The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barrow, A. D.
Right arrow Articles by Trowsdale, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barrow, A. D.
Right arrow Articles by Trowsdale, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*L-TYROSINE
The Journal of Immunology, 2004, 172: 5838-5842.
Copyright © 2004 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: TREM-Like Transcript-1, a Platelet Immunoreceptor Tyrosine-Based Inhibition Motif Encoding Costimulatory Immunoreceptor that Enhances, Rather than Inhibits, Calcium Signaling via SHP-2 1

Alexander D. Barrow2,*, Emmanuelle Astoul{dagger}, Andres Floto*, Gary Brooke, Ingrid A. M. Relou§, Nicola S. Jennings{ddagger}, Kenneth G. C. Smith*, Willem Ouwehand{ddagger}, Richard W. Farndale§, Denis R. Alexander{dagger} and John Trowsdale*

* Cambridge Institute for Medical Research, Wellcome Trust, Addenbrookes Hospital, {dagger} Laboratory of Lymphocyte Signaling and Development, Molecular Immunology Programme, Babraham Institute, {ddagger} University of Cambridge and National Blood Service, and § Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom; and Dunn School of Pathology, University of Oxford, Oxford, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To date, immunoreceptor tyrosine-based inhibition motifs (ITIMs) have been shown to mediate inhibitory properties. We report a novel triggering receptor expressed on myeloid cells (TREM) family member, TREM-like transcript-1 (TLT1), which differs from the activating members because its cytoplasmic tail contains two ITIMs at Y245 and Y281. A TLT1 splice variant (TLT1sp) encodes a different cytoplasmic tail lacking ITIMs. Both isoforms are expressed in resting platelet {alpha}-granules, which are up-regulated to the cell surface following activation. TLT1 recruited Src homology 2 domain-containing tyrosine phosphatase (SHP)-2 to the "classical" ITIM (Y281) but not the "nonclassical" ITIM (Y245). In contrast to previously characterized ITIM receptors, TLT1 enhanced, rather than inhibited, Fc{epsilon}RI-mediated calcium signaling in rat basophilic leukemia cells, a property dependent on the SHP-2 recruiting classical Y281 ITIM. Therefore, TLT1 represents a new costimulatory ITIM immunoreceptor and is the second ITIM-bearing receptor to be identified in platelets after platelet endothelial cell adhesion molecule-1.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunoreceptor tyrosine-based activation motifs (ITAMs), 3 such as those found in the cytoplasmic tail (cyt) of CD3{zeta}, DAP12, Fc{gamma}RIIA, and the FcR common {gamma}-chain, induce cellular activation via protein tyrosine kinase (PTK) mediated signaling cascades (1). In contrast, inhibitory receptors encode one or more immunoreceptor tyrosine-based inhibition motifs (ITIMs), characterized by the residues, S/I/V/LXYXXV/L (2). Phosphorylation of ITIMs by PTKs on activating receptors leads to the recruitment of Src homology (SH)2 domain-containing tyrosine phosphatases (SHP), such as SHP-1 or SHP-2, or the inositol phosphatase, SH2 domain containing inositol 5-phosphatase (SHIP), which can mediate cellular inhibition (2).

The triggering receptors expressed on myeloid cells (TREM) family include TREM1, TREM2 and NKp44 and are activating receptors that interact with DNAX activating protein of 12 kDa (DAP12) (3). We have identified a new TREM family member termed, TREM-like transcript-1 (TLT1) (4). TLT1 is typical of the TREM family comprising a single Ig superfamily V-type domain but, unlike the others, is not predicted to interact with DAP12 (4). Instead, two isoforms of TLT1 are predicted from cDNAs that share identical extracellular and transmembrane domains but differ in their cyt.

A 199 aa splice variant of TLT1 (TLT1sp) is predicted, which encodes a short cyt of 14 aa containing a potential dileucine receptor sorting motif similar to that found in the invariant chain of MHC class II molecules (4). In contrast, the 126 aa cyt of TLT1 contains two consensus ITIMs. The C-terminal VXYXXV conforms to a "classical" ITIM (2), whereas the membrane-proximal "nonclassical" TXYXXL ITIM is similar to one that has been shown to recruit SHP-2 in the cyt of CD33 (5). Either of the ITIMs could be responsible for recruiting SHP-1, SHP-2, or SHIP. We set out to characterize the signaling capability and expression of TLT1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and treatments

Rat basophilic leukemia cells (RBL-2H3) were cultured in RPMI 1640 with 10% FCS, penicillin, and streptomycin. PBL were purified over Lymphoprep (Nycomed Pharma, Oslo, Norway). Platelets were isolated, as described (6). Platelets were activated with 20 µM thrombin receptor activating peptide (TRAP) (Sigma-Aldrich, Poole, U.K.) for 5 min at 37°C before fixing in 1% formaldehyde.

Cloning and expression of recombinant proteins

For addition of rFLAG-tag, TLT1 cDNA was amplified using the following primers: forward: ATAAAGCTTAGCCTCCCTGAGGTGCTG; reverse: CTCGAATTCGCTTAGCTGGATGGAGTCTG.

PCR products were cloned into the p3XFLAG-CMV-9 expression vector (Sigma-Aldrich) to give the wild-type (wt) TLT1 construct. cDNAs encoding the shared extracellular domain of TLT1/TLT1sp were cloned into the pMT/BiP/V5-His vector in the Drosophila expression system (Invitrogen, Paisley, U.K.) with a histidine (His) tag using the following primers: forward: AACTGCGGCCCAGCCGGCCATGGCCAGCCTCCCTGAGGTGCTG; reverse: ACTTGCGGCCGCCTTCTCATCCTGGCTGGG.

His-tagged TLT1 protein (TLT1-His) was purified, as described (7).

Peptides, immunizations, and Abs

Keyhole limpet hemocyanin-conjugated peptides designed to the cyt of TLT1sp and TLT1 used to immunize rabbits were: cytTLT1sp: CKRKQESLLSGPPRQ; cytTLT1: CGPAQNPPNNQTPSS.

The TLT1-His protein was used to raise rabbit antisera to the TLT1/TLT1sp extracellular domain. Anti-SHP-1 and anti-SHP-2 antisera were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-SHIP antisera and anti-Fc{epsilon}RI{alpha} mAb were purchased from Upstate (Cambridge, U.K.). Goat anti-rabbit Ig Alexa-568 was purchased from Molecular Probes (Leiden, The Netherlands). Anti-phosphotyrosine mAb 4G10 was obtained as a hybridoma tissue culture supernatant. Goat anti-mouse Ig FITC, swine anti-rabbit Ig FITC, goat anti-rabbit Ig HRP, un- and HRP-conjugated goat anti-mouse Ig, and unconjugated mouse IgG2a isotype control mAb were purchased from DAKO (Ely, U.K.). Un- and FITC-conjugated anti-FLAG (M2; IgG1) mAb were purchased from Sigma-Aldrich. Anti-rat {beta}2-microglobulin (anti-{beta}2M; IgG1) and anti-human CD62P (IgG2a) mAbs were purchased from BD Biosciences (Heidelberg, Germany).

Immunostaining, flow cytometry, and confocal microscopy

Intracellular immunostaining, flow cytometry, and confocal microscopy were performed, as described (8).

Site-directed mutagenesis of wtTLT1 ITIMs

Tyrosine to phenylalanine (Y>F) mutations of the ITIMs in the wtTLT1 construct to give the Y>F 245, Y>F 281, and Y>F 245, 281 mutant constructs were performed using the QuikChange site-directed mutagenesis kit, according to the manufacturer’s instructions (Stratagene) using the following oligonucleotides (Y>F mutations underlined): Y>F 245 forward: CATTTGACAATACCACCTTCACCAGCCTACCTCTTG; Y>F 245 reverse: CAAGAGGTAGGCTGGTGAAGGTGGTATTGTCAAATG; Y>F 281 forward: CTCCAAGCCTGTGACATTTGCCACAGTAATCTTCC; Y>F 281 reverse: GGAAGATTACTGTGGCAAATGTCACAGGCTTGGAG.

Clones were verified by sequencing.

Transfections

Two micrograms of each FLAG construct were transfected into RBL-2H3 using Lipofectamine 2000 (Invitrogen). Stable cell lines were selected in the presence of 1 mg/ml active G418.

Immunoprecipitation and immunoblotting

Immunoprecipitation, Western blotting, and determination of tyrosine phosphorylation of wtTLT1 and Y>F mutant proteins were done as described (9).

Cytosolic calcium measurement

Intracellular calcium mobilization was determined, as described (10).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TLT1 (35 kDa) and TLT1sp (20 kDa) colocalize with P-selectin (CD62P) in the {alpha}-granules of resting platelets

Using antisera raised against peptides designed to the unique cyt of TLT1 (anti-cytTLT1) and TLT1sp (anti-cytTLT1sp), protein species of molecular masses 20 and 35 kDa, respectively, were recognized in Western blots of PBL lysates under reducing SDS-PAGE conditions (Fig. 1A). Preimmune antisera did not recognize any protein species (Fig. 1A).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 1. TLT1sp (20 kDa) and TLT1 (35 kDa) are intracellular {alpha}-granule proteins in resting platelets. A, Peptides designed to the unique cyt of TLT1 and TLT1sp were used to immunize rabbits. The resulting postimmune (Post) antisera were used in Western blots to identify 20 kDa TLT1sp and 35 kDa TLT1 isoforms in PBL lysates under reducing SDS-PAGE conditions. Preimmune antisera (Pre) did not react with PBL lysates. B, Permeabilization of PBL identified a population of TLT1sp+ and TLT1+ low FSC cells (Post), the higher FSC cells shown for comparison, which do not react with the postimmune antisera, are lymphocytes, other PBL subpopulations were not found to express TLT1 or TLT1sp (data not shown); preimmune TLT1sp or TLT1 antisera (Pre) did not show staining of permeabilized PBLs. C, Confocal microscopy of permeabilized resting platelets showing intracellular distribution of (i) anti-cytTLT1sp antisera (TLT1sp; red fluorescence); (ii) anti-CD62P mAb (CD62P; green fluorescence); (iii) merged image showing colocalization of CD62P and TLT1sp staining (yellow) in {alpha}-granules; (iv) merge of anti-cytTLT1 antisera (TLT1; red fluorescence) and anti-CD62P mAb (green fluorescence) staining showing colocalization CD62P and TLT1 in {alpha}-granules (yellow). Bar = 20 µM.

 
The anti-cytTLT1sp and the anti-cytTLT1 antisera recognized low forward scatter (FSC) cells, presumably platelets, by flow cytometry (Fig. 1B). Confocal microscopy using anti-cytTLT1sp antisera showed abundant intracellular distribution of TLT1sp in resting platelets (Fig. 1Ci). Using a mAb to identify P-selectin (CD62P) expression in platelet {alpha}-granules (Fig. 1Cii), we found TLT1sp colocalized with CD62P in {alpha}-granules when the two images were merged (Fig. 1Ciii). Anti-TLT1 antisera and anti-CD62P mAb immunostaining revealed that TLT1 was also expressed in {alpha}-granules (Fig. 1Civ). Some TLT1 and TLT1sp staining did not colocalize with CD62P suggesting these isoforms may have their own discrete subcellular distribution within {alpha}-granules or localize to other as yet unidentified intracellular compartments.

TLT1 and TLT1sp are expressed at the cell surface of platelets following activation with TRAP

The anti-extTLT1 antisera, raised to the extracellular domain shared by both TLT1 and TLT1sp proteins (extTLT1) was used to stain platelets in flow cytometry. Neither TLT1 nor TLT1sp were detected at the cell surface of resting platelets (Fig. 2Ai). This was not due to a failure of the anti-extTLT1 antisera to recognize cell surface-expressed extTLT1 because the same antisera recognized cell surface FLAG-tagged TLT1 protein (wtTLT1) expressed in a stable RBL-2H3 cell-line (Fig. 2Aii), but not in parental RBL-2H3 cells (Fig. 2Aiii).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 2. TLT1 and TLT1sp were not detected on the surface of resting platelets but were positive for extTLT1 and CD62P after treatment with TRAP. A, Flow cytometry using anti-extTLT1 antisera raised to the extracellular domain shared by TLT1sp/TLT1 did not detect cell surface expression of either TLT1sp or TLT1 on (i) resting platelets (shaded histograms = preimmune sera, thick black lines = postimmune sera); anti-extTLT1 antisera recognized cell surface FLAG-tagged TLT1 protein stably expressed in (ii) stable FLAG-tagged TLT1-expressing RBL-2H3 cells (wtTLT1), but not (iii) parental RBL-2H3 cells. B, Flow cytometry using (i) anti-CD62 mAb (CD62P) and (ii) anti-extTLT1 antisera on unstimulated (gray-shaded histogram) and TRAP-activated platelets (open black line): TRAP-activated, but not resting, platelets were CD62P+ and extTLT1+.

 
The localization of TLT1 and TLT1sp to platelet {alpha}-granules and lack of detectable cell surface staining in resting platelets suggested that these proteins might be regulated by cell activation (11). We activated platelets using TRAP and found increased cell surface expression of CD62P on activated, but not resting, platelets by flow cytometry (Fig. 2Bi). Using anti-extTLT1 antisera, platelets from the same donor were positive for extTLT1 following TRAP activation (Fig. 2Bii). These results show that TLT1 and TLT1sp colocalized with CD62P in the {alpha}-granules of resting platelets but were found on the cell surface with CD62P following TRAP activation.

TLT1 recruits SHP-2 to the C-terminal (Y281) classical ITIM

To perform TLT1-specific mAb cross-linking experiments that would not be complicated by coexpression of TLT1sp and to determine which ITIM might be responsible for the recruitment of phosphatases, such as SHP-1, SHP-2, or SHIP, we generated stable RBL-2H3 cell lines expressing wtTLT1 and tyrosine to phenylalanine (Y>F) mutants of the TLT1 ITIMs. Expression levels for wtTLT1, Y>F245, Y>F281 and Y245, 281 proteins in each stable cell line are shown in Fig. 3A.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 3. TLT1 recruits SHP-2 to the phosphorylated C-terminal Y281 ITIM. A, Stable cell surface expression of FLAG-tagged wtTLT1, Y>F 245, Y>F 281 and Y>F 245, 281 TLT1 mutant proteins in RBL-2H3 cells (thick black line) compared with untransfected parental RBL-2H3 cells (gray shaded). B, Anti-phosphotyrosine blot using mAb 4G10 (4G10) of anti-FLAG IPs from untreated (0') and pervanadate treated (5') wtTLT1, Y>F 245, Y>F 281 and Y>F 245, 281 cells, respectively. Increased tyrosine phosphorylation of wtTLT1, Y>F 245 and Y>F 281 proteins was observed in pervanadate-treated lanes compared with untreated lanes. No tyrosine phosphorylation of Y>F 245, 281 was seen in either untreated or pervanadate-treated lanes. Arrowhead indicates the presence of tyrosine phosphorylated wtTLT1 and Y >245 and Y281 mutant TLT1 proteins. Ig H and L chains, are indicated. C, Anti-FLAG immunostaining (M2) of the same blot shows comparable levels of wtTLT1 and mutant FLAG-tagged proteins (arrowhead) in all IP lanes. D, SHP-2 is coimmunoprecipitated with wtTLT1 and Y>F 245, but not Y>F 281 or Y>F 245, 281 proteins. Increased SHP-2 association is seen in IPs from pervanadate-treated (5') wtTLT1 and Y>F 245 cells compared with untreated (0') cells. SHP-1 and SHIP were not detected in IPs, despite expression in whole cell lysates.

 
Anti-FLAG immunoprecipitations (IPs) from both untreated and pervanadate-treated cells expressing wtTLT1 and each ITIM mutant were used to assess ITIM phosphorylation and phosphatase recruitment. Upon pervanadate treatment, increased ITIM phosphorylation in IPs of wtTLT1, Y>F 245, and Y>F 281 was detected by Western blotting using mAb 4G10 compared with untreated cells (Fig. 3B). Tyrosine phosphorylation of the double Y>F 245, 281 ITIM mutant was not detected (Fig. 3B). All IP lanes contained comparable levels of FLAG-tagged proteins when reprobed with M2 mAb (Fig. 3C).

When the immunoblot was probed using anti SHP-2 antisera, increased SHP-2 association was detected in pervanadate-treated wtTLT1 cells compared with untreated cells (Fig. 3D). SHP-2 was recruited to cells expressing the Y>F 245 TLT1 mutation, but not the Y>F 281 or Y>F 245, 281 mutations, showing that the C-terminal classical Y281 ITIM is essential for SHP-2 recruitment (Fig. 3D). SHP-1 and SHIP could not be detected in any of the IPs analyzed despite abundant expression in cell lysates (Fig. 3D).

Fc{epsilon}RI-mediated calcium signaling is enhanced by TLT1 and is dependent on Y281 in RBL-2H3

We examined the regulation of Fc{epsilon}RI-mediated calcium signaling in RBL-2H3 cells stably expressing either wtTLT1, Y>F 245, or Y>F 281 cell surface proteins. Cross-linking anti-Fc{epsilon}RI{alpha} + anti-{beta}2M mAbs in either wtTLT1, Y>F 245, or Y>F 281-expressing cells resulted in identical calcium release traces, indicating that Fc{epsilon}RI-mediated calcium signaling was intact in the three cell lines (Fig. 4, A–C, black lines and Fig. 4D, black bars). However, striking differences were observed in the peak Fc{epsilon}RI-mediated calcium response when anti-Fc{epsilon}RI{alpha} and M2 mAbs were coaggregated (Fig. 4, A–C, red lines and Fig. 4D, red bars). Surprisingly, RBL-2H3 cells expressing either the wtTLT1 or Y>F 245 proteins had significantly enhanced, rather than inhibited, peak intracellular calcium levels in response to receptor cross-linking compared with anti-Fc{epsilon}RI{alpha} + anti-{beta}2M mAb-treated controls (Figs. 4, A and B, red and black lines, respectively). The mutation of Y281 in Y>F 281-expressing cells completely abolished this costimulatory effect, resulting in calcium responses equivalent to control cells (Fig. 4, C and D). Isolated cross-linking of either wtTLT1, Y>F 245, or Y>F 281 in cells preloaded with M2 mAb alone had no effect on intracellular calcium release (Fig. 4, A–C, blue lines), consistent with the previous work showing that ITIM-encoding receptors require coaggregation with activating receptors to affect signaling (2, 12, 13).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 4. TLT1 is a costimulatory ITIM receptor that enhances Fc{epsilon}RI-mediated calcium responses and Y281 is essential for this function. Stable RBL-2H3 cell-lines expressing either (A) wtTLT1 or (B) Y>F 245 or (C) Y>F 281 mutant proteins were incubated with either: anti-Fc{epsilon}RI{alpha} + anti-{beta}2M mAbs (black line); anti-Fc{epsilon}RI{alpha} + M2 mAbs (red line) or M2 mAb alone (blue). Each mutant (n = 3) was assessed for calcium release from intracellular stores after the addition of 20 µg of goat anti-mouse Ig cross-linker, indicated by arrows (A–C). D, Bar graphs to show peak intracellular calcium concentration [Ca2+]i as percentage (%) of wtTLT1 (anti-Fc{epsilon}RI{alpha} + anti-{beta}2M) cells (100%).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we show that SHP-2 is recruited to the classical Y281 ITIM in the TLT1 cyt and this might be expected to inhibit early signaling (2). To our surprise, the cross-linking of TLT1 with Fc{epsilon}RI resulted in an enhanced rather than diminished early calcium signal. TLT1-mediated up-regulation of Fc{epsilon}RI-mediated calcium signaling was dependent on Y281, as the Y>F mutation of this residue abolished this effect. In this respect, TLT1 does not behave like classical ITIM-containing receptors, which down-regulate calcium responses. Therefore, TLT1 represents a new subclass of costimulatory ITIM receptor and is likely to mediate these effects through the recruitment of SHP-2 because the Y>F 281 mutation abolished SHP-2 binding and the costimulatory effect on Fc{epsilon}RI-mediated calcium signaling.

TLT1 and TLT1sp colocalized with CD62P in {alpha}-granules of resting platelets and TRAP activation resulted in redistribution of the shared TLT1 and TLT1sp extracellular domains to the cell surface with CD62P, presumably for TLT1 and TLT1sp to interact with their respective ligand(s) and, based on our results in RBL-2H3, for TLT1 to interact with signaling molecules, e.g., ITAM receptors and SHP-2 to mediate its costimulatory activity. In platelets, TLT1 is therefore likely to mediate its costimulatory activity downstream of initial activation events, akin to a role attributed to platelet endothelial cell adhesion molecule (PECAM)-1, the first ITIM-bearing receptor to be identified in platelets (14).

TLT1 is the second ITIM-bearing receptor to be identified in platelets after PECAM-1. Like TLT1, PECAM-1 also occurs in the {alpha}-granules but, in contrast, is known to attenuate signaling via SHP-2 (14). TLT1 differs from PECAM-1 and other ITIM receptors in encoding a unique polyproline-rich region (PRR). Although we have not yet identified any SH3 domain binding partners for TLT1, the PRR is likely to be important in mediating its costimulatory properties because this motif is not found in other inhibitory ITIM receptors. Identifying the ligand(s) for TLT1 and TLT1sp will be an important next step in discovering their roles in platelet biology and thrombus formation and may assist in the development of novel clinical strategies.


    Acknowledgments
 
We thank Nick Watkins, Peter Smethurst, and Steve Garner for technical assistance and Doug Fearon for the critical evaluation of this manuscript.


    Footnotes
 
1 This work was supported by the Wellcome Trust. R.W.F. and I.A.M.R. are supported by the British Heart Foundation and Medical Research Council. E.A. is supported by the Association for International Cancer Research. Back

2 Address correspondence and reprint requests to Dr. Alexander D. Barrow, Cambridge Institute for Medical Research, Wellcome Trust/Medical Research Council Building, Addenbrookes Hospital, Hills Road, Cambridge, CB2 2XY, U.K. E-mail address: adb44{at}cam.ac.uk Back

3 Abbreviations used in this paper: ITAM, immunoreceptor tyrosine-based activation motif; cyt, cytoplasmic tail; PTK, protein tyrosine kinase; ITIM, immunoreceptor tyrosine-based inhibition motif; SH, Src homology; SHP, SH2 domain-containing tyrosine phosphatase; SHIP, SH2 domain containing inositol 5-phosphatase; TREM, triggering receptor expressed on myeloid cells; TLT1, TREM-like transcript-1; sp, splice variant; RBL-2H3, rat basophilic leukemia cell; TRAP, thrombin receptor activating peptide; wt, wild type; His, histidine; {beta}2M, {beta}2-microglobulin; Y>F, tyrosine to phenylalanine; FSC, forward scatter; extTLT1, extracellular TLT1/TLT1sp domain; PRR, proline-rich region; IP, immunoprecipitation; PECAM-1, platelet endothelial cell adhesion molecule-1; DAP12, DNAX activating protein of 12 kDa. Back

Received for publication February 12, 2004. Accepted for publication March 25, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tomasello, E., L. Olcese, F. Vely, C. Geourgeon, M. Blery, A. Moqrich, D. Gautheret, M. Djabali, M. G. Mattei, E. Vivier. 1998. Gene structure, expression pattern, and biological activity of mouse killer cell activating receptor-associated protein (KARAP)/DAP12. J. Biol. Chem. 273:115.
  2. Vivier, E., M. Daeron. 1997. Immunoreceptor tyrosine-based inhibition motifs. Immunol. Today 18:286.[Medline]
  3. Colonna, M.. 2003. TREMs in the immune system and beyond. Nat. Rev. Immunol. 3:445.[Medline]
  4. Allcock, R. J., A. D. Barrow, S. Forbes, S. Beck, J. Trowsdale. 2003. The human TREM gene cluster at 6p21.1 encodes both activating and inhibitory single IgV domain receptors and includes NKp44. Eur. J. Immunol. 33:567.[Medline]
  5. Paul, S. P., L. S. Taylor, E. K. Stansbury, D. W. McVicar. 2000. Myeloid specific human CD33 is an inhibitory receptor with differential ITIM function in recruiting the phosphatases SHP-1 and SHP-2. Blood 96:483.[Abstract/Free Full Text]
  6. Achison, M., C. M. Elton, P. G. Hargreaves, C. G. Knight, M. J. Barnes, R. W. Farndale. 2001. Integrin-independent tyrosine phosphorylation of p125fak in human platelets stimulated by collagen. J. Biol. Chem. 276:3167.[Abstract/Free Full Text]
  7. Smethurst, P. A., L. Joutsi-Korhonen, M. N. O’Connor, E. Wilson, N. S. Jennings, S. F. Garner, Y. Zhang, C. G. Knight, T. R. Dafforn, A. Buckle, et al 2004. Identification of the primary collagen binding surface on human glycoprotein VI by site-directed mutagenesis and by a blocking phage antibody. Blood 103:903.[Abstract/Free Full Text]
  8. Barrow, A. D., S. C. Burgess, S. J. Baigent, K. Howes, V. K. Nair. 2003. Infection of macrophages by a lymphotropic herpesvirus: a new tropism for Marek’s disease virus. J. Gen. Virol. 84:2635.[Abstract/Free Full Text]
  9. Chang, C., J. Dietrich, A. G. Harpur, J. A. Lindquist, A. Haude, Y. W. Loke, A. King, M. Colonna, J. Trowsdale, M. J. Wilson. 1999. Cutting edge: KAP10, a novel transmembrane adapter protein genetically linked to DAP12 but with unique signaling properties. J. Immunol. 163:4651.[Abstract/Free Full Text]
  10. Melendez, A., R. A. Floto, D. J. Gillooly, M. M. Harnett, J. M. Allen. 1998. Fc{gamma}RI coupling to phospholipase D initiates sphingosine kinase-mediated calcium mobilization and vesicular trafficking. J. Biol. Chem. 273:9393.[Abstract/Free Full Text]
  11. Harrison, P., E. M. Cramer. 1993. Platelet {alpha}-granules. Blood Rev. 7:52.[Medline]
  12. Blery, M., J. Delon, A. Trautmann, A. Cambiaggi, L. Olcese, R. Biassoni, L. Moretta, P. Chavrier, A. Moretta, M. Daeron, E. Vivier. 1997. Reconstituted killer cell inhibitory receptors for major histocompatibility complex class I molecules control mast cell activation induced via immunoreceptor tyrosine-based activation motifs. J. Biol. Chem. 272:89.[Abstract/Free Full Text]
  13. Colonna, M., F. Navarro, T. Bellon, M. Llano, P. Garcia, J. Samaridis, L. Angman, M. Cella, M. Lopez-Botet. 1997. A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809.[Abstract/Free Full Text]
  14. Jones, K. L., S. C. Hughan, S. M. Dopheide, R. W. Farndale, S. P. Jackson, D. E. Jackson. 2001. Platelet endothelial cell adhesion molecule-1 is a negative regulator of platelet-collagen interactions. Blood 98:1456.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. J.A. Korporaal, C. A. Koekman, S. Verhoef, D. E. van der Wal, M. Bezemer, M. Van Eck, and J.-W. N. Akkerman
Downregulation of Platelet Responsiveness Upon Contact With LDL by the Protein-Tyrosine Phosphatases SHP-1 and SHP-2
Arterioscler Thromb Vasc Biol, March 1, 2009; 29(3): 372 - 379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Mori, A. C. Pearce, J. C. Spalton, B. Grygielska, J. A. Eble, M. G. Tomlinson, Y. A. Senis, and S. P. Watson
G6b-B Inhibits Constitutive and Agonist-induced Signaling by Glycoprotein VI and CLEC-2
J. Biol. Chem., December 19, 2008; 283(51): 35419 - 35427.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Haselmayer, L. Grosse-Hovest, P. von Landenberg, H. Schild, and M. P. Radsak
TREM-1 ligand expression on platelets enhances neutrophil activation
Blood, August 1, 2007; 110(3): 1029 - 1035.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. A. Newland, I. C. Macaulay, A. R. Floto, E. C. de Vet, W. H. Ouwehand, N. A. Watkins, P. A. Lyons, and D. R. Campbell
The novel inhibitory receptor G6B is expressed on the surface of platelets and attenuates platelet function in vitro
Blood, June 1, 2007; 109(11): 4806 - 4809.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. S. Tessmer, C. Fugere, F. Stevenaert, O. V. Naidenko, H. J. Chong, G. Leclercq, and L. Brossay
KLRG1 binds cadherins and preferentially associates with SHIP-1
Int. Immunol., April 1, 2007; 19(4): 391 - 400.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
Y. A. Senis, M. G. Tomlinson, A. Garcia, S. Dumon, V. L. Heath, J. Herbert, S. P. Cobbold, J. C. Spalton, S. Ayman, R. Antrobus, et al.
A Comprehensive Proteomics and Genomics Analysis Reveals Novel Transmembrane Proteins in Human Platelets and Mouse Megakaryocytes Including G6b-B, a Novel Immunoreceptor Tyrosine-based Inhibitory Motif Protein
Mol. Cell. Proteomics, March 1, 2007; 6(3): 548 - 564.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. A. Lee, M. van Lier, I. A. M. Relou, L. Foley, J.-W. N. Akkerman, H. F. G. Heijnen, and R. W. Farndale
Lipid Rafts Facilitate the Interaction of PECAM-1 with the Glycoprotein VI-FcR {gamma}-Chain Complex in Human Platelets
J. Biol. Chem., December 22, 2006; 281(51): 39330 - 39338.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Imhof, A.-S. Wavreille, A. May, M. Zacharias, S. Tridandapani, and D. Pei
Sequence Specificity of SHP-1 and SHP-2 Src Homology 2 Domains: CRITICAL ROLES OF RESIDUES BEYOND THE pY+3 POSITION
J. Biol. Chem., July 21, 2006; 281(29): 20271 - 20282.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. G. King, B. R. Herrin, and L. B. Justement
Trem-Like Transcript 2 Is Expressed on Cells of the Myeloid/Granuloid and B Lymphoid Lineage and Is Up-Regulated in Response to Inflammation
J. Immunol., May 15, 2006; 176(10): 6012 - 6021.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barrow, A. D.
Right arrow Articles by Trowsdale, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barrow, A. D.
Right arrow Articles by Trowsdale, J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*Protein*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Hazardous Substances DB
*L-TYROSINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS