|
|
||||||||
CUTTING EDGE |






* Cambridge Institute for Medical Research, Wellcome Trust, Addenbrookes Hospital,
Laboratory of Lymphocyte Signaling and Development, Molecular Immunology Programme, Babraham Institute,
University of Cambridge and National Blood Service, and
Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom; and
¶ Dunn School of Pathology, University of Oxford, Oxford, United Kingdom
| Abstract |
|---|
|
|
|---|
-granules, which are up-regulated to the cell surface following activation. TLT1 recruited Src homology 2 domain-containing tyrosine phosphatase (SHP)-2 to the "classical" ITIM (Y281) but not the "nonclassical" ITIM (Y245). In contrast to previously characterized ITIM receptors, TLT1 enhanced, rather than inhibited, Fc
RI-mediated calcium signaling in rat basophilic leukemia cells, a property dependent on the SHP-2 recruiting classical Y281 ITIM. Therefore, TLT1 represents a new costimulatory ITIM immunoreceptor and is the second ITIM-bearing receptor to be identified in platelets after platelet endothelial cell adhesion molecule-1. | Introduction |
|---|
|
|
|---|
, DAP12, Fc
RIIA, and the FcR common
-chain, induce cellular activation via protein tyrosine kinase (PTK) mediated signaling cascades (1). In contrast, inhibitory receptors encode one or more immunoreceptor tyrosine-based inhibition motifs (ITIMs), characterized by the residues, S/I/V/LXYXXV/L (2). Phosphorylation of ITIMs by PTKs on activating receptors leads to the recruitment of Src homology (SH)2 domain-containing tyrosine phosphatases (SHP), such as SHP-1 or SHP-2, or the inositol phosphatase, SH2 domain containing inositol 5-phosphatase (SHIP), which can mediate cellular inhibition (2). The triggering receptors expressed on myeloid cells (TREM) family include TREM1, TREM2 and NKp44 and are activating receptors that interact with DNAX activating protein of 12 kDa (DAP12) (3). We have identified a new TREM family member termed, TREM-like transcript-1 (TLT1) (4). TLT1 is typical of the TREM family comprising a single Ig superfamily V-type domain but, unlike the others, is not predicted to interact with DAP12 (4). Instead, two isoforms of TLT1 are predicted from cDNAs that share identical extracellular and transmembrane domains but differ in their cyt.
A 199 aa splice variant of TLT1 (TLT1sp) is predicted, which encodes a short cyt of 14 aa containing a potential dileucine receptor sorting motif similar to that found in the invariant chain of MHC class II molecules (4). In contrast, the 126 aa cyt of TLT1 contains two consensus ITIMs. The C-terminal VXYXXV conforms to a "classical" ITIM (2), whereas the membrane-proximal "nonclassical" TXYXXL ITIM is similar to one that has been shown to recruit SHP-2 in the cyt of CD33 (5). Either of the ITIMs could be responsible for recruiting SHP-1, SHP-2, or SHIP. We set out to characterize the signaling capability and expression of TLT1.
| Materials and Methods |
|---|
|
|
|---|
Rat basophilic leukemia cells (RBL-2H3) were cultured in RPMI 1640 with 10% FCS, penicillin, and streptomycin. PBL were purified over Lymphoprep (Nycomed Pharma, Oslo, Norway). Platelets were isolated, as described (6). Platelets were activated with 20 µM thrombin receptor activating peptide (TRAP) (Sigma-Aldrich, Poole, U.K.) for 5 min at 37°C before fixing in 1% formaldehyde.
Cloning and expression of recombinant proteins
For addition of rFLAG-tag, TLT1 cDNA was amplified using the following primers: forward: ATAAAGCTTAGCCTCCCTGAGGTGCTG; reverse: CTCGAATTCGCTTAGCTGGATGGAGTCTG.
PCR products were cloned into the p3XFLAG-CMV-9 expression vector (Sigma-Aldrich) to give the wild-type (wt) TLT1 construct. cDNAs encoding the shared extracellular domain of TLT1/TLT1sp were cloned into the pMT/BiP/V5-His vector in the Drosophila expression system (Invitrogen, Paisley, U.K.) with a histidine (His) tag using the following primers: forward: AACTGCGGCCCAGCCGGCCATGGCCAGCCTCCCTGAGGTGCTG; reverse: ACTTGCGGCCGCCTTCTCATCCTGGCTGGG.
His-tagged TLT1 protein (TLT1-His) was purified, as described (7).
Peptides, immunizations, and Abs
Keyhole limpet hemocyanin-conjugated peptides designed to the cyt of TLT1sp and TLT1 used to immunize rabbits were: cytTLT1sp: CKRKQESLLSGPPRQ; cytTLT1: CGPAQNPPNNQTPSS.
The TLT1-His protein was used to raise rabbit antisera to the TLT1/TLT1sp extracellular domain. Anti-SHP-1 and anti-SHP-2 antisera were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-SHIP antisera and anti-Fc
RI
mAb were purchased from Upstate (Cambridge, U.K.). Goat anti-rabbit Ig Alexa-568 was purchased from Molecular Probes (Leiden, The Netherlands). Anti-phosphotyrosine mAb 4G10 was obtained as a hybridoma tissue culture supernatant. Goat anti-mouse Ig FITC, swine anti-rabbit Ig FITC, goat anti-rabbit Ig HRP, un- and HRP-conjugated goat anti-mouse Ig, and unconjugated mouse IgG2a isotype control mAb were purchased from DAKO (Ely, U.K.). Un- and FITC-conjugated anti-FLAG (M2; IgG1) mAb were purchased from Sigma-Aldrich. Anti-rat
2-microglobulin (anti-
2M; IgG1) and anti-human CD62P (IgG2a) mAbs were purchased from BD Biosciences (Heidelberg, Germany).
Immunostaining, flow cytometry, and confocal microscopy
Intracellular immunostaining, flow cytometry, and confocal microscopy were performed, as described (8).
Site-directed mutagenesis of wtTLT1 ITIMs
Tyrosine to phenylalanine (Y>F) mutations of the ITIMs in the wtTLT1 construct to give the Y>F 245, Y>F 281, and Y>F 245, 281 mutant constructs were performed using the QuikChange site-directed mutagenesis kit, according to the manufacturers instructions (Stratagene) using the following oligonucleotides (Y>F mutations underlined): Y>F 245 forward: CATTTGACAATACCACCTTCACCAGCCTACCTCTTG; Y>F 245 reverse: CAAGAGGTAGGCTGGTGAAGGTGGTATTGTCAAATG; Y>F 281 forward: CTCCAAGCCTGTGACATTTGCCACAGTAATCTTCC; Y>F 281 reverse: GGAAGATTACTGTGGCAAATGTCACAGGCTTGGAG.
Clones were verified by sequencing.
Transfections
Two micrograms of each FLAG construct were transfected into RBL-2H3 using Lipofectamine 2000 (Invitrogen). Stable cell lines were selected in the presence of 1 mg/ml active G418.
Immunoprecipitation and immunoblotting
Immunoprecipitation, Western blotting, and determination of tyrosine phosphorylation of wtTLT1 and Y>F mutant proteins were done as described (9).
Cytosolic calcium measurement
Intracellular calcium mobilization was determined, as described (10).
| Results |
|---|
|
|
|---|
-granules of resting plateletsUsing antisera raised against peptides designed to the unique cyt of TLT1 (anti-cytTLT1) and TLT1sp (anti-cytTLT1sp), protein species of molecular masses 20 and 35 kDa, respectively, were recognized in Western blots of PBL lysates under reducing SDS-PAGE conditions (Fig. 1A). Preimmune antisera did not recognize any protein species (Fig. 1A).
|
-granules (Fig. 1Cii), we found TLT1sp colocalized with CD62P in
-granules when the two images were merged (Fig. 1Ciii). Anti-TLT1 antisera and anti-CD62P mAb immunostaining revealed that TLT1 was also expressed in
-granules (Fig. 1Civ). Some TLT1 and TLT1sp staining did not colocalize with CD62P suggesting these isoforms may have their own discrete subcellular distribution within
-granules or localize to other as yet unidentified intracellular compartments. TLT1 and TLT1sp are expressed at the cell surface of platelets following activation with TRAP
The anti-extTLT1 antisera, raised to the extracellular domain shared by both TLT1 and TLT1sp proteins (extTLT1) was used to stain platelets in flow cytometry. Neither TLT1 nor TLT1sp were detected at the cell surface of resting platelets (Fig. 2Ai). This was not due to a failure of the anti-extTLT1 antisera to recognize cell surface-expressed extTLT1 because the same antisera recognized cell surface FLAG-tagged TLT1 protein (wtTLT1) expressed in a stable RBL-2H3 cell-line (Fig. 2Aii), but not in parental RBL-2H3 cells (Fig. 2Aiii).
|
-granules and lack of detectable cell surface staining in resting platelets suggested that these proteins might be regulated by cell activation (11). We activated platelets using TRAP and found increased cell surface expression of CD62P on activated, but not resting, platelets by flow cytometry (Fig. 2Bi). Using anti-extTLT1 antisera, platelets from the same donor were positive for extTLT1 following TRAP activation (Fig. 2Bii). These results show that TLT1 and TLT1sp colocalized with CD62P in the
-granules of resting platelets but were found on the cell surface with CD62P following TRAP activation. TLT1 recruits SHP-2 to the C-terminal (Y281) classical ITIM
To perform TLT1-specific mAb cross-linking experiments that would not be complicated by coexpression of TLT1sp and to determine which ITIM might be responsible for the recruitment of phosphatases, such as SHP-1, SHP-2, or SHIP, we generated stable RBL-2H3 cell lines expressing wtTLT1 and tyrosine to phenylalanine (Y>F) mutants of the TLT1 ITIMs. Expression levels for wtTLT1, Y>F245, Y>F281 and Y245, 281 proteins in each stable cell line are shown in Fig. 3A.
|
When the immunoblot was probed using anti SHP-2 antisera, increased SHP-2 association was detected in pervanadate-treated wtTLT1 cells compared with untreated cells (Fig. 3D). SHP-2 was recruited to cells expressing the Y>F 245 TLT1 mutation, but not the Y>F 281 or Y>F 245, 281 mutations, showing that the C-terminal classical Y281 ITIM is essential for SHP-2 recruitment (Fig. 3D). SHP-1 and SHIP could not be detected in any of the IPs analyzed despite abundant expression in cell lysates (Fig. 3D).
Fc
RI-mediated calcium signaling is enhanced by TLT1 and is dependent on Y281 in RBL-2H3
We examined the regulation of Fc
RI-mediated calcium signaling in RBL-2H3 cells stably expressing either wtTLT1, Y>F 245, or Y>F 281 cell surface proteins. Cross-linking anti-Fc
RI
+ anti-
2M mAbs in either wtTLT1, Y>F 245, or Y>F 281-expressing cells resulted in identical calcium release traces, indicating that Fc
RI-mediated calcium signaling was intact in the three cell lines (Fig. 4, AC, black lines and Fig. 4D, black bars). However, striking differences were observed in the peak Fc
RI-mediated calcium response when anti-Fc
RI
and M2 mAbs were coaggregated (Fig. 4, AC, red lines and Fig. 4D, red bars). Surprisingly, RBL-2H3 cells expressing either the wtTLT1 or Y>F 245 proteins had significantly enhanced, rather than inhibited, peak intracellular calcium levels in response to receptor cross-linking compared with anti-Fc
RI
+ anti-
2M mAb-treated controls (Figs. 4, A and B, red and black lines, respectively). The mutation of Y281 in Y>F 281-expressing cells completely abolished this costimulatory effect, resulting in calcium responses equivalent to control cells (Fig. 4, C and D). Isolated cross-linking of either wtTLT1, Y>F 245, or Y>F 281 in cells preloaded with M2 mAb alone had no effect on intracellular calcium release (Fig. 4, AC, blue lines), consistent with the previous work showing that ITIM-encoding receptors require coaggregation with activating receptors to affect signaling (2, 12, 13).
|
| Discussion |
|---|
|
|
|---|
RI resulted in an enhanced rather than diminished early calcium signal. TLT1-mediated up-regulation of Fc
RI-mediated calcium signaling was dependent on Y281, as the Y>F mutation of this residue abolished this effect. In this respect, TLT1 does not behave like classical ITIM-containing receptors, which down-regulate calcium responses. Therefore, TLT1 represents a new subclass of costimulatory ITIM receptor and is likely to mediate these effects through the recruitment of SHP-2 because the Y>F 281 mutation abolished SHP-2 binding and the costimulatory effect on Fc
RI-mediated calcium signaling.
TLT1 and TLT1sp colocalized with CD62P in
-granules of resting platelets and TRAP activation resulted in redistribution of the shared TLT1 and TLT1sp extracellular domains to the cell surface with CD62P, presumably for TLT1 and TLT1sp to interact with their respective ligand(s) and, based on our results in RBL-2H3, for TLT1 to interact with signaling molecules, e.g., ITAM receptors and SHP-2 to mediate its costimulatory activity. In platelets, TLT1 is therefore likely to mediate its costimulatory activity downstream of initial activation events, akin to a role attributed to platelet endothelial cell adhesion molecule (PECAM)-1, the first ITIM-bearing receptor to be identified in platelets (14).
TLT1 is the second ITIM-bearing receptor to be identified in platelets after PECAM-1. Like TLT1, PECAM-1 also occurs in the
-granules but, in contrast, is known to attenuate signaling via SHP-2 (14). TLT1 differs from PECAM-1 and other ITIM receptors in encoding a unique polyproline-rich region (PRR). Although we have not yet identified any SH3 domain binding partners for TLT1, the PRR is likely to be important in mediating its costimulatory properties because this motif is not found in other inhibitory ITIM receptors. Identifying the ligand(s) for TLT1 and TLT1sp will be an important next step in discovering their roles in platelet biology and thrombus formation and may assist in the development of novel clinical strategies.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Alexander D. Barrow, Cambridge Institute for Medical Research, Wellcome Trust/Medical Research Council Building, Addenbrookes Hospital, Hills Road, Cambridge, CB2 2XY, U.K. E-mail address: adb44{at}cam.ac.uk ![]()
3 Abbreviations used in this paper: ITAM, immunoreceptor tyrosine-based activation motif; cyt, cytoplasmic tail; PTK, protein tyrosine kinase; ITIM, immunoreceptor tyrosine-based inhibition motif; SH, Src homology; SHP, SH2 domain-containing tyrosine phosphatase; SHIP, SH2 domain containing inositol 5-phosphatase; TREM, triggering receptor expressed on myeloid cells; TLT1, TREM-like transcript-1; sp, splice variant; RBL-2H3, rat basophilic leukemia cell; TRAP, thrombin receptor activating peptide; wt, wild type; His, histidine;
2M,
2-microglobulin; Y>F, tyrosine to phenylalanine; FSC, forward scatter; extTLT1, extracellular TLT1/TLT1sp domain; PRR, proline-rich region; IP, immunoprecipitation; PECAM-1, platelet endothelial cell adhesion molecule-1; DAP12, DNAX activating protein of 12 kDa. ![]()
Received for publication February 12, 2004. Accepted for publication March 25, 2004.
| References |
|---|
|
|
|---|
RI coupling to phospholipase D initiates sphingosine kinase-mediated calcium mobilization and vesicular trafficking. J. Biol. Chem. 273:9393.
-granules. Blood Rev. 7:52.[Medline]
This article has been cited by other articles:
![]() |
S. J.A. Korporaal, C. A. Koekman, S. Verhoef, D. E. van der Wal, M. Bezemer, M. Van Eck, and J.-W. N. Akkerman Downregulation of Platelet Responsiveness Upon Contact With LDL by the Protein-Tyrosine Phosphatases SHP-1 and SHP-2 Arterioscler Thromb Vasc Biol, March 1, 2009; 29(3): 372 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mori, A. C. Pearce, J. C. Spalton, B. Grygielska, J. A. Eble, M. G. Tomlinson, Y. A. Senis, and S. P. Watson G6b-B Inhibits Constitutive and Agonist-induced Signaling by Glycoprotein VI and CLEC-2 J. Biol. Chem., December 19, 2008; 283(51): 35419 - 35427. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Haselmayer, L. Grosse-Hovest, P. von Landenberg, H. Schild, and M. P. Radsak TREM-1 ligand expression on platelets enhances neutrophil activation Blood, August 1, 2007; 110(3): 1029 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Newland, I. C. Macaulay, A. R. Floto, E. C. de Vet, W. H. Ouwehand, N. A. Watkins, P. A. Lyons, and D. R. Campbell The novel inhibitory receptor G6B is expressed on the surface of platelets and attenuates platelet function in vitro Blood, June 1, 2007; 109(11): 4806 - 4809. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Tessmer, C. Fugere, F. Stevenaert, O. V. Naidenko, H. J. Chong, G. Leclercq, and L. Brossay KLRG1 binds cadherins and preferentially associates with SHIP-1 Int. Immunol., April 1, 2007; 19(4): 391 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. A. Senis, M. G. Tomlinson, A. Garcia, S. Dumon, V. L. Heath, J. Herbert, S. P. Cobbold, J. C. Spalton, S. Ayman, R. Antrobus, et al. A Comprehensive Proteomics and Genomics Analysis Reveals Novel Transmembrane Proteins in Human Platelets and Mouse Megakaryocytes Including G6b-B, a Novel Immunoreceptor Tyrosine-based Inhibitory Motif Protein Mol. Cell. Proteomics, March 1, 2007; 6(3): 548 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Lee, M. van Lier, I. A. M. Relou, L. Foley, J.-W. N. Akkerman, H. F. G. Heijnen, and R. W. Farndale Lipid Rafts Facilitate the Interaction of PECAM-1 with the Glycoprotein VI-FcR {gamma}-Chain Complex in Human Platelets J. Biol. Chem., December 22, 2006; 281(51): 39330 - 39338. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Imhof, A.-S. Wavreille, A. May, M. Zacharias, S. Tridandapani, and D. Pei Sequence Specificity of SHP-1 and SHP-2 Src Homology 2 Domains: CRITICAL ROLES OF RESIDUES BEYOND THE pY+3 POSITION J. Biol. Chem., July 21, 2006; 281(29): 20271 - 20282. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. King, B. R. Herrin, and L. B. Justement Trem-Like Transcript 2 Is Expressed on Cells of the Myeloid/Granuloid and B Lymphoid Lineage and Is Up-Regulated in Response to Inflammation J. Immunol., May 15, 2006; 176(10): 6012 - 6021. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |