The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.
The Journal of Immunology, 2004, 172: 516-524.
Copyright © 2004 by The American Association of Immunologists

Murine {gamma}-Herpesvirus-68-Induced IL-12 Contributes to the Control of Latent Viral Burden, but Also Contributes to Viral-Mediated Leukocytosis 1

Sherine F. Elsawa and Kenneth L. Bost2

Department of Biology, University of North Carolina, Charlotte, NC 28223


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Early IFN-{alpha}/{beta} production, followed by the development of a viral-specific CTL response, are critical factors in limiting the level of murine {gamma}-herpesvirus-68 ({gamma}HV-68) infection. Development of a long-lived CTL response requires T cell help, and these CTLs most likely function to limit the extent of infection following reactivation. The importance of IL-12 in the development and/or activity of Th1 cells and CTLs is well documented, and we investigated the kinetics and magnitude of {gamma}HV-68-induced IL-12 production. Following intranasal infection, IL-12 and IL-23 mRNA expression was up-regulated in lung and spleen and lung, respectively, followed by increased levels of IL-12p40 in lung homogenates and sera. Exposure of cultured macrophages or dendritic cells to {gamma}HV-68 induced secretion of IL-12, suggesting that these cells might be responsible for IL-12 production in vivo. {gamma}HV-68 infection of mice made genetically deficient in IL-12p40 expression (IL-12p40-/-) resulted in a leukocytosis and splenomegaly that was significantly less than that observed in syngeneic C57BL/6 mice. IL-12p40-/- mice showed increased levels of infectious virus in the lung, but only at day 9 postinfection. Increased levels of latent virus in the spleen at day 15 postinfection were also observed in IL-12p40-/- mice when compared with syngeneic C57BL/6 mice. An overall reduction in {gamma}HV-68-induced IFN-{gamma} production was observed in IL-12p40-/- mice, suggesting that most of the viral-induced IFN-{gamma} in C57BL/6 mice was IL-12 dependent. Taken together, these results suggest that {gamma}HV-68-induced IL-12 contributes to the pathophysiology of viral infection while also functioning to limit viral burden.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Murine {gamma}-herpesvirus-68 ({gamma}HV-68) 3 is a {gamma}2-herpesvirus that infects rodents (1, 2), thus providing a valuable model system to investigate the pathogenesis of the human {gamma}-herpesviruses, EBV and human herpesvirus-8 (3, 4, 5, 6, 7, 8). Recent studies have provided much insight, and some significant surprises, regarding {gamma}HV-68 infection and the host response against this virus. Following intranasal inoculation, epithelial cells in the upper respiratory tract and lung are productively infected (9). This acute infection is self-resolving in immunocompetent rodents; however, the virus can establish latency in B lymphocytes (10, 11, 12), which is strikingly similar to the tropism of EBV for human B lymphocytes (13). Unexpectedly, it was found that during {gamma}HV-68 infection, latent virus could also be detected in macrophages (14, 15) and dendritic cells (15). In fact, it has even been suggested that epithelial cells may serve as a reservoir for persistent and, possibly, latent virus (16). While establishing latency, the virus induces leukocytosis and splenomegaly, which is similar to the mononucleosis induced following EBV infection. Other similarities to EBV infection have been noted, including the formation of B lymphoid hyperplasias in mice that have harbored {gamma}HV-68 for long periods of time (17). Thus, for {gamma}HV-68, the establishment of viral latency following acute infection is one mechanism used by this virus to persist within the host and to evade the immune response.

In the process of establishing latency, {gamma}HV-68 can subvert the host response, although it is not altogether clear which aspects of this response are protective, and which contribute to the pathophysiology induced following viral infection. Early IFN-{alpha}/{beta} production is critical for controlling acute viral infection (18), and it has been suggested that early chemokine production might also contribute to the protective host response. Such a suggestion is supported by the observation that the viral M3 gene encodes a soluble chemokine receptor (19, 20) that can compete for chemokine binding (19). However, disruption of the M3 gene also resulted in decreased leukocytosis, suggesting that this viral protein also contributes to viral pathophysiology (21). Furthermore, ORF-74 of {gamma}HV-68 also encodes for a CXCR2-like chemokine receptor that seems to enhance viral replication and re-emergence from latency (22, 23). Together, these studies suggest that {gamma}HV-68 targets early chemokine production in an effort to subvert the host response.

Viral-induced alterations in the development of the Ag-specific antiviral response have also been noted. The development of {gamma}HV-68-specific CTL requires CD4+ T cell help (12, 24, 25), and it is likely that these Ag-specific CTL function to limit the extent of infection (26) and to limit infection following reactivation (27, 28, 29). However, the virus can limit development of the CTL response via expression of the K3 gene product, which down-regulates MHC class I expression (30). Paradoxically, this reduction of Ag-specific lymphocyte responses occurs concomitantly during viral-induced expansion of CD4+ and CD8+ T lymphocytes, and B cells, producing the characteristic leukocytosis and splenomegaly (9, 25, 31).

Despite the significant progress made toward defining mechanisms of {gamma}HV-68-mediated pathogenesis, there remain significant questions regarding the nature of the protective host response. This is especially true for cytokine production during {gamma}HV-68 infection. Production of IL-6 during viral infection seems irrelevant (32). Decreased levels of latent virus in IL-10-deficient mice suggested that a Th1-type cytokine response might correlate with protection (33). However, it is not clear whether production of viral-induced IFN-{gamma} makes any contribution toward a protective host response. Mice deficient in IFN-{gamma} receptors had a significantly increased latent viral burden (34), whereas mice genetically deficient in IFN-{gamma} had no differences in viral burden (35), when compared with wild-type mice.

Endogenous production of IL-12 by macrophages and dendritic cells can contribute to the protective Th1 response against some viral infections (36, 37, 38, 39, 40, 41, 42). This cytokine can augment the development and activation of NK, CTL, and Th1 cells (43, 44); however, no studies have been performed to investigate IL-12 following {gamma}HV-68 infection. In this study, we demonstrate that {gamma}HV-68 can induce IL-12 secretion in macrophages and dendritic cells. Endogenous production of IL-12 affects viral pathogenesis, as evidenced by increased latent virus, decreased splenic leukocytosis, and decreased IFN-{gamma} production in mice genetically deficient in IL-12p40 expression, when compared with wild-type mice. Taken together, these studies suggest a role for IL-12 in the protective host response and in viral-induced splenomegaly.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Virus propagation and isolation

{gamma}HV-68 was a kind gift from A. Nash (University of Edinburgh, Edinburgh, U.K.) and P. Doherty (St. Jude’s Hospital, Memphis, TN). Virus stocks were prepared by infecting baby hamster kidney (BHK)-21 cells (American Type Culture Collection (ATCC), Manassas, VA; CCL-10) with {gamma}HV-68 at a low multiplicity of infection, followed by isolation of virus from cellular lysates, as previously described (33, 45). Replicating virus was quantified using serial dilutions on NIH 3T3 cell (ATCC CRL-1658) monolayers, as previously described (33, 45).

For use as negative controls for in vitro assays, lysates of uninfected BHK-21 cells were prepared in an identical manner, as previously described (33, 45).

Intranasal inoculation with {gamma}HV-68 or UV-inactivated virus

C57BL/6 and B6.129S1-Il12btm1Jm (IL-12p40-/-) mice (The Jackson Laboratory, Bar Harbor, ME) were housed under specific pathogen-free conditions. Mice were given food and water ad libitum, and were housed in isolation cages throughout the experimental period. Intranasal inoculations with {gamma}HV-68 were performed, as previously described (11, 12, 45). Briefly, mice were anesthetized and allowed to aspirate, via the nasal passages, 20 µl of inoculum containing 6 x 104 PFU of {gamma}HV-68.

Animals exposed to medium or to UV-inactivated {gamma}HV-68 were used as negative controls. For UV inactivation, viral stocks, containing equivalent numbers of PFU as that used for infection, were exposed to UV light (1165 J/m2). Viral plaque assays were performed following inactivation to assure that UV-treated virus stocks contained no detectable levels of infectious virus. For these controls, mice were anesthetized in an identical manner and allowed to aspirate 20 µl of UV-killed {gamma}HV-68.

Isolation of peritoneal macrophages and in vitro infection with {gamma}HV-68

Peritoneal macrophages were isolated, as previously described (46, 47). Briefly, C57BL/6 mice were injected i.p. with 500 µl of IFA (Sigma-Aldrich, St. Louis, MO). Three days later, the mice were euthanized, and the peritoneal cavities were lavaged with RPMI 1640 (Life Technologies-BRL, Gaithersburg, MD) containing 2% FCS. Peritoneal cells were washed twice and then allowed to adhere to tissue culture plates (Costar, Cambridge, MA) for 45 min in RPMI 1640 containing 10% FCS. Nonadherent cells were then washed off, and the adherent cells were exposed to medium, BHK lysate, or the indicated number of PFU of {gamma}HV-68. Following a 1-h exposure, culture wells were washed to remove any extracellular virus.

Isolation of bone marrow macrophages and in vitro infection with {gamma}HV-68

Femurs were flushed with RPMI 1640 containing 2% FCS to collect total bone marrow cells. Any spicules or bone matrix was allowed to settle and was removed. Total bone marrow cells were washed once, resuspended in LADMAC-conditioned medium, and plated in tissue culture plates. To produce LADMAC-conditioned medium, the LADMAC cell line (CRL-2420; ATCC, Rockville, MD) was grown to confluence in 75-cm2 flasks for 5 days, followed by harvesting and filtering these culture supernatants. DMEM-10 supplemented with 10% FCS and 20% LADMAC supernatants was used as conditioned medium to foster the growth and differentiation of bone marrow macrophages. Conditioned medium, prepared in a similar manner, has been used to support the growth of bone marrow-derived macrophages because the LADMAC cell line is a source of M-CSF (48, 49).

Bone marrow cells were fed with LADMAC-conditioned medium every 2 days. After 5 days in culture, nonadherent bone marrow cells were removed from culture wells by washing with RPMI. Adherent cells were greater than 98% CD11b+ as determined by FACS analyses using a PE-conjugated anti-CD11b+ Ab (BD Biosciences, Chicago, IL). These adherent bone marrow macrophages were then placed in RPMI 1640 containing 10% FCS, and exposed to medium, BHK lysate, or the indicated number of PFU of {gamma}HV-68. Following a 1-h exposure, culture wells were washed to remove any extracellular virus.

Isolation of bone marrow-derived myeloid dendritic cells and in vitro infection with {gamma}HV-68

Bone marrow-derived myeloid dendritic cells were isolated, as previously described (50). Briefly, femurs were flushed with RPMI 1640 containing 2% FCS to collect total bone marrow cells. Any spicules or bone matrix was allowed to settle and was removed. Total bone marrow cells were washed once, and resuspended in RPMI 1640 containing 12% FCS and 1000 U/ml GM-CSF (BD Biosciences). Cells were fed every 3 days by adding 50% fresh medium. After 7 days in culture, nonadherent cells were removed, washed, and resuspended in RPMI 1640 containing 12% FCS. Cultured dendritic cells were placed in culture wells in RPMI 1640 containing 10% FCS and exposed to medium, BHK lysate, or the indicated number of PFU of {gamma}HV-68.

Isolation of flt3-derived dendritic cells and in vitro infection with {gamma}HV-68

Primary murine dendritic cells were isolated, as previously described (51, 52). Briefly, dendritic cells present in peripheral lymphoid organs of C57BL/6 mice were expanded by daily injection with 10 µg of human flt3 ligand for nine consecutive days. Splenic and lymph node cells were then isolated, and single cell suspensions were made following collagenase treatment of 2-mm2 tissue fragments. Cells were washed, and CD11b+ cells were removed by MACS, as described (52). CD11c+ dendritic cells were then isolated from this depleted leukocyte population by MACS. Dendritic cells were then cultured in RPMI 1640 containing 12% FCS and 1000 U/ml of GM-CSF (BD Biosciences) for 2 days. Cultured dendritic cells were placed in culture wells in RPMI 1640 containing 10% FCS and exposed to medium, BHK lysate, or the indicated number of PFU of {gamma}HV-68.

Cultures of JAWS II dendritic cells and in vitro infection with {gamma}HV-68

JAWS II dendritic cells (CRL-11904; ATCC) were propagated in LADMAC-conditioned medium, as described above. Before their use, JAWS II cells were washed in RPMI 1640 and then placed in RPMI 1640 containing 10% FCS. Cells were exposed to medium, BHK lysate, or the indicated number of PFU of {gamma}HV-68.

Isolation of splenic leukocytes

Fifteen days postinfection, spleens were removed and weighed. Single cell suspensions were made by pressing tissue through a 30-gauge wire mesh, followed by hypotonic lysis of RBC. Leukocytes were washed, and the pellet was resuspended in RPMI 1640 with 10% FCS. Total leukocytes were counted using a Coulter Counter (Coulter, Miami, FL).

Infectious centers assay

The presence of latent virus was quantified using an infectious centers assay, as previously described (11, 12, 45). For quantification of latent virus, limiting dilutions of isolated splenic leukocytes were placed onto monolayers of NIH 3T3 cells. After 24 h, an agar overlay supplemented with medium and FCS was added and allowed to incubate for 5 days in 5% CO2. The monolayers were then fixed and stained with crystal violet. The number of infectious centers was counted in triplicate for several serial dilutions of cells for each experimental condition.

Quantification of lytic virus

The presence of lytic virus was quantified, as previously described (45), using a plaque-forming assay. Briefly, lung tissue was excised and weighed. Portions of the lung tissue were snap frozen, and then homogenized lung tissue was pulse sonicated (Vibra Cell, Newton, CT) to release intracellular virus. Limiting dilutions of the lysates were then placed on NIH 3T3 monolayers for 1 h, followed by washing and overlaying with 0.15% agar (Difco, Detroit, MI) in DMEM (Life Technologies-BRL) with 30% FCS. After 5 days, the overlays were removed and cell monolayers were stained with crystal violet. PFU were quantified in triplicate for several serial dilutions of each lysate.

PCR amplification of {gamma}HV-68 gp150 DNA

To demonstrate the presence of {gamma}HV-68 DNA in the spleens of infected mice, a sensitive and specific PCR amplifying the DNA encoding {gamma}HV-68 gp150 was used, as previously described (33, 45). Briefly, DNA was isolated from spleen tissue (Qiagen, Valencia, CA) and quantified using a spectrophotometer. The nested PCR procedure consisted of 20 cycles of amplification using the positive and negative strand primers CCATCTAGCGGTGCAACATTTTCATTAC and TTTACTGGGTCATCCTCTTGTTTGGG, respectively. Ten percent of this PCR amplification was then amplified for 20 cycles using the positive and negative strand primers CGAACAACAATCCCACTACAATTATGCG and GTATCTGATGTGTCAGCAGGAGCGTC, respectively. These sequences were derived from the published sequence of {gamma}HV-68 gp150 (53). Amplified {gamma}HV-68 gp150 DNA was then electrophoresed on ethidium bromide-stained agarose gels. The amplified product was compared with DNA standards (Invitrogen, Carlsbad, CA).

Semiquantitative RT-PCR to detect mRNA expression following {gamma}HV-68 infection

To detect the presence of mRNA encoding IL-12p40, IL-12p35, IL-23, IL-18, and G3PDH, semiquantitative RT-PCR analyses were performed, as previously described (54, 55, 56, 57), using TRIzol reagent (Life Technologies-BRL). A total of 1 µg of total RNA was reverse transcribed using SuperScript II reverse transcriptase (Life Technologies-BRL), and a portion of the total cDNA was amplified by PCR using 94°C denaturation, 59°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers used for the amplification of each mRNA species were as follows: IL-12p40, 27 cycles, GCACCAAATTACTCCGGACGGTTC and GCAAGTTCTTGGGCGGGTCTG; IL-23p19, 27 cycles, CTGCTTGCAAAGGATCCGCCAAGG and CTCAGTCAGAGTTGCTGCTCCGTG; IL-18, 27 cycles, AACTTTGGCCGACTTCACTGTACAA and CTATTGATGTAAGTTAGTGAGAGTG; IL-12p35, 27 cycles, AAGACATCACACGGGACCAAACCA and CGCAGAGTCTCGCCATTATGATTC; IFN-{gamma}, 27 cycles, CCACTCACATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCCAG; IL-12R B2 chain, 27 cycles, AATCTCCATGGCAAGAAAGTCC and GTTGATGGCAGTAACACGGACT; IL-23 receptor, 30 cycles, TGAAAGAGACCCTACATCCCTTGA, CAGAAAATTGGAAGTTGGGATATGTT; IFN-{gamma} receptor, 27 cycles, CAGACAGCCCTCCAACTCCGACAC, GGCCTCTCCTGTGAGTCTATACCC; and G3PDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT, respectively. Amplified products were electrophoresed on ethidium bromide-stained gels and visualized under UV illumination.

ELISA to quantify IL-12 and IFN-{gamma} from tissue homogenates and sera

Groups of C57BL/6 or IL-12p40-/- mice were infected with {gamma}HV-68, and, at varying times postinfection, lung and spleen tissue and sera were taken. Tissue was weighed and homogenized in T-PER Tissue Protein Extraction Reagent (Pierce, Rockford, IL) containing 1 mM PMSF and 1 mM iodoacetamide. Following homogenization of each tissue sample using a pestle, debris was removed by centrifugation (13,000 x g for 10 min at 4°C), and 100 µl of the homogenate was added to ELISA plates coated with the appropriate capture Ab. It should be noted that T-PER (Pierce) contains a proprietary detergent that does not interfere with Ab binding; therefore, it was not necessary to remove this detergent before performing ELISAs.

Capture ELISAs were also used to quantify the presence of IL-12p40, IL-12p70, or IFN-{gamma} in sera or culture supernatants using methodologies previously described (56, 58).

Statistical analyses

The results of the present studies were tested statistically by one-way ANOVA using Bonferroni post hoc test for comparison of means (GraphPad, San Diego, CA). Results were determined to be statistically significant when p < 0.01 was obtained.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{gamma}HV-68 induced IL-12 expression in C57BL/6 mice

The importance of IL-12 in the development and activation of cell-mediated immune responses is well documented. However, the production of this cytokine following infection with {gamma}HV-68 has not been investigated. We began these studies by intranasally inoculating groups of C57BL/6 mice with {gamma}HV-68, and at varying times thereafter, in vivo expression of IL-12 was investigated. IL-12p35 mRNA expression was observed in the spleens of mice exposed to UV-killed {gamma}HV-68 or infected with {gamma}HV-68 (Fig. 1A). In contrast, the mRNA encoding IL-12p40 was inducible and detected as early as 2 days postinfection in the spleens (Fig. 1A) and lungs (Fig. 1B) of infected mice. This increase could not be attributed to significant differences in input RNA or efficiencies of reverse transcription between samples, as indicated by the amplification of the housekeeping gene, G3PDH, from the same cDNA samples. In addition, no significant increases in IL-18 mRNA expression in lung or spleen were observed. IL-23p19 mRNA expression was not detectable in the spleens of {gamma}HV-68-infected mice (Fig. 1A), but was detected in lung tissue (Fig. 1B). Expression of the mRNA encoding the {beta}-chain of IL-12R and IL-23R was also detected in the spleens of {gamma}HV-68-infected mice (Fig. 1A).



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 1. {gamma}HV-68 induced IL-12 mRNA expression in the spleen and lungs of infected C57BL/6 mice. Mice were exposed to UV-killed {gamma}HV-68 (0), or infected with {gamma}HV-68. At the indicated days postinfection, RNA was isolated from the spleen (A) and lung (B). RT-PCR was performed to detect the indicated mRNA species, and results are presented as amplified products electrophoresed on ethidium bromide-stained agarose gels. RNA extracted from LPS- and IFN-{gamma}-activated macrophages, or from Ag-activated T lymphocytes, respectively, were used as positive controls (+) for the detection of each mRNA species by RT-PCR (A). These studies were performed three times with similar results.

 
Increased expression of IL-12p40 mRNA translated into increased IL-12p40 secretion in lung homogenates of {gamma}HV-68-infected C57BL/6 mice (Fig. 2A). Interestingly, early production of IL-12p40 at day 2 postinfection decreased steadily until mice experienced the peak of leukocytosis, which correlated with a peak in IL-12p40 presence in the lung at day 15 postinfection (Fig. 2A). Homogenates from the lungs of infected IL-12p40-/- mice were used as negative controls to demonstrate the specificity of the ELISA procedure using tissues homogenized in T-PER.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. {gamma}HV-68 induced IL-12p40 production in the lungs and sera of infected mice. Groups of C57BL/6 or IL-12-/- mice were uninfected (0) or infected with {gamma}HV-68. At the indicated days postinfection, mice were euthanized and lung tissue and sera were isolated. A capture ELISA was used to quantify levels of IL-12p40 present in lung homogenates (A) and sera (B). Results are presented as mean values of triplicate determinations (±SDs). These studies were performed three times with similar results.

 
IL-12p40 was also increased in the sera of {gamma}HV-68-infected C57BL/6 mice (Fig. 2B). Again, peak cytokine levels correlated with the peak of leukocytosis at day 15 postinfection. It should be noted that we were unable to detect the presence of IL-12p70 in lung tissue homogenates or in the sera of {gamma}HV-68-infected C57BL/6 mice.

{gamma}HV-68 induced IL-12 expression by cultured murine macrophages and dendritic cells

{gamma}HV-68 can infect macrophages and dendritic cells, and because these cells can also be a source of IL-12, we questioned whether viral infection might induce expression of this cytokine. Peritoneal and bone marrow-derived macrophages were able to up-regulate expression of IL-12p40 mRNA within 4 h following exposure to {gamma}HV-68 (Fig. 3A). This increased mRNA expression was due to viral infection because exposure of macrophages to medium or BHK lysate resulted in no detectable IL-12p40 mRNA expression. This increased mRNA expression translated into IL-12p40 (Fig. 3B) and IL-12p70 (Fig. 3C) secretion by 24 h postinfection. As has been noted with other microbial infections, {gamma}HV-68 induced much higher levels of IL-12p40 than of the heterodimer, IL-12p70 (Fig. 3). Taken together, these results demonstrate {gamma}HV-68-induced secretion of IL-12p40 and IL-12p70 protein by both peritoneal and bone marrow-derived macrophages.



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3. {gamma}HV-68 induced IL-12 expression by cultured murine macrophages. Peritoneal or bone marrow-derived macrophages were isolated and cultured in six-well plates with medium, or exposed to BHK lysate, or infected with 1 or 10 PFU of {gamma}HV-68 for 1 h. After washing, RNA was extracted from macrophages at the indicated times postinfection, or culture supernatants were taken 24 h later. RT-PCR was performed to detect IL-12p40 mRNA expression, and results are presented as amplified products electrophoresed on ethidium bromide-stained agarose gels (A). ELISAs were performed on culture supernatants to quantify IL-12p40 (B) or IL-12p70 (C) secretion. ELISA results are presented as mean values of triplicate determinations (±SDs). These studies were performed three times with similar results.

 
Addition of rIFN-{gamma} to {gamma}HV-68-infected bone marrow-derived macrophages increased secretion of IL-12p40 when compared with macrophages that were only infected (Fig. 4). This result demonstrated that IFN-{gamma} could further augment the capacity of these cells to secrete IL-12 following infection.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. {gamma}HV-68 and IFN-{gamma} induced IL-12p40 expression by bone marrow-derived macrophages. Bone marrow macrophages were isolated and cultured in 24-well plates with medium, or with 1 ng/ml IFN-{gamma} (IFN), and/or infected with 1 or 10 PFU of {gamma}HV-68. At 24 or 48 h postinfection, culture supernatants were removed, and secretion of IL-12p40 was quantified using an ELISA. ELISA results are presented as mean values of triplicate determinations (±SDs). These studies were performed twice with similar results.

 
In addition to macrophages, dendritic cells have been shown to contribute to IL-12 production (59, 60) and have been suggested to harbor latent {gamma}HV-68 in vivo (15). Therefore, we questioned whether different types of cultured dendritic cells could secrete IL-12 in response to {gamma}HV-68 infection. Bone marrow-derived dendritic cells, flt3 ligand-derived dendritic cells, and a dendritic cell line, JAWS II, demonstrated increased IL-12p40 secretion within 24 h following exposure to {gamma}HV-68 (Fig. 5A). This increased IL-12p40 secretion was due to viral infection, because exposure of these dendritic cells to medium or BHK lysate resulted in no detectable levels of IL-12p40. Bone marrow dendritic cells and JAWS II dendritic cells also demonstrated increased IL-12p70 secretion following infection with {gamma}HV-68 (Fig. 5B). Taken together, these results demonstrate {gamma}HV-68-induced secretion of IL-12p40 and IL-12p70 protein by cultured dendritic cells.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 5. {gamma}HV-68 induced IL-12 expression by cultured murine dendritic cells. JAWS II dendritic cells, or bone marrow- or flt3 ligand-derived dendritic cells were isolated and cultured in medium, exposed to BHK lysate, or infected with 1 or 10 PFU of {gamma}HV-68 for 1 h. After washing, cells were cultured for 24 h, and supernatants were taken for quantification of IL-12p40 (A) or IL-12p70 (B) secretion by ELISA. ELISA results are presented as mean values of triplicate determinations (±SDs). These studies were performed twice with similar results.

 
{gamma}HV-68-induced splenomegaly and leukocytosis in C57BL/6 and IL-12p40-/- mice

The ability of {gamma}HV-68 to induce in vivo (Figs. 1 and 2) and in vitro (Figs. 3–5) production of IL-12 suggested that this cytokine was one component of the host response to this viral infection. To address the contribution that production of endogenous IL-12 might make toward viral pathophysiology, groups of IL-12p40-/- or syngeneic C57BL/6 mice were intranasally infected with {gamma}HV-68. As expected, both strains of mice had significant splenomegaly (Fig. 6A) and splenic leukocytosis (Fig. 6B) 15 days postinfection when compared with mice exposed to UV-killed virus. Surprisingly, the magnitude of this viral-induced pathophysiology was significantly lower in IL-12p40-/- mice, when compared with syngeneic C57BL/6 mice (Fig. 6). These results demonstrated that secretion of IL-12 during {gamma}HV-68 infection contributes to, but is not solely responsible for, viral-induced splenomegaly and splenic leukocytosis.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 6. {gamma}HV-68-induced splenomegaly and leukocytosis in C57BL/6 and IL-12p40-/- mice. Groups of C57BL/6 and IL-12p40-/- mice were treated with UV-killed {gamma}HV-68 or infected with {gamma}HV-68 and at 15 days postinfection, spleens were removed. Splenic weights (A) and numbers of leukocytes present in the spleen (B) were determined. Results are presented as mean values (±SDs) of four separate animals per group. These studies were repeated three times with similar results. Asterisks indicate a statistically significant difference when compared with {gamma}HV-68-infected C57BL/6 mice.

 
Acute and latent viral burden in C57BL/6 and IL-12p40-/- mice

The importance of IL-12 in the protective host response against intracellular pathogens is well documented (43, 44). Therefore, we questioned whether the absence of endogenous production of this cytokine might alter levels of virus in mice. For these studies, groups of IL-12p40-/- or syngeneic C57BL/6 mice were intranasally infected with {gamma}HV-68, and at varying times postinfection the levels of acute or latent virus were quantified. No significant differences were observed in the PFU of virus present in the lungs of IL-12p40-/- mice when compared with C57BL/6 mice at 3, 5, or 7 days postinfection (Fig. 7). However, a significantly higher level of plaque-forming virus was detected at day 9 postinfection (Fig. 7), indicating that the lack of IL-12p40 expression could affect the host response, albeit late in the acute infection.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 7. Acute viral burden in the lungs of C57BL/6 and IL-12p40-/- mice. Groups of C57BL/6 and IL-12p40-/- mice were infected with {gamma}HV-68, and at the indicated days postinfection, lung tissue was removed to quantify viral burden using a plaque-forming cell assay. Results are presented as mean values (±SDs) of three separate animals calculated per group. These studies were repeated twice with similar results. The asterisk indicates a statistically significant difference when compared with {gamma}HV-68-infected C57BL/6 mice.

 
Latent viral burden in the spleens of infected mice were also investigated. PCR to detect the DNA encoding {gamma}HV-68 suggested that there were higher levels of viral DNA in the spleens of IL-12p40-/- mice (Fig. 8A). This suggestion was confirmed using a more quantitative infectious centers assay, in which greater than a log increase in latent virus per 107 splenocytes (Fig. 8B) or per spleen (Fig. 8C) was observed in IL-12p40-/- mice when compared with C57BL/6 mice. Taken together, these results demonstrate significant increases in latent viral burden in IL-12p40-/- mice when compared with C57BL/6 mice (Fig. 8).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 8. {gamma}HV-68 DNA and latent viral burden in C57BL/6 and IL-12p40-/- mice. Groups of C57BL/6 and IL-12p40-/- mice were exposed to UV-killed {gamma}HV-68 or infected with {gamma}HV-68, and at 15 days postinfection, splenic DNA or splenic leukocytes were isolated. The gene encoding viral gp150 was amplified by PCR to detect the presence of {gamma}HV-68 genomes, and results are presented as amplified products electrophoresed on ethidium bromide-stained agarose gels (A). Latent virus present in splenic leukocytes was quantified using infectious centers assays. Results are presented as mean values (±SDs) of four separate animals calculated per 107 leukocytes (B) or calculated per spleen (C). These studies were repeated three times with similar results. Samples with less than 1 infectious center (<1) were considered to be below the detection limit of this assay. Asterisks indicate a statistically significant difference when compared with {gamma}HV-68-infected C57BL/6 mice.

 
IL-12-dependent IFN-{gamma} production in mice infected with {gamma}HV-68

One possible explanation for an increased level of latent {gamma}HV-68 in IL-12p40-/- mice would be a decreased cell-mediated immune response against the virus (43, 44). IL-12-dependent IFN-{gamma} production is one cytokine pathway that can contribute to the host response against intracellular pathogens. Therefore, we questioned whether levels of IFN-{gamma} were decreased in IL-12p40-/- mice following {gamma}HV-68 infection. Groups of C57BL/6 or IL-12p40-/- mice were intranasally infected with {gamma}HV-68, and at varying days postinfection, mice were euthanized, and lung, spleen, and sera were collected to detect expression of IFN-{gamma}. IFN-{gamma} mRNA expression was detected as early as 2 days postinfection of C57BL/6 mice in the spleens (Fig. 9A) and lungs (Fig. 9B). IFN-{gamma} mRNA expression in these tissues of infected IL-12p40-/- mice was qualitatively less than that observed for C57BL/6 early in the response. Interestingly, while IFN-{gamma} mRNA was inducible, levels of the mRNA encoding the IFN-{gamma} receptor did not differ significantly following infection (Fig. 9).



View larger version (69K):
[in this window]
[in a new window]
 
FIGURE 9. IFN-{gamma} mRNA expression following infection with {gamma}HV-68. Groups of C57BL/6 or IL-12p40-/- mice were exposed to UV-killed {gamma}HV-68 (0), or infected with {gamma}HV-68. At the indicated days postinfection, RNA was isolated from the spleen (A), lung (B), or splenic CD8+ T lymphocytes, CD4+ T lymphocytes, or CD11b+ cells (C). RT-PCR was performed to detect IFN-{gamma} or IFN-{gamma} receptor (IFN-{gamma} R) mRNA expression. Results are presented as amplified products electrophoresed on ethidium bromide-stained agarose gels. These studies were repeated twice with similar results.

 
To determine which leukocyte populations might contribute to IFN-{gamma} mRNA expression following infection with {gamma}HV-68 in C57BL/6 mice, MACS was used to separate CD8+, CD4+, and CD11b+ leukocytes from the spleen. At 5, 7, and 9 days postinfection, IFN-{gamma} mRNA expression was observed in CD8+ and CD4+ T lymphocytes, but not in CD11b+ leukocytes (Fig. 9C).

Increased expression of IFN-{gamma} mRNA translated into increased IFN-{gamma} secretion in the spleens, lungs, and sera of {gamma}HV-68-infected C57BL/6 and IL-12p40-/- mice (Fig. 10). At 15 days postinfection, both strains of mice produced IFN-{gamma} in spleen and lung homogenates; however, there were significantly higher levels of this cytokine present in C57BL/6 mice (Fig. 10A). Similar results were observed in sera in which IL-12p40-/- mice had significantly less IFN-{gamma} present following infection than did wild-type mice (Fig. 10B). Taken together, these results demonstrate that at least a portion of the IFN-{gamma} produced following {gamma}HV-68 infection was dependent upon the expression of a functional IL-12p40 gene.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 10. Levels of IFN-{gamma} in the spleen, lung, and sera of {gamma}HV-68-infected C57BL/6 and IL-12p40-/- mice. Groups of C57BL/6 and IL-12p40-/- mice were exposed to UV-killed {gamma}HV-68 or infected with {gamma}HV-68, and at 15 days postinfection, sera were collected. ELISAs were performed to quantify IFN-{gamma} present in the spleen and lung (A) and in sera (B). Results are presented as mean values (±SDs) of four separate animals per group. These studies were repeated three times with similar results. Tissue homogenates or sera containing less than 30 pg/unit of IFN-{gamma} were considered to be below the detection limit of these assays. Asterisks indicate a statistically significant difference when compared with {gamma}HV-68-infected C57BL/6 mice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In vitro infection of macrophages and dendritic cells with {gamma}HV-68 resulted in significant IL-12 production (Figs. 3, 4, and 5). This finding was consistent with results obtained from mice following intranasal inoculation, in which induction of IL-12 mRNA in spleens and lungs (Fig. 1) and secreted protein in lungs and sera (Fig. 2) were observed as early as 2 days postinfection. Comparisons of IL-12p40-/- mice with syngeneic C57BL/6 following {gamma}HV-68 infection demonstrated increased lytic (Fig. 7) and latent virus (Fig. 8), decreased splenic leukocytosis (Fig. 6), and decreased IFN-{gamma} production (Figs. 9 and 10) in the genetically deficient mice. Taken together, these studies demonstrate that virally induced IL-12 functions to limit levels of lytic and latent viral burden, but that this cytokine also contributes to the mononucleosis-like expansion of peripheral leukocytes. Thus, endogenous IL-12 augments the host response while contributing to the pathophysiology observed during viral infection.

The studies presented in this work begin to define a role for IL-12 during the initial days following infection with this {gamma}-herpesvirus. Hypothetically, these studies suggest that macrophages or dendritic cells, which are infected with {gamma}HV-68, secrete IL-12 that acts on NK, CD8+, and/or CD4+ T lymphocytes to induce IFN-{gamma} secretion. An IFN-{gamma}-driven Th1 response is then initiated, which allows development and/or activation of Th1 cells and CTLs. Although this chain of events most likely occurs, this mechanistic description does not consider viral-induced alterations in the direction, or magnitude, of the host response. The initial immune response against {gamma}HV-68 is not sufficient to protect immunocompetent rodents from acute infection, or to clear the infection once latency has been established. Whether this result is due to one of the recently investigated {gamma}HV-68-mediated alterations in the immune response (19, 20, 21, 22, 23, 30), or due to undiscovered mechanisms, is not clear.

Following infection, there were lowered levels of IFN-{gamma} present in the tissues and sera of IL-12p40-/- mice (Figs. 9 and 10), indicating that at least a portion of the endogenous IFN-{gamma} production is dependent upon the presence of a functional IL-12p40 gene. Lowered IFN-{gamma} production in IL-12p40-/- mice correlated with increased levels of lytic (Fig. 7) and latent (Fig. 8) virus in the lung and spleen, respectively, and decreased splenic leukocytosis (Fig. 6). These results are consistent with one published study using mice deficient in IFN-{gamma} receptor expression (34). Infection of these receptor-deficient mice with {gamma}HV-68 resulted in significant increases in latent virus in the spleen, as well as a limited splenomegaly. This previous study (34), together with our results, suggest that IL-12-dependent IFN-{gamma} production helps to drive a suboptimal antiviral Th1 response, while also contributing to the non-Ag-induced expansion of leukocytes in peripheral lymphoid organs.

Interestingly, the presence of IL-12p40 or IFN-{gamma} had little effect on the level of infectious virus in the lungs following intranasal inoculation. There was a significant increase in lytic virus in the lung (Fig. 7), but only relatively late in the kinetics of the acute infection (i.e., day 9 postinfection). This result is strikingly similar to that observed for IFN-{gamma}-/- following infection with {gamma}HV-68 (35). Thus, even though endogenous IL-12 is made early in the immune response against this viral infection (Figs. 1 and 2), any protective effect against acute viral infection in the lung seems limited.

Depending upon the viral infection, endogenous IL-12 production may or may not contribute to a protective host response following infection. Murine models of CMV infection demonstrated an IL-12-dependent induction of IFN-{gamma} by NK cells as an important anti-herpesvirus defense mechanism (40, 41). Endogenous IL-12 production was found to be important for the host response against herpes simplex virus, but not in an IFN-{gamma}-dependent manner (39). IL-12p40-/- mice were used to demonstrate the importance of this cytokine in limiting togavirus (37) and poxvirus (38) burden following infection. Interestingly, IL-12p40-/- mice infected with the poxvirus, vaccinia, were more susceptible to infection than IFN-{gamma} -/- mice, suggesting an IL-12-dependent, IFN-{gamma}-independent mechanism (38). Taken together, these previous studies demonstrate an important contribution for endogenous IL-12 production in the protective host response against representative models of herpesvirus, togavirus, and poxvirus infections.

In contrast, the absence of IL-12 during certain viral infections has little effect on viral burden, and does not necessarily eliminate the development of a polarized Th1 response. IL-12p40-/- mice infected with mouse hepatitis virus had similar levels of viral-induced liver damage as did wild-type mice (36). Furthermore, these IL-12-deficient mice were still capable of producing IFN-{gamma} and generating a Th1 response against this viral infection. Similar results were observed when IL-12p40-/- mice were infected with lymphocytic choriomeningitis virus (61, 62). In these models of viral infection, it is not altogether clear which IL-12-independent mechanisms account for the antiviral responses.

When using IL-12p40-/- mice to investigate the contribution of this cytokine during viral infection, it cannot be assumed that similar results will be obtained with IL-12p40-/- and IL-12p35-/- mice. For example, mouse CMV infection was more severe in IL-12p35-/- mice than that observed in IL-12p40-/- mice (40). Several hypothetical mechanisms have been put forward to explain such results. Infection with {gamma}HV-68 induced much higher levels of IL-12p40 than IL-12p70 in macrophages (Fig. 3) and dendritic cells (Fig. 5). This is true for most microbial pathogens that induce excess amounts of IL-12p40 when compared with the amount of IL-12p70 that is secreted (58). This may be a significant finding because homodimers of IL-12p40 may be antagonists of IL-12p70 activity (63). For this reason, the presence of IL-12p40 protein in IL-12p35-/- mice, but not in IL-12p40-/- mice, was suggested as a possible mechanism to explain the differences observed following CMV infection of these two different strains of deficient mice (40).

As shown in Fig. 1A, the mRNA encoding the p19 subunit of IL-23 was not detected in the spleens of infected C57BL/6 mice; however, this message was up-regulated in lung tissue (Fig. 1B). This may be a significant observation because p19 can form heterodimers with IL-12p40 to form IL-23, a novel IL-12-like molecule (55). The IL-12p40-/- mice used in the studies in this work would be deficient in both IL-12p70 and IL-23, because both these cytokines contain IL-12p40 as one subunit. Thus, any contribution to the host response by either of these cytokines in IL-12p40-/- mice would be eliminated. It would be of interest to investigate the host response to {gamma}HV-68 in IL-12p35-/- mice to compare any differences or similarities with the results obtained using IL-12p40-/- mice.

{gamma}-Herpesviruses have been recognized as highly successful viral pathogens. A protective host response must clear acute infection, as well as target leukocytes, which become latently infected. Recent revelations concerning the diverse mechanisms used by {gamma}-herpesvirus to subvert the immune response (7, 64) demonstrate why the host fails to eliminate the virus following infection. These studies suggest that therapeutic intervention will be required to augment the ineffective antiviral response of the host, if the goal of clearing the virus is to be achieved. In the present work, we demonstrate that endogenous IL-12 contributes to limiting the level of latent virus in peripheral lymphoid organs. It will be important to understand whether IL-12-mediated pathways are being subverted following {gamma}-herpesvirus infection. If this does occur, then the mechanisms used by the virus to limit the initiation of Th1 responses would be of considerable importance in understanding the pathogenesis of {gamma}HV-68.


    Footnotes
 
1 This work was supported by grants from the National Institutes of Health (NS40307 and AI32976). Back

2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina, 9201 University City Boulevard, Charlotte, NC 28223. E-mail address: klbost{at}email.uncc.edu Back

3 Abbreviations used in this paper: {gamma}HV-68, murine {gamma}-herpesvirus-68; BHK, baby hamster kidney. Back

Received for publication February 3, 2003. Accepted for publication October 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rajcani, J., D. Blaskovic, J. Svobodova, F. Ciampor, D. Huckova, D. Stanekova. 1985. Pathogenesis of acute and persistent murine herpesvirus infection in mice. Acta Virol. 29:51.[Medline]
  2. Blaskovic, D., M. Stancekova, J. Svobodova, J. Mistrikova. 1980. Isolation of five strains of herpesviruses from two species of free living small rodents. Acta Virol. 24:468.[Medline]
  3. Blackman, M. A., E. Flano, E. Usherwood, D. L. Woodland. 2000. Murine {gamma}-herpesvirus-68: a mouse model for infectious mononucleosis?. Mol. Med. Today 6:488.[Medline]
  4. Flano, E., D. L. Woodland, M. A. Blackman. 2002. A mouse model for infectious mononucleosis. Immunol. Res. 25:201.[Medline]
  5. Nash, A. A., N. P. Sunil-Chandra. 1994. Interactions of the murine {gamma} herpesvirus with the immune system. Curr. Opin. Immunol. 6:560.[Medline]
  6. Simas, J. P., S. Efstathiou. 1998. Murine {gamma} herpesvirus 68: a model for the study of {gamma} herpesvirus pathogenesis. Trends Microbiol. 6:276.[Medline]
  7. Virgin, H. W., S. H. Speck. 1999. Unraveling immunity to {gamma}-herpesviruses: a new model for understanding the role of immunity in chronic virus infection. Curr. Opin. Immunol. 11:371.[Medline]
  8. Speck, S. H., H. W. Virgin. 1999. Host and viral genetics of chronic infection: a mouse model of {gamma}-herpesvirus pathogenesis. Curr. Opin. Microbiol. 2:403.[Medline]
  9. Sunil-Chandra, N. P., S. Efstathiou, J. Arno, A. A. Nash. 1992. Virological and pathological features of mice infected with murine {gamma}-herpesvirus 68. J. Gen. Virol. 73:2347.[Abstract/Free Full Text]
  10. Usherwood, E. J., J. P. Stewart, K. Robertson, D. J. Allen, A. A. Nash. 1996. Absence of splenic latency in murine {gamma} herpesvirus 68-infected B cell-deficient mice. J. Gen. Virol. 77:2819.[Abstract/Free Full Text]
  11. Sunil-Chandra, N. P., S. Efstathiou, A. A. Nash. 1992. Murine {gamma} herpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen. Virol. 73:3275.[Abstract/Free Full Text]
  12. Cardin, R. D., J. W. Brooks, S. R. Sarawar, P. C. Doherty. 1996. Progressive loss of CD8+ T cell-mediated control of a {gamma}-herpesvirus in the absence of CD4+ T cells. J. Exp. Med. 184:863.[Abstract/Free Full Text]
  13. Faulkner, G. C., A. S. Krajewski, D. H. Crawford. 2000. The ins and outs of EBV infection. Trends Microbiol. 8:185.[Medline]
  14. Weck, K. E., S. S. Kim, H. I. Virgin, S. H. Speck. 1999. Macrophages are the major reservoir of latent murine {gamma} herpesvirus 68 in peritoneal cells. J. Virol. 73:3273.[Abstract/Free Full Text]
  15. Flano, E., S. M. Husain, J. T. Sample, D. L. Woodland, M. A. Blackman. 2000. Latent murine {gamma}-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages. J. Immunol. 165:1074.[Abstract/Free Full Text]
  16. Stewart, J. P., E. J. Usherwood, A. Ross, H. Dyson, T. Nash. 1998. Lung epithelial cells are a major site of murine {gamma} herpesvirus persistence. J. Exp. Med. 187:1941.[Abstract/Free Full Text]
  17. Sunil-Chandra, N. P., J. Arno, J. Fazakerley, A. A. Nash. 1994. Lymphoproliferative disease in mice infected with murine {gamma} herpesvirus 68. Am. J. Pathol. 145:818.[Abstract]
  18. Dutia, B. M., D. J. Allen, H. Dyson, A. A. Nash. 1999. Type I interferons and IRF-1 play a critical role in the control of a {gamma} herpesvirus infection. Virology 261:173.[Medline]
  19. Van Berkel, V., J. Barrett, H. L. Tiffany, D. H. Fremont, P. M. Murphy, G. McFadden, S. H. Speck, H. I. Virgin. 2000. Identification of a {gamma} herpesvirus selective chemokine binding protein that inhibits chemokine action. J. Virol. 74:6741.[Abstract/Free Full Text]
  20. Van Berkel, V., K. Preiter, H. W. t. Virgin, S. H. Speck. 1999. Identification and initial characterization of the murine {gamma} herpesvirus 68 gene M3, encoding an abundantly secreted protein. J. Virol. 73:4524.[Abstract/Free Full Text]
  21. Bridgeman, A., P. G. Stevenson, J. P. Simas, S. Efstathiou. 2001. A secreted chemokine binding protein encoded by murine {gamma} herpesvirus-68 is necessary for the establishment of a normal latent load. J. Exp. Med. 194:301.[Abstract/Free Full Text]
  22. Wakeling, M. N., D. J. Roy, A. A. Nash, J. P. Stewart. 2001. Characterization of the murine {gamma} herpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor. J. Gen. Virol. 82:1187.[Abstract/Free Full Text]
  23. Lee, B. J., U. H. Koszinowski, S. R. Sarawar, H. Adler. 2003. A {gamma} herpesvirus G protein-coupled receptor homologue is required for increased viral replication in response to chemokines and efficient reactivation from latency. J. Immunol. 170:243.[Abstract/Free Full Text]
  24. Stevenson, P. G., G. T. Belz, J. D. Altman, P. C. Doherty. 1998. Virus-specific CD8+ T cell numbers are maintained during {gamma}-herpesvirus reactivation in CD4-deficient mice. Proc. Natl. Acad. Sci. USA 95:15565.[Abstract/Free Full Text]
  25. Usherwood, E. J., A. J. Ross, D. J. Allen, A. A. Nash. 1996. Murine {gamma} herpesvirus-induced splenomegaly: a critical role for CD4 T cells. J. Gen. Virol. 77:627.[Abstract/Free Full Text]
  26. Khanna, R., S. R. Burrows. 2000. Role of cytotoxic T lymphocytes in Epstein-Barr virus-associated diseases. Annu. Rev. Microbiol. 54:19.[Medline]
  27. Stevenson, P. G., P. C. Doherty. 1998. Kinetic analysis of the specific host response to a murine {gamma} herpesvirus. J. Virol. 72:943.[Abstract/Free Full Text]
  28. Usherwood, E. J., D. J. Roy, K. Ward, S. L. Surman, B. M. Dutia, M. A. Blackman, J. P. Stewart, D. L. Woodland. 2000. Control of {gamma} herpesvirus latency by latent antigen-specific CD8+ T cells. J. Exp. Med. 192:943.[Abstract/Free Full Text]
  29. Belz, G. T., P. C. Doherty. 2001. Virus-specific and bystander CD8+ T-cell proliferation in the acute and persistent phases of a {gamma} herpesvirus infection. J. Virol. 75:4435.[Abstract/Free Full Text]
  30. Stevenson, P. G., S. Efstathiou, P. C. Doherty, P. J. Lehner. 2000. Inhibition of MHC class I-restricted antigen presentation by {gamma}2-herpesviruses. Proc. Natl. Acad. Sci. USA 97:8455.[Abstract/Free Full Text]
  31. Tripp, R. A., A. M. Hamilton-Easton, R. D. Cardin, P. Nguyen, F. G. Behm, D. L. Woodland, P. C. Doherty, M. A. Blackman. 1997. Pathogenesis of an infectious mononucleosis-like disease induced by a murine {gamma}-herpesvirus: role for a viral superantigen?. J. Exp. Med. 185:1641.[Abstract/Free Full Text]
  32. Sarawar, S. R., J. W. Brooks, R. D. Cardin, M. Mehrpooya, P. C. Doherty. 1998. Pathogenesis of murine {gamma} herpesvirus-68 infection in interleukin-6-deficient mice. Virology 249:359.[Medline]
  33. Peacock, J. W., K. L. Bost. 2001. Murine {gamma} herpesvirus-68-induced interleukin-10 increases viral burden, but limits virus-induced splenomegaly and leukocytosis. Immunology 104:109.[Medline]
  34. Dutia, B. M., C. J. Clarke, D. J. Allen, A. A. Nash. 1997. Pathological changes in the spleens of {gamma} interferon receptor-deficient mice infected with murine {gamma} herpesvirus: a role for CD8 T cells. J. Virol. 71:4278.[Abstract]
  35. Sarawar, S. R., R. D. Cardin, J. W. Brooks, M. Mehrpooya, A. M. Hamilton-Easton, X. Y. Mo, P. C. Doherty. 1997. {gamma} Interferon is not essential for recovery from acute infection with murine {gamma} herpesvirus 68. J. Virol. 71:3916.[Abstract]
  36. Schijns, V. E., B. L. Haagmans, C. M. Wierda, B. Kruithof, I. A. Heijnen, G. Alber, M. C. Horzinek. 1998. Mice lacking IL-12 develop polarized Th1 cells during viral infection. J. Immunol. 160:3958.[Abstract/Free Full Text]
  37. Keogh, B., G. J. Atkins, K. H. Mills, B. J. Sheahan. 2002. Avirulent Semliki Forest virus replication and pathology in the central nervous system is enhanced in IL-12-defective and reduced in IL-4-defective mice: a role for Th1 cells in the protective immunity. J. Neuroimmunol. 125:15.[Medline]
  38. Van Den Broek, M., M. F. Bachmann, G. Kohler, M. Barner, R. Escher, R. Zinkernagel, M. Kopf. 2000. IL-4 and IL-10 antagonize IL-12-mediated protection against acute vaccinia virus infection with a limited role of IFN-{gamma} and nitric oxide synthetase 2. J. Immunol. 164:371.[Abstract/Free Full Text]
  39. Harandi, A. M., B. Svennerholm, J. Holmgren, K. Eriksson. 2001. Interleukin-12 (IL-12) and IL-18 are important in innate defense against genital herpes simplex virus type 2 infection in mice but are not required for the development of acquired {gamma} interferon-mediated protective immunity. J. Virol. 75:6705.[Abstract/Free Full Text]
  40. Carr, J. A., J. A. Rogerson, M. J. Mulqueen, N. A. Roberts, A. A. Nash. 1999. The role of endogenous interleukin-12 in resistance to murine cytomegalovirus (MCMV) infection and a novel action for endogenous IL-12 p40. J. Interferon Cytokine Res. 19:1145.[Medline]
  41. Orange, J. S., C. A. Biron. 1996. An absolute and restricted requirement for IL-12 in natural killer cell IFN-{gamma} production and antiviral defense: studies of natural killer and T cell responses in contrasting viral infections. J. Immunol. 156:1138.[Abstract]
  42. Pien, G. C., A. R. Satoskar, K. Takeda, S. Akira, C. A. Biron. 2000. Cutting edge: selective IL-18 requirements for induction of compartmental IFN-{gamma} responses during viral infection. J. Immunol. 165:4787.[Abstract/Free Full Text]
  43. Trinchieri, G.. 1998. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv. Immunol. 70:83.[Medline]
  44. Sinigaglia, F., D. D’Ambrosio, P. Panina-Bordignon, L. Rogge. 1999. Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function. Immunol. Rev. 170:65.[Medline]
  45. Peacock, J. W., K. L. Bost. 2000. Infection of intestinal epithelial cells and development of systemic disease following gastric instillation of murine {gamma} herpesvirus-68. J. Gen. Virol. 81:421.[Abstract/Free Full Text]
  46. Bost, K. L., M. J. Mason. 1995. Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages. J. Immunol. 155:285.[Abstract]
  47. Elhofy, A., K. L. Bost. 1999. Limited interleukin-18 response in Salmonella-infected murine macrophages and in Salmonella-infected mice. Infect. Immun. 67:5021.[Abstract/Free Full Text]
  48. Olivas, E., B. B. Chen, W. S. Walker. 1995. Use of the Pannell-Milstein roller bottle apparatus to produce high concentrations of the CSF-1, the mouse macrophage growth factor. J. Immunol. Methods 182:73.[Medline]
  49. Sklar, M. D., A. Tereba, B. D. Chen, W. S. Walker. 1985. Transformation of mouse bone marrow cells by transfection with a human oncogene related to c-myc is associated with the endogenous production of macrophage colony stimulating factor 1. J. Cell. Physiol. 125:403.[Medline]
  50. Son, Y. I., S. Egawa, T. Tatsumi, R. E. Redlinger, Jr, P. Kalinski, T. Kanto. 2002. A novel bulk-culture method for generating mature dendritic cells from mouse bone marrow cells. J. Immunol. Methods 262:145.[Medline]
  51. Marriott, I., E. W. Inscho, K. L. Bost. 1999. Extracellular uridine nucleotides initiate cytokine production by murine dendritic cells. Cell. Immunol. 195:147.[Medline]
  52. Marriott, I., T. G. Hammond, E. K. Thomas, K. L. Bost. 1999. Salmonella efficiently enter and survive within cultured CD11c+ dendritic cells initiating cytokine expression. Eur. J. Immunol. 29:1107.[Medline]
  53. Stewart, J. P., N. J. Janjua, S. D. Pepper, G. Bennion, M. Mackett, T. Allen, A. A. Nash, J. R. Arrand. 1996. Identification and characterization of murine {gamma} herpesvirus 68 gp150: a virion membrane glycoprotein. J. Virol. 70:3528.[Abstract]
  54. Okamura, H., H. Tsutsi, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  55. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13:715.[Medline]
  56. Kincy-Cain, T., K. L. Bost. 1997. Substance P-induced IL-12 production by murine macrophages. J. Immunol. 158:2334.[Abstract]
  57. Bost, K. L., J. D. Clements. 1995. In vivo induction of interleukin-12 mRNA expression after oral immunization with Salmonella dublin or the B subunit of Escherichia coli heat-labile enterotoxin. Infect. Immun. 63:1076.[Abstract]
  58. Bost, K. L., J. D. Clements. 1997. Intracellular Salmonella dublin induces substantial secretion of the 40-kilodalton subunit of interleukin-12 (IL-12) but minimal secretion of IL-12 as a 70-kilodalton protein in murine macrophages. Infect. Immun. 65:3186.[Abstract]
  59. Koch, F., U. Stanzl, P. Jennewein, K. Janke, C. Heufler, E. Kampgen, N. Romani, G. Schuler. 1996. High level IL-12 production by murine dendritic cells: up-regulation via MHC class II and CD40 molecules and down-regulation by IL-4 and IL-10. J. Exp. Med. 184:741.[Abstract/Free Full Text]
  60. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. S. Hsieh, J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154:5071.[Abstract]
  61. Oxenius, A., U. Karrer, R. M. Zinkernagel, H. Hengartner. 1999. IL-12 is not required for induction of type 1 cytokine responses in viral infections. J. Immunol. 162:965.[Abstract/Free Full Text]
  62. Pien, G. C., K. B. Nguyen, L. Malmgaard, A. R. Satoskar, C. A. Biron. 2002. A unique mechanism for innate cytokine promotion of T cell responses to viral infections. J. Immunol. 169:5827.[Abstract/Free Full Text]
  63. Gately, M. K., D. M. Carvajal, S. E. Connaughton, S. Gillessen, R. R. Warrier, K. D. Kolinsky, V. L. Wilkinson, C. M. Dwyer, G. F. Higgins, Jr, F. J. Podlaski, et al 1996. Interleukin-12 antagonist activity of mouse interleukin-12 p40 homodimer in vitro and in vivo. Ann. NY Acad. Sci. 795:1.[Medline]
  64. Stevenson, P. G., J. M. Boname, B. de Lima, S. Efstathiou. 2002. A battle for survival: immune control and immune evasion in murine {gamma}-herpesvirus-68 infection. Microbes Infect. 4:1177.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Guggemoos, D. Hangel, S. Hamm, A. Heit, S. Bauer, and H. Adler
TLR9 Contributes to Antiviral Immunity during Gammaherpesvirus Infection
J. Immunol., January 1, 2008; 180(1): 438 - 443.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. C. Reading, P. G. Whitney, D. P. Barr, M. Wojtasiak, J. D. Mintern, J. Waithman, and A. G. Brooks
IL-18, but not IL-12, Regulates NK Cell Activity following Intranasal Herpes Simplex Virus Type 1 Infection
J. Immunol., September 1, 2007; 179(5): 3214 - 3221.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Gasper-Smith, I. Marriott, and K. L. Bost
Murine {gamma}-Herpesvirus 68 Limits Naturally Occurring CD4+CD25+ T Regulatory Cell Activity following Infection
J. Immunol., October 1, 2006; 177(7): 4670 - 4678.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsawa, S. F.
Right arrow Articles by Bost, K. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS