limited extent sensitive to NK-mediated kill in resting mice (10–15%), the ratio of TAP1–/– cells to C57BL/6 cells transferred into recipient mice was set to 0% kill.

Pancreatic histology

To assess the degree of insulitis, pancreata were embedded in OCT compound (Tissue Tek, Vogel, Germany), and 7-µm serial sections were stained with H&E. A total of 20–30 individual islets was scored for each pancreas. Immunohistochemistry was performed on 7-µm sections, as described (2). Sections were stained with the following Abs: anti-CD4 (GK1.5, 10 µg/ml, BD PharMingen), anti-CD8 (Ly-2, 10 µg/ml; BD PharMingen), anti-Tag (rabbit polyclonal, 1/1000; from D. Hanahan), anti-ICAM (YN1/1.7.4, 10 µg/ml; American Type Culture Collection, LGC Promochem, Middlesex, U.K.), and anti-VCAM (429, 10 µg/ml; BD PharMingen). To monitor in vivo uptake of CpG-ODN, mice were injected i.v. with 100 µg of Cy3-labeled CpG-ODN. Two hours later, mice were heart perfused with 4% paraformaldehyde/PBS. Pancreata were excised, immersion fixed in 4% paraformaldehyde/PBS for 2 h at 4°C, and embedded in OCT compound. Tissue was sectioned at 10 µm thickness, blocked with PBS/5% normal goat serum/1% BSA/0.1% Triton X-100, stained with the anti-macrosialin Ab FA/11 (28) (culture supernatant 1:5) in PBS/2% normal goat serum/1% BSA/0.1% Triton X-100, and incubated with FITC-conjugated IgG F(ab')2 goat anti-rat (3 µg/ml; Dianova, Hamburg, Germany) in PBS/1% BSA/0.1% Triton X-100.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Anti-Tag vaccination is only successful in a preventive, but not therapeutic setting

Expression of Tag in RIP1-Tag5 mice starts in adult life, at ~10 wk, and subsequent multistage tumorigenesis has been studied in detail (17, 29, 30) (for schematic summary, see Fig. 1A). At 6 wk of age, Tag expression is not evident in transgenic mice. Later, all {beta} cells express Tag protein, and the first signs of malignant transformation become apparent at ~16 wk. At this stage, there is only a minor increase in islet size, but neovascularization is initiated and first aberrant features of the vasculature develop (30). At 23 wk, solid tumors are present and the expression of Tag protein is dramatically enhanced (3). To test the antitumor efficacy of a standard vaccination treatment, mice of all three age groups were immunized s.c. with purified Tag protein in combination with the classical murine adjuvant, CFA, or with CpG-ODN as adjuvant. The initial treatment was followed by biweekly i.p. injections of Tag in PBS or Tag mixed with CpG-ODN, respectively. Blood glucose levels were measured throughout the experiment to monitor islet destruction/diabetes or tumor formation (Fig. 1, C and E). Due to the overproduction of insulin and subsequent hypoglycemia, untreated RIP1-Tag5 transgenic mice succumb to insulinomas between 30 and 35 wk. Immunization as early as at 6–8 wk of age resulted in a dramatic increase in the life span of transgenic mice. A combination of Tag with CpG-ODN is significantly more efficient than a combination of Tag and CFA (p = 0.0001). The experiment was terminated when 80% of surviving mice in the Tag/CpG-ODN group were 56 wk old (Fig. 1B). Three of 12 mice died before 56 wk. Repetitive CpG-ODN i.p. injections induce pancreatitis and weight loss in C3H mice, which were the most likely causes for premature death. Efficacy of Tag/CpG-ODN vaccination decreased by half, when treatment was started at 16 wk (Fig. 1D). It was inefficient when treatment was started at 23 wk of age (Fig. 1F). To investigate whether vaccination efficacy correlated with the capacity to prime an endogenous cytotoxic T cell response, RIP1-Tag5 (C3H x C57 BL/6)F1 transgenic mice of different age groups were immunized with Tag protein and CpG-ODN. Subsequently, the elimination of Tag peptide IV-pulsed target cells was monitored in vivo. The H2-Kb-restricted peptide IV is a naturally presented Ag, and peptide IV-specific CTL responses can be primed by the endogenous Tag tumor Ag (31). Fig. 2A demonstrates that Tag-specific CTL activity was induced in vivo at all stages during tumor progression. Histological examination of 56-wk-old, surviving mice revealed that lymphocytes infiltrate Tag+ islets and prevent tumor formation without evidence for complete {beta} cell destruction and diabetes (Fig. 2B). Tumor growth as indicated by a drop in glucose level was not observed (Fig. 1C). In contrast, in the late treatment groups, corresponding to survival curves shown in Fig. 1, D and F, mice succumb to insulinomas, which did not show a significant T cell infiltrate (Figs. 1, E and G, and 2C). These results imply that the lack of therapeutic success of Tag/CpG-ODN vaccination is not due to the induction of systemic tolerance by the growing tumor, but a failure of effector cells to eradicate solid tumors.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1. CpG-ODN 1668 as adjuvant prolongs survival of RIP1-Tag5 mice in a prophylactic setting. A, Schematic overview of the multistep tumor progression in the RIP1-Tag5 line. B, Effect of vaccination on survival in 6- to 8-wk-old RIP1-Tag5 mice. C, Blood glucose levels were measured in 6- to 8-wk-old vaccination groups. Values for individual mice are provided in 5-weekly intervals. All animals show normal blood glucose levels (range: 80–120 mg/100 ml) until 20 wk. Absence of symbols indicates the death of individuals. Mice with a blood glucose level below 70 mg/100 ml were considered hypoglycemic (dashed line). D, 16-wk-old vaccination group, and E, corresponding blood glucose values. F, 23-wk-old vaccination group, and G, corresponding blood glucose levels. Twelve mice per vaccination group were treated. The experiment was terminated when surviving mice were 56 wk old. In all treatment groups, the adjuvant effect of CpG-ODN was compared with CFA.

 


View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 2. CpG-ODN 1668 as adjuvant primes Tag-specific CTLs in vivo. A, Nontransgenic (C3H x C57 BL/6)F1 mice represent the immunized control group. Eight-, 15-, 20- and 25-wk-old RIP1-Tag5 ((C3H x C57 BL/6)F1, three to seven mice per group) were immunized with CpG-ODN and Tag s.c. at the tail base, followed by two i.p injections. Subsequently, CTL activity against the Tag-specific peptide IV was assessed in vivo. The percentage of specific kill measured in splenocytes is presented as mean ± SEM. B, Islet histology of a long-term surviving RIP1-Tag5 mouse from the 6-wk Tag/CpG-ODN vaccination group. CD4+ and CD8+ T cell infiltrates replace most of the Tag-expressing {beta} cells. Arrowheads indicate islet boundaries. Tumors are not detectable. Bar length, 45 µm. C, Tag+ tumors, which arise in the 16- and 23-wk-old vaccination groups, are free of infiltrating lymphocytes. Bar length, 50 µm.

 
CpG monotherapy activates innate immunity, but fails to induce Tag-specific CTL activity

We have previously shown that repetitive, peritumoral injection of CpG-ODN alone leads to rejection of a variety of transplantation tumors. This effect is mainly mediated by induction of NK- and tumor-specific CD8+ T cells (13). It is not known, however, whether repeated i.v. injections of CpG-ODN as single agent would impact the growth of spontaneously arising tumors at different stages during tumor progression. In RIP1-Tag5 mice, CFSE-labeled, naive MHC class I (TCRCD8+)- and class II-restricted (TagTCR1) transgenic TCR T cells specific for Tag are primed in the pancreatic lymph nodes upon transfer (Fig. 3A). This demonstrates that Tag tumor Ag is presented in the draining lymph node of the pancreas throughout tumorigenesis. But is the amount of endogenously presented tumor Ag sufficient to prime an effective anti-Tag CTL response in vivo upon CpG-ODN stimulation? To address this question, different age groups of RIP1-Tag5 (C3H x C57 BL/6)F1 mice were injected i.v. with 25 µg of CpG-ODN (three times within 2 wk), and CTL activity against peptide IV was measured in vivo. Although specific lysis was induced in a Tag/CpG-ODN-based vaccination regimen (Fig. 2A), CpG-ODN as a single agent was not sufficient to prime anti-Tag killer cells (Fig. 3B). In contrast, NK cytotoxic activity in vivo was readily detectable after a single i.v. injection of CpG-ODN and remained high after repetitive injections (Fig. 3, C and D). This observed NK cell activity, however, was not sufficient to reject tumors. Thus, systemic CpG-ODN application is effective at activating innate immune responses, but fails to elicit intrinsic anti-Tag immunity. This result is consistent with the absence of infiltrating CD4+ and CD8+ T cells in Langerhans islets after repetitive CpG-ODN i.v. injections (Fig. 4A). Consequently, systemic application of CpG-ODN as a single agent in therapeutic studies has no impact on the survival of transgenic mice (see below).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. Systemic application of CpG-ODN 1668 as a single agent fails to prime specific CTLs, but strongly activates NK cells. A, CFSE-labeled, naive TCRCD8+ or TagTCR1/RAG1–/– transgenic T cells were adoptively transferred into nontransgenic (control) mice and into 15-, 20-, and 25-wk-old RIP1-Tag5 mice. Proliferation of V{beta}8.1, 8.2+/CD8+, or clonotype+/CD4+ T cells in pancreatic lymph nodes was determined after 46 h. Graphs are representative for five independent experiments. B, (C3H x C57 BL/6)F1 control mice and 15-, 20-, and 25-wk-old RIP1-Tag5 ((C3H x C57 BL/6)F1, two mice per group) mice were three times injected i.v. with CpG-ODN. Peptide IV-specific kill in vivo is shown for spleen cells and a pool of the tumor-draining pancreatic lymph nodes. C, Low MHC class I-expressing spleen cells from TAP1–/– mice (CFSEhigh) are killed in vivo upon activation of NK cells with either poly(I:C) or CpG-ODN. NK cell depletion with the mAb TM{beta}1 abrogates the killing activity. CFSElow C57BL/6 target cells are not killed by NK cells. Three mice per group were analyzed, and a representative histogram for each treatment group is shown. D, NK cells are specifically activated by CpG-ODN 1668 in vivo without exhaustion after several i.v. injections. The graph represents a summary of three mice per group.

 


View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 4. A combination of CpG-ODN and activated Tag-specific lymphocytes results in progressive insulitis. A, Graphical summary of penetrance of insulitis in RIP1-Tag5 treatment groups (five mice per group). The 24-wk-old RIP1-Tag5 mice received only CpG-ODN (1668) injections on days –1, 5, and 9 or adoptive transfers with in vitro activated TagTCR1 or TCR CD8+ T cells on days 0 and 10. Alternatively, adoptive transfers on days 0 and 10 were combined with CpG-ODN (1668 + TagTCR, 1668 + TCRCD8+). Mice of all treatment groups were sacrificed on day 12. Twenty to 30 individual islets per mouse were scored as: normal in appearance (0% infiltration), having mainly perivascular accumulation of mononuclear cells with mild insulitis (10–30% infiltration), insulitis with some {beta} cell damage (40–70% infiltration), and severe insulitis (80–100% infiltration). B, Representative histology depicts Tag-expressing {beta} cells and the degree of infiltration by CD4+ and CD8+ T cells in TCRCD8+ and 1668 + TCR CD8+ treatment groups. Arrowheads indicate islet boundaries. Bar length, 45 µm.

 
CpG-ODN renders islets accessible for infiltration by preactivated Tag-specific T cells

Even though CpG-ODN monotherapy fails to activate Tag-specific CTLs, it is a potent proinflammatory stimulus capable of eliciting strong NK cell activity and may be able to support an ongoing adoptive immune response. Therefore, we postulated that systemic CpG-ODN application may have therapeutic value in the treatment of established tumors when combined with preactivated antitumor effector cells. To test the hypothesis, islet infiltration in 23-wk-old RIP1-Tag5 mice was assessed after short-term treatment with CpG-ODN alone or in combination with adoptive transfers of activated Tag-specific T cells (three i.v. injections of CpG-ODN with or without two adoptive transfers). Pancreata of 23-wk-old transgenic mice display a range of normal, hyperproliferative, and angiogenic islets as well as solid tumors. Our initial histological examination focused on Tag-expressing Langerhans islets because the degree of infiltration can be easily scored. This evaluation method turned out to be an excellent prognostic parameter for subsequent long-term therapeutic studies (see below). Fig. 4A shows that transfer of ex vivo activated Tag-specific effector cells led to a low-grade peri-islet infiltration, but did not dramatically infiltrate islets. In contrast, combination of Tag-specific T cells with CpG-ODN resulted in massive lymphocyte influx into islets with up to 90% of Langerhans islets being taken over by T cells. Fig. 4B shows a pancreatic islet after TCRCD8+ transfer alone or in combination with CpG-ODN. It demonstrates that T cells infiltrate islets only in the presence of CpG-ODN. Infiltrating CD4+ T cells are possibly cotransferred cells or host cells, which are recruited after TCRCD8+ transfer. Islet histology after transfer of TagTCR1 cells in combination with CpG-ODN shows a similar degree of CD4+ and CD8+ T cell infiltration (data not shown). These results demonstrate that i.v. injection of CpG-ODN renders Tag-expressing islets accessible for the entry of Ag-specific, activated T cells.

CpG-ODN changes the organ microenvironment

CpG-ODN express a wide range of biological activities that include the triggering of innate immune responses. In addition, our data indicate that i.v. applied CpG-ODN also exerts some direct or indirect effects on the tissue microenvironment. Lymphocyte penetration into tissue is a well-coordinated process, which in the first instance requires interactions of adhesion molecules on endothelial cells with their corresponding ligands on lymphocytes. Therefore, we examined the expression of ICAM-1 and VCAM-1 in Langerhans islets after CpG-ODN injection. Pancreatic sections of PBS-treated controls were compared with short-term CpG-ODN-treated transgenic mice. In control mice, a basal level of ICAM and VCAM expression was detectable in the vasculature of the endocrine pancreas (Fig. 5A). The basic expression level increased dramatically after i.v. injection of CpG-ODN. This effect was observed independently of a cotransfer of activated effector cells, but could be responsible for the massive infiltration of effector cells into islets, as documented in Fig. 4B. Enhanced ICAM and VCAM expression was also seen in solid tumors on the same pancreatic sections (data not shown). To investigate whether the up-regulation of ICAM and VCAM is a direct or indirect effect of CpG-ODN, the tissue distribution of i.v. injected CpG-ODN tagged with a red fluorescent dye was monitored in vivo. There was no evidence for CpG-ODN uptake by endothelial cells in pancreatic tissue. However, the majority of CpG-ODN colocalized with FA/11 (Fig. 5B), a mAb to macrosialin, which predominantly stains tissue macrophages and to some extent DCs (28). These FA/11-positive cells were scattered throughout the pancreatic tissue, including insulinomas (data not shown). Because activated cells of the innate immune system secrete a variety of cytokines and chemokines, it is likely that the up-regulation of adhesion molecules is caused by CpG-ODN-stimulated tissue macrophages. These results suggest that uptake of CpG-ODN by tissue resident cells changes the tissue microenvironment to support effector cell extravasation.



View larger version (101K):
[in this window]
[in a new window]
 
FIGURE 5. CpG-ODN is taken up by tissue macrophages and changes the islet microenvironment. A, Representative staining for ICAM and VCAM in Langerhans islets of untreated RIP1-Tag5 mice and after three CpG-ODN 1668 injections. Bar length, 45 µm. B, Confocal microscopy demonstrates that i.v. injected, Cy3-labeled CpG-ODN (red) is taken up by FA/11-positive, tissue-resident macrophages (green). Bar length, 20 µm.

 
Combination therapy of CpG-ODN with activated Tag-specific effector cells dramatically prolongs the life of tumor-bearing RIP1-Tag5 mice

Systemic application of CpG-ODN activates NK cells and opens pancreatic islets for infiltration by activated effector cells. To translate these findings into a therapeutic antitumor strategy, we used CpG-ODN in combination with different effector cell populations in a long-term treatment regimen. Notably, treatment was started when RIP1-Tag5 mice were 23 wk old and had already developed solid tumors. Repetitive treatment with CpG-ODN alone was compared with CpG-ODN combined with activated, Tag-specific CD4+ or CD8+ T cells or a combination of both effector cell populations, CD4+ and CD8+ (Fig. 6, A, C, and E). We have previously shown that repeated adoptive transfers of TagTCR1 cells have no impact on tumor growth (3). In this study, we obtained similar results with repetitive transfers of activated TCRCD8+ effector cells, which were unable to extravasate into tumor tissue (Fig. 6C). Consistent with our results on transplantation tumors (13), CD4+ T cells were not the main players in CpG-ODN-triggered tumor rejection. However, tumor growth was significantly delayed compared with CpG-ODN treatment alone (p = 0.0011; Fig. 6A). All mice succumbed to insulinomas before the age of 45 wk, which is reflected in low blood glucose levels (Fig. 6B). In contrast, combination therapy of CpG-ODN with CD8+ effector cells resulted in a dramatic survival advantage of tumor-bearing mice (Fig. 6, C and D). Sixty percent of treated mice were still alive at 46 wk when the experiment was terminated. Tumors, which grew in these treatment group, were massively infiltrated by CD8+ T cells and to a lesser extent by CD4+ T cells (data not shown). The most effective antitumor therapy, however, was achieved with a combination of CpG-ODN and Tag-specific CD4+ and CD8+ T cells, which resulted in 90% survivors at 46 wk (Fig. 6E). At the endpoint of the experiment, no tumors were visible and blood glucose levels remained at a normal level (Fig. 6F). This antitumor effect was Ag specific because Con A-activated C3H-derived lymphocytes in combination with CpG-ODN were unable to prevent tumor growth (Fig. 6E). Thus, our results demonstrate that neither CpG-ODN alone nor persistently high numbers of antitumor T cells impact tumor growth. In contrast, a combination of CpG-ODN and CD4+/CD8+ effector cells leads to massive tumor infiltration and dramatically prolongs the life of tumor-bearing transgenic mice.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 6. Combination therapy of CpG-ODN and CD4+ and CD8+ effector cells cures established tumors. A, Long-term treatment of tumor-bearing, 23-wk-old RIP1-Tag5 mice demonstrates that CpG-ODN 1668 combined with 2.5 x 106 activated CD4+ TagTCR1 cells has a low therapeutic efficacy (p = 0.001). B, Corresponding blood glucose values of individual mice (16 mice per group). Blood glucose levels were measured in all experimental groups before the start of therapy at 20 wk and monitored in 5-weekly intervals thereafter. Absence of symbols indicates the death of individuals. Mice with a blood glucose level below 70 mg/100 ml were considered hypoglycemic (dashed line). C, Long-term survival was improved in a combination therapy of CpG-ODN 1668 and 2.5 x 106 activated TCRCD8+ cells. D, Corresponding blood glucose values of individual mice (10–16 mice per group). E, Combination of CpG-ODN 1668 and activated, Tag-specific CD4+ and CD8+ T cells results in a dramatically increased life span. The experiment was terminated when surviving transgenic mice were 47 wk old. F, Corresponding blood glucose values of individual mice (10 mice per group). Data represent a summary of two independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The failure of the immune system to eradicate solid tumors remains puzzling. It is argued that progressive tumor growth is met by a severely compromised immune response, and there is indeed evidence in tumor models supporting the hypothesis that tumor-specific lymphocytes are actively tolerized (32, 33, 34). Other reports, however, demonstrate that tumor-specific T cells can encounter the cognate Ag without impairment of their immune function (16, 35). Independent of the immune status of the host, therapeutic vaccination with tumor Ags seems to be a promising strategy to overcome T cell unresponsivness and to trigger effector function. Because CpG-ODN acts as a powerful adjuvant in vivo and RIP1-Tag5 mice express a strong de novo tumor Ag, we tested the efficacy of an anti-Tag/CpG-ODN vaccination regimen in a preventive and therapeutic setting. Our findings demonstrate, however, that Tag together with CpG-ODN as an antitumor vaccine in an autochthonous tumor model is only effective before tumors are established. This result is consistent with a related SV40 Tag model of islet cell carcinogenesis, in which immunization with SV40 virus delays tumor development only when mice were infected before the onset of Tag expression (33). Although in vitro Tag-specific CTLs are readily detectable throughout tumorigenesis in these immunized mice, it was speculated that effector cells are rendered unresponsive in vivo upon encounter with the endogenous Tag protein. In our tumor model, we used a new approach to assess the anti-Tag cytotoxic response in vivo and show that peptide IV-specific CTLs are primed in all stages of progressive tumor growth, independent of the therapeutic outcome. We cannot exclude that effector cell frequency or unresponsiveness toward other Tag epitopes might limit the effectiveness of the vaccination strategy. However, in a preventive setting, T cells are able to infiltrate islets and keep Tag+ {beta} cells in check, whereas once tumors arise, infiltrating cells are barely detectable in the malignant tissue. Therefore, we favor as an alternative explanation for the lack of therapeutic efficacy, that cancer vaccines can elicit antitumor CTL responses in vivo, but activated effectors fail to extravasate into clinically manifest tumors in numbers sufficient for tumor eradication. As we have demonstrated in RIP1-Tag5 mice, changes in the islet microenvironment start very early during multistage tumorigenesis (even before 16 wk) and an aberrant microvascular system precedes the expansion of the tumor mass. Interestingly, this angiogenic switch, as an early event during tumor formation, directly affects leukocyte extravasation into malignant tissue (30) and may also be responsible for the limited access of effectors in late vaccination groups.

CpG-ODN as a single agent has been shown to be therapeutically effective when applied peritumorally (12, 13, 14). In tumor-bearing RIP1-Tag5 mice, however, systemic i.v. injection of CpG-ODN alone has no impact on tumor growth. Tag is presented in the draining lymph node of the pancreas and tumor growth correlates with an enhanced capacity for cross-presentation (Fig. 3A). Nonetheless, CpG-ODN monotherapy is not sufficient to activate a Tag-specific intrinsic immune response in transgenic mice with low or advanced tumor burdens. Similarly, in s.c. growing tumor models, injection in direct vicinity of the tumor is more effective than injections into the tumor-free flank (13, 14). Thus, the therapeutic success experienced in transplantation models is critically dependent on the CpG-ODN injection site, local concentration, and frequency of application. It may also reflect a fundamental difference between transplanted and autochthonous tumors and the site of tumor development (36). Consistent with our findings, systemic injection of CpG-ODN in transgenic mice developing spontaneous mammary adenocarcinoma showed some efficacy in preventing tumor growth, but is ineffective once tumors are established (37).

Although the proinflammatory effect of CpG-ODN as a single agent was not sufficient to cure endogenous tumors in RIP1-Tag5 mice, a combination of CpG-ODN with preactivated, tumor-specific CD4+ and CD8+ T cells leads to massive infiltration into tumors and a striking therapeutic efficacy. Notably, repeated infusions of Tag-specific, activated effector cells alone do not infiltrate tumors and have no impact on progressive tumor growth. Hence, effector cells are crucially dependent on CpG-ODN to overcome the tumor’s intrinsic barrier to infiltration. As we and others have demonstrated, CpG-ODN is a potent inducer of innate immunity and thus provides a favorable cytokine milieu even in the absence of measurable CTL activity. But more importantly, CpG-ODN acts on the tissue microenvironment, where it is taken up by resident cells, mainly macrosialin-positive macrophages (Fig. 5B). This finding implies that i.v. injected CpG-ODN acts locally as a proinflammatory stimulus within pancreatic islets and tumors. Consequently, adhesion molecules are up-regulated on endothelia that, among other factors, facilitate extravasation of effector cells into tumor tissue. In a model for T cell-mediated autoaggression against liver, CpG-ODN-induced inflammation has similar effects on the liver microenvironment, which includes up-regulation of adhesion molecules on endothelial cells, followed by infiltration and subsequent liver damage (38). In addition, enhanced expression of adhesion and costimulatory molecules on hepatocytes correlated with T cell activation in the CpG-ODN-stimulated liver. Uptake of CpG-ODN by islet macrophages may also increase Ag presentation within the pancreas and further enhance effector function of adoptively transferred T cells.

Based on the results reported in this work, protein vaccination with CpG-ODN as adjuvant following classical protocols or systemic treatment with CpG-ODN alone is not promising for the cure of cancer. In contrast, CpG-ODN was most effective as a proinflammatory factor in T cell-based immunotherapy, in which it activates innate immunity and acts on the tumor microenvironment to increase accessibility for effector cell infiltration. A crucial difference between vaccination with Tag/CpG-ODN and adoptive transfers/CpG-ODN is the route and frequency of CpG-ODN application, indicating that the inflammatory effect of CpG-ODN is self-limiting and repetitive i.v. injections are required for maximal efficacy. Moreover, the endogenously primed CTL response after vaccination might be relatively weak compared with adoptive transfers of two million highly primed CD4+ and CD8+ effector cells. It will be interesting to investigate the vaccination efficiency in a scenario in which CpG-ODN is directly conjugated to the tumor Ag (39).


    Acknowledgments
 
We thank Christine Schmitt, Ludmila Umansky, and Kathrin Frank for excellent technical assistance; Dr. H. Spring for confocal microscopy; and Drs. R. Flavell, I. Förster, T. Geiger, and D. Hanahan for providing transgenic mice.


    Footnotes
 
1 This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB 405) and the European Community (QLG1-CT-1999-00202). Back

2 Address correspondence and reprint requests to Dr. Ruth Ganss, Department of Molecular Immunology, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany. E-mail address: r.ganss{at}dkfz.de Back

3 Abbreviations used in this paper: RIP, rat insulin promoter; CpG, cytosine-phosphorothioate-guanine; DC, dendritic cell; ODN, oligodeoxynucleotide; Tag, SV40 T Ag. Back

Received for publication October 9, 2003. Accepted for publication February 27, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ganss, R., A. Limmer, T. Sacher, B. Arnold, G. J. Hämmerling. 1999. Autoaggression and tumor rejection: it takes more than self-specific T-cell activation. Immunol. Rev. 169:263.[Medline]
  2. Ganss, R., D. Hanahan. 1998. Tumor microenvironment can restrict the effectiveness of activated antitumor lymphocytes. Cancer Res. 58:4673.[Abstract/Free Full Text]
  3. Ganss, R., E. Ryschich, E. Klar, B. Arnold, G. J. Hämmerling. 2002. Combination of T-cell therapy and trigger of inflammation induces remodeling of the vasculature and tumor eradication. Cancer Res. 62:1462.[Abstract/Free Full Text]
  4. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  5. Krieg, A. M., G. Hartmann, A. K. Yi. 2000. Mechanism of action of CpG DNA. Curr. Top. Microbiol. Immunol. 247:1.[Medline]
  6. Krieg, A. M.. 2003. CpG motifs: the active ingredient in bacterial extracts?. Nat. Med. 9:831.[Medline]
  7. Jahrsdorfer, B., G. J. Weiner. 2003. CpG oligodeoxynucleotides for immune stimulation in cancer immunotherapy. Curr. Opin. Investig. Drugs 4:686.[Medline]
  8. Brunner, C., J. Seiderer, A. Schlamp, M. Bidlingmaier, A. Eigler, W. Haimerl, H. A. Lehr, A. M. Krieg, G. Hartmann, S. Endres. 2000. Enhanced dendritic cell maturation by TNF-{alpha} or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo. J. Immunol. 165:6278.[Abstract/Free Full Text]
  9. Davila, E., R. Kennedy, E. Celis. 2003. Generation of antitumor immunity by cytotoxic T lymphocyte epitope peptide vaccination, CpG-oligodeoxynucleotide adjuvant, and CTLA-4 blockade. Cancer Res. 63:3281.[Abstract/Free Full Text]
  10. Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
  11. Baral, R. N., A. Saha, S. K. Chatterjee, K. A. Foon, A. M. Krieg, G. J. Weiner, M. Bhattacharya-Chatterjee. 2003. Immunostimulatory CpG oligonucleotides enhance the immune response of anti-idiotype vaccine that mimics carcinoembryonic antigen. Cancer Immunol. Immunother. 52:317.[Medline]
  12. Carpentier, A. F., L. Chen, F. Maltonti, J. Y. Delattre. 1999. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice. Cancer Res. 59:5429.[Abstract/Free Full Text]
  13. Kawarada, Y., R. Ganss, N. Garbi, T. Sacher, B. Arnold, G. J. Hämmerling. 2001. NK- and CD8+ T cell-mediated eradication of established tumors by peritumoral injection of CpG-containing oligodeoxynucleotides. J. Immunol. 167:5247.[Abstract/Free Full Text]
  14. Heckelsmiller, K., K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, G. Hartmann. 2002. Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors to cure established tumors in a murine colon carcinoma model. J. Immunol. 169:3892.[Abstract/Free Full Text]
  15. Carpentier, A. F., J. Xie, K. Mokhtari, J. Y. Delattre. 2000. Successful treatment of intracranial gliomas in rat by oligodeoxynucleotides containing CpG motifs. Clin. Cancer Res. 6:2469.[Abstract/Free Full Text]
  16. Nguyen, L. T., A. R. Elford, K. Murakami, K. M. Garza, S. P. Schoenberger, B. Odermatt, D. E. Speiser, P. S. Ohashi. 2002. Tumor growth enhances cross-presentation leading to limited T cell activation without tolerance. J. Exp. Med. 195:423.[Abstract/Free Full Text]
  17. Hanahan, D.. 1985. Heritable formation of pancreatic {beta}-cell tumors in transgenic mice expressing recombinant insulin/simian virus 40 oncogenes. Nature 315:115.[Medline]
  18. Skowronski, J., C. Jolicoeur, S. Alpert, D. Hanahan. 1990. Determinants of the B-cell response against a transgenic autoantigen. Proc. Natl. Acad. Sci. USA 87:7487.[Abstract/Free Full Text]
  19. Geiger, T., L. R. Gooding, R. A. Flavell. 1992. T-cell responsiveness to an oncogenic peripheral protein and spontaneous autoimmunity in transgenic mice. Proc. Natl. Acad. Sci. USA 89:2985.[Abstract/Free Full Text]
  20. Förster, I., R. Hirose, J. M. Arbeit, B. E. Clausen, D. Hanahan. 1995. Limited capacity for tolerization of CD4+ T cells specific for a pancreatic {beta} cell neo-antigen. Immunity 2:573.[Medline]
  21. Van Kaer, L., P. G. Ashton-Rickardt, H. L. Ploegh, S. Tonegawa. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD48+ T cells. Cell 71:1205.[Medline]
  22. Jolicoeur, C., D. Hanahan, K. M. Smith. 1994. T-cell tolerance toward a transgenic {beta}-cell antigen and transcription of endogenous pancreatic genes in thymus. Proc. Natl. Acad. Sci. USA 91:6707.[Abstract/Free Full Text]
  23. Lyons, A. B., C. R. Parish. 1994. Determination of lymphocyte division by flow cytometry. J. Immunol. Methods 171:131.[Medline]
  24. Kurts, C., H. Kosaka, F. R. Carbone, J. F. Miller, W. R. Heath. 1997. Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8+ T cells. J. Exp. Med. 186:239.[Abstract/Free Full Text]
  25. Aichele, P., K. Brduscha-Riem, S. Oehen, B. Odermatt, R. M. Zinkernagel, H. Hengartner, H. Pircher. 1997. Peptide antigen treatment of naive and virus-immune mice: antigen-specific tolerance versus immunopathology. Immunity 6:519.[Medline]
  26. Coles, R. M., S. N. Mueller, W. R. Heath, F. R. Carbone, A. G. Brooks. 2002. Progression of armed CTL from draining lymph node to spleen shortly after localized infection with herpes simplex virus 1. J. Immunol. 168:834.[Abstract/Free Full Text]
  27. Tanaka, T., F. Kitamura, Y. Nagasaka, K. Kuida, H. Suwa, M. Miyasaka. 1993. Selective long-term elimination of natural killer cells in vivo by an anti-interleukin 2 receptor {beta} chain monoclonal antibody in mice. J. Exp. Med. 178:1103.[Abstract/Free Full Text]
  28. Rabinowitz, S. S., S. Gordon. 1991. Macrosialin, a macrophage-restricted membrane sialoprotein differentially glycosylated in response to inflammatory stimuli. J. Exp. Med. 174:827.[Abstract/Free Full Text]
  29. Onrust, S. V., P. M. Hartl, S. D. Rosen, D. Hanahan. 1996. Modulation of L-selectin ligand expression during an immune response accompanying tumorigenesis in transgenic mice. J. Clin. Invest. 97:54.[Medline]
  30. Ryschich, E., J. Schmidt, G. J. Hämmerling, E. Klar, R. Ganss. 2002. Transformation of the microvascular system during multistage tumorigenesis. Int. J. Cancer 97:719.[Medline]
  31. Schell, T. D., S. S. Tevethia. 2001. Control of advanced choroid plexus tumors in SV40 T antigen transgenic mice following priming of donor CD8+ T lymphocytes by the endogenous tumor antigen. J. Immunol. 167:6947.[Abstract/Free Full Text]
  32. Staveley-O’Carroll, K., E. Sotomayor, J. Montgomery, I. Borrello, L. Hwang, S. Fein, D. Pardoll, H. Levitsky. 1998. Induction of antigen-specific T cell anergy: an early event in the course of tumor progression. Proc. Natl. Acad. Sci. USA 95:1178.[Abstract/Free Full Text]
  33. Ye, X., J. McCarrick, L. Jewett, B. B. Knowles. 1994. Timely immunization subverts the development of peripheral nonresponsiveness and suppresses tumor development in simian virus 40 tumor antigen-transgenic mice. Proc. Natl. Acad. Sci. USA 91:3916.[Abstract/Free Full Text]
  34. Staveley-O’Carroll, K., T. D. Schell, M. Jimenez, L. M. Mylin, M. J. Tevethia, S. P. Schoenberger, S. S. Tevethia. 2003. In vivo ligation of CD40 enhances priming against the endogenous tumor antigen and promotes CD8+ T cell effector function in SV40 T antigen transgenic mice. J. Immunol. 171:697.[Abstract/Free Full Text]
  35. Wick, M., P. Dubey, H. Koeppen, C. T. Siegel, P. E. Fields, L. Chen, J. A. Bluestone, H. Schreiber. 1997. Antigenic cancer cells grow progressively in immune hosts without evidence for T cell exhaustion or systemic anergy. J. Exp. Med. 186:229.[Abstract/Free Full Text]
  36. Willimsky, G., T. Blankenstein. 2000. Interleukin-7/B7.1-encoding adenoviruses induce rejection of transplanted but not nontransplanted tumors. Cancer Res. 60:685.[Abstract/Free Full Text]
  37. Sfondrini, L., D. Besusso, C. Rumio, M. Rodolfo, S. Menard, A. Balsari. 2002. Prevention of spontaneous mammary adenocarcinoma in HER-2/neu transgenic mice by foreign DNA. FASEB J. 16:1749.[Abstract/Free Full Text]
  38. Sacher, T., P. Knolle, T. Nichterlein, B. Arnold, G. J. Hämmerling, A. Limmer. 2002. CpG-ODN-induced inflammation is sufficient to cause T-cell-mediated autoaggression against hepatocytes. Eur. J. Immunol. 32:3628.[Medline]
  39. Cho, H. J., K. Takabayashi, P. M. Cheng, M. D. Nguyen, M. Corr, S. Tuck, E. Raz. 2000. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism. Nat. Biotechnol. 18:509.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 172: 5811-5812. [Full Text]  



This article has been cited by other articles:


Home page
Cancer Res.Home page
J. Kohlmeyer, M. Cron, J. Landsberg, T. Bald, M. Renn, S. Mikus, S. Bondong, D. Wikasari, E. Gaffal, G. Hartmann, et al.
Complete Regression of Advanced Primary and Metastatic Mouse Melanomas following Combination Chemoimmunotherapy
Cancer Res., August 1, 2009; 69(15): 6265 - 6274.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Hamzah, J. G. Altin, T. Herringson, C. R. Parish, G. J. Hammerling, H. O'Donoghue, and R. Ganss
Targeted Liposomal Delivery of TLR9 Ligands Activates Spontaneous Antitumor Immunity in an Autochthonous Cancer Model
J. Immunol., July 15, 2009; 183(2): 1091 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Wei, S. Wang, D. Zhang, S. Hou, W. Qian, B. Li, H. Guo, G. Kou, J. He, H. Wang, et al.
Targeted Delivery of Tumor Antigens to Activated Dendritic Cells via CD11c Molecules Induces Potent Antitumor Immunity in Mice
Clin. Cancer Res., July 15, 2009; 15(14): 4612 - 4621.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Epardaud, K. G. Elpek, M. P. Rubinstein, A.-r. Yonekura, A. Bellemare-Pelletier, R. Bronson, J. A. Hamerman, A. W. Goldrath, and S. J. Turley
Interleukin-15/Interleukin-15R{alpha} Complexes Promote Destruction of Established Tumors by Reviving Tumor-Resident CD8+ T Cells
Cancer Res., April 15, 2008; 68(8): 2972 - 2983.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. B. J. Wong, R. Bos, and L. A. Sherman
Tumor-Specific CD4+ T Cells Render the Tumor Environment Permissive for Infiltration by Low-Avidity CD8+ T Cells
J. Immunol., March 1, 2008; 180(5): 3122 - 3131.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. J. Currie, R. G. van der Most, S. A. Broomfield, A. C. Prosser, M. G. Tovey, and B. W. S. Robinson
Targeting the Effector Site with IFN-{alpha}{beta}-Inducing TLR Ligands Reactivates Tumor-Resident CD8 T Cell Responses to Eradicate Established Solid Tumors
J. Immunol., February 1, 2008; 180(3): 1535 - 1544.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Otahal, B. B. Knowles, S. S. Tevethia, and T. D. Schell
Anti-CD40 Conditioning Enhances the TCD8 Response to a Highly Tolerogenic Epitope and Subsequent Immunotherapy of Simian Virus 40 T Antigen-Induced Pancreatic Tumors
J. Immunol., November 15, 2007; 179(10): 6686 - 6695.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. M. Paulos, A. Kaiser, C. Wrzesinski, C. S. Hinrichs, L. Cassard, A. Boni, P. Muranski, L. Sanchez-Perez, D. C. Palmer, Z. Yu, et al.
Toll-like Receptors in Tumor Immunotherapy
Clin. Cancer Res., September 15, 2007; 13(18): 5280 - 5289.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. M. Wall, K. Milne, M. L. Martin, P. H. Watson, P. Theiss, and B. H. Nelson
Spontaneous Mammary Tumors Differ Widely in Their Inherent Sensitivity to Adoptively Transferred T Cells
Cancer Res., July 1, 2007; 67(13): 6442 - 6450.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Reibke, N. Garbi, R. Ganss, G. J. Hammerling, B. Arnold, and T. Oelert
CD8+ regulatory T cells generated by neonatal recognition of peripheral self-antigen
PNAS, October 10, 2006; 103(41): 15142 - 15147.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Nelson and R. Ganss
Tumor growth or regression: powered by inflammation
J. Leukoc. Biol., October 1, 2006; 80(4): 685 - 690.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Otahal, T. D. Schell, S. C. Hutchinson, B. B. Knowles, and S. S. Tevethia
Early Immunization Induces Persistent Tumor-Infiltrating CD8+ T Cells against an Immunodominant Epitope and Promotes Lifelong Control of Pancreatic Tumor Progression in SV40 Tumor Antigen Transgenic Mice.
J. Immunol., September 1, 2006; 177(5): 3089 - 3099.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. de Witte, M. Coccoris, M. C. Wolkers, M. D. van den Boom, E. M. Mesman, J.-Y. Song, M. van der Valk, J. B. A. G. Haanen, and T. N. M. Schumacher
Targeting self-antigens through allogeneic TCR gene transfer
Blood, August 1, 2006; 108(3): 870 - 877.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Tormo, A. Ferrer, P. Bosch, E. Gaffal, E. Basner-Tschakarjan, J. Wenzel, and T. Tuting
Therapeutic Efficacy of Antigen-Specific Vaccination and Toll-Like Receptor Stimulation against Established Transplanted and Autochthonous Melanoma in Mice.
Cancer Res., May 15, 2006; 66(10): 5427 - 5435.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. I. Garbe, B. Vermeer, J. Gamrekelashvili, R. v. Wasielewski, F. R. Greten, A. M. Westendorf, J. Buer, R. M. Schmid, M. P. Manns, F. Korangy, et al.
Genetically Induced Pancreatic Adenocarcinoma Is Highly Immunogenic and Causes Spontaneous Tumor-Specific Immune Responses
Cancer Res., January 1, 2006; 66(1): 508 - 516.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
A Limmer, R Ganss, N Garbi, B Arnold, and G J Hammerling
Stimulation of autoimmunity by toll-like receptor ligands
Ann Rheum Dis, November 1, 2005; 64(suppl_4): iv15 - iv17.
[Full Text] [PDF]


Home page
Cancer Res.Home page
K. Mahnke, Y. Qian, S. Fondel, J. Brueck, C. Becker, and A. H. Enk
Targeting of Antigens to Activated Dendritic Cells In vivo Cures Metastatic Melanoma in Mice
Cancer Res., August 1, 2005; 65(15): 7007 - 7012.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Lugade, J. P. Moran, S. A. Gerber, R. C. Rose, J. G. Frelinger, and E. M. Lord
Local Radiation Therapy of B16 Melanoma Tumors Increases the Generation of Tumor Antigen-Specific Effector Cells That Traffic to the Tumor
J. Immunol., June 15, 2005; 174(12): 7516 - 7523.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Gough, M. Crittenden, U. Thanarajasingam, L. Sanchez-Perez, J. Thompson, D. Jevremovic, and R. Vile
Gene Therapy to Manipulate Effector T Cell Trafficking to Tumors for Immunotherapy
J. Immunol., May 1, 2005; 174(9): 5766 - 5773.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Guiducci, A. P. Vicari, S. Sangaletti, G. Trinchieri, and M. P. Colombo
Redirecting In vivo Elicited Tumor Infiltrating Macrophages and Dendritic Cells towards Tumor Rejection
Cancer Res., April 15, 2005; 65(8): 3437 - 3446.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Lyman, C. T. Nugent, K. L. Marquardt, J. A. Biggs, E. G. Pamer, and L. A. Sherman
The Fate of Low Affinity Tumor-Specific CD8+ T Cells in Tumor-Bearing Mice
J. Immunol., March 1, 2005; 174(5): 2563 - 2572.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garbi, N.
Right arrow Articles by Ganss, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garbi, N.
Right arrow Articles by Ganss, R.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Pancreatic Cancer


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS