| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Cellular Genetics Unit, Institute of Cellular Pathology, Université de Louvain, Brussels, Belgium;
Ludwig Institute for Cancer Research, Brussels Branch, Brussels, Belgium;
Ludwig Institute for Cancer Research, Lausanne Branch, Lausanne, Switzerland;
Unit of Skin Oncology, Hôtel Dieu, Centre Hospitalier Universitaire, Nantes, France; and
¶ Université Libre de Bruxelles, Hôpital Erasme, Brussels, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ags encoded by gene MAGE-3 have been used for small-scale therapeutic vaccination trials of melanoma patients with detectable disease. The vaccines consisted of either an antigenic peptide, a protein, or dendritic cells pulsed with an antigenic peptide (8, 9, 10, 11). In the peptide and protein trials, tumor regressions were observed in 
20% of the patients (Refs. 9 and 10 and our unpublished data), a proportion which appears to be well above the rates of spontaneous regressions that have been reported (12). In the absence of a randomized study including a placebo control arm, which could demonstrate vaccine effectiveness, our working hypothesis is that the regressions are caused by the vaccine.
The failure of 80% of the vaccinated patients to show tumor regression could be due to two major causes which are not mutually exclusive: a failure of the vaccine to induce an adequate T cell response or a resistance of the tumor to immune attack. If a limiting factor for success is the level of the T cell response to the vaccine, one ought to find a correlation between the occurrences of T cell responses and those of tumoral regression.
We focused our efforts on the detection of CTL recognizing the antigenic peptide MAGE-3168–176.A1, which is encoded by gene MAGE-A3 and presented by HLA-A1. To detect the anti-MAGE-3.A1 CTL, our approach is based on an in vitro restimulation of PBMC with the antigenic peptide over 2 wk, followed by labeling with A1/MAGE-3 tetramers. To evaluate precursor frequencies, these mixed lymphocyte-peptide cultures (MLPC) 3 are conducted under limiting dilution conditions. Cells that are labeled with the tetramer are cloned and their diversity is analyzed by TCR sequencing (13).
To strengthen the basis of our evaluation of low-level CTL responses, we have recently considered the size of diversity of the anti-MAGE-3.A1 TCR repertoire (Refs. 13 and 14 and C. Lonchay, S. Lucas, T. Boon, and P. Van Der Bruggen, manuscript in preparation). Our latest estimate of the frequency of naive anti-MAGE-3.A1 T cells found in the blood of individuals without cancer is 4 x 10-7 of the CD8 cells. In a noncancerous individual, we obtained a series of 14 independent anti-MAGE-3.A1 CTL clones, all expressing different TCR. On this basis, we conclude that it is very likely that the TCR diversity of the naive anti-MAGE-3.A1 repertoire is larger than 40, implying a frequency below 10-8 for each naive clonotype. Assuming this, there is a lower than 5% probability of finding in a naive repertoire the same CTL clone three times in a set of <10 clones or four times in a set of <20 clones. On the basis of these considerations, we conclude that a patient has made an anti-MAGE-3.A1 CTL response if either the CTL precursor (CTLp) frequency is 4 x 10-6 of CD8 or if "repeated" CTL clones are found in at least the proportions just mentioned.
We have applied the MLPC/tetramer/cloning method to a metastatic melanoma patient who responded clinically to vaccination with peptide MAGE-3.A1 administered without adjuvant (15). We found that the vaccination induced at least a 100-fold amplification of a single anti-MAGE-3.A1 CTL clone, with a postvaccination frequency of 5 x 10-5 of the CD8 cells. This blood frequency was confirmed by a direct evaluation using clonotypic PCR. In another patient who showed tumor regression after vaccination with peptide MAGE-3.A1, we observed a CTL response that was also monoclonal (13).
We describe here the CTL responses of a number of metastatic melanoma patients following vaccination with a recombinant canarypox virus of the ALVAC type containing a minigene encoding the MAGE-1.A1 and MAGE-3.A1 peptides (Refs. 16 and 17 and N. van Baren, M. Marchand, B. Dreno, T. Dorval, S. Piperno, D. Lienard, B. Escudier, T. Boon, P. Coulie, M.-C. Bonnet, and P. Moingeon, manuscript in preparation). This vector will be referred to as ALVAC-MAGE. Vaccination included four injections of ALVAC-MAGE followed by three injections of peptides MAGE-1.A1 and MAGE-3.A1 without adjuvant. All vaccines were administered every 3 wk by intradermal and s.c. routes. Twenty-three HLA-A1 patients received the four ALVAC-MAGE injections, and five of them showed tumor regression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
An HLA-A*0101 cDNA clone served as template to amplify the sequence coding for the extracellular domains (residues 1–276) of the HLA-A1 H chain with primers A1M8 (5'-AAGAAGGAGATATACCATGGGtTCacacagtATGcgctAtTTttttacatccgtgtcccgg) and A27b (5'-ATGATGCAGGGATCCTTATTATTCGAAGATGTCGTTCAGACCACCACCCAGCTCCCATCTCAGGGTG). A1M8 contains several base changes (small letters) designed to optimize protein expression in Escherichia coli BL21(DE3)pLysS. The PCR product was digested with NcoI and SfuI and cloned into a vector derived from pET3D (Stratagene, Heidelberg, Germany) and containing a BirA biotinylation site in frame with the 3' end of the HLA sequence. Recombinant HLA molecules were folded in vitro with 
2-microglobulin (pHN1-2m, kindly provided by P. Moss, Oxford University, Oxford, U.K.) and peptides EADPTGHSY (MAGE-1.A1), EVDPIGHLY (MAGE-3.A1), or VSDGGPNLY (influenza basic polymerase 1 (18)), as described previously (19). Soluble complexes purified by gel filtration were biotinylated using the BirA enzyme (Avidity LCC, Denver, CO). PE or allophycocyanin-labeled tetramers were produced by mixing the biotinylated complexes with Extravidin-PE (Sigma-Aldrich, St. Louis, MO) or streptavidin-allophycocyanin (Molecular Probes, Eugene, OR). Each tetramer batch was validated by staining CTL clones with the appropriate specificity, titered, and then used at the optimum concentration, usually 5 nM HLA H chain.
MLPC
PBMC isolated by Lymphoprep (Nycomed, Oslo, Norway) density gradient centrifugation were cryopreserved in Iscove’s medium supplemented with 10% human serum (HS) and 10% DMSO. After thawing, PBMC were resuspended at 107 cells/ml in Iscove’s medium supplemented with 1% HS and divided into two groups. One group was incubated for 60 min at room temperature with peptide MAGE-1.A1 (20 µM). The other was incubated with MAGE-3.A1. These pulsed PBMC were washed, pooled, and distributed at 2.5 x 105 cells/0.2 ml in round-bottom microwells in Iscove’s medium with HS (10%), L-arginine (116 mg/L), L-asparagine (36 mg/L), L-glutamine (216 mg/L), IL-2 (20 U/ml), IL-4 (10 ng/ml), and IL-7 (10 ng/ml). On day 7, 50% of the medium was replaced by fresh medium containing IL-2, IL-4, and IL-7. Peptide MAGE-3.A1 (20 µM) was added to all cultures. Peptide MAGE-1.A1 was added to all cultures 1 day later. During the second week of stimulation, the cultures were divided according to proliferation in medium containing IL-2 alone. Tetramer labeling was performed on day 14.
Improved protocol for the detection of tetramer-positive cells
We have observed in many MLPC/tetramer experiments that the proportions of cells labeled by a tetramer were <0.03% of the CD8 cells. As the background labeling by a tetramer is in the same range, we use two criteria to distinguish the cells that are specifically labeled by a tetramer from those that are labeled nonspecifically or that appear to be labeled because they display autofluorescence (see Fig. 1). We gate out the cells that display autofluorescence and those that are equally labeled by the relevant A1/MAGE tetramer and by a control HLA-A1 tetramer containing an influenza peptide. Briefly, MLPC were washed, resuspended in PBS with 1% HS, and incubated for 30 min at 37°C with the two HLA-A1 tetramers. Anti-CD8 Abs coupled to FITC (SK1; BD Biosciences, Mountain View, CA) were then added and after a further incubation for 30 min at 37°C, the cells were washed, fixed with 0.5% formaldehyde, and analyzed on a FACSCalibur flow cytometer (BD Biosciences). Typical results are shown in Fig. 1 for four MLPC set up with PBMC from patient EB81 (A–C) or LB2196 (D) stimulated with peptide MAGE-3.A1. The classical CD8/tetramer plots are shown in column 2 for lymphocytes gated on their light scattering properties, as shown in column 1. Column 3 shows that the specificity of detection is improved by gating out cells that emit a higher than background fluorescence at 670 nm when excited at 488 nm. Considering that no dye emitting at 670 nm is present during labeling, the positive events in this "empty channel" are probably cells with a high autofluorescence. This autofluorescence is also apparent in the PE detection channel, leading to false positives. The usefulness of gating out these events is clearly apparent for MLPC D, which contains cells that appear to be CD8+ and tetramer positive. With the autofluorescence correction, this culture can safely be considered negative. Column 4 shows the results when the labeling with the control tetramer is taken into account. In MLPC A and B, there are clearly CD8 cells that are labeled with the two tetramers, artificially increasing the sizes of the A1/MAGE-3+ clusters detected with a single tetramer.
|
|
To derive stable CTL clones from the populations of tetramer-positive cells, which are usually clonal populations, cells stained by tetramer were seeded at one cell per well in round-bottom microplates using flow cytometry and stimulated by the addition of irradiated (100 Gy) allogenic PBMC (8 x 104/well) as feeder cells and irradiated allogenic HLA-A1 EBV-B cells (2 x 104/well) incubated with the MAGE-3.A1 peptide (20 µM) and washed in culture medium with IL-2 (100 U/ml), IL-4 (10 ng/ml), and IL-7 (10 ng/ml). The CTL clones were restimulated weekly by the addition of feeder cells and peptide-pulsed EBV-B cells in medium with growth factors. After 3 wk, they were transferred into 2-ml wells and maintained by weekly restimulations with allogenic LG2-EBV-B cells and peptide-pulsed HLA-A1 tumor cells.
Total RNA from PBMC or tumor material was extracted with the Tripure reagent (Roche Diagnostics, Brussels, Belgium). Reverse transcription was performed at 42°C for 90 min with 200 U of Moloney murine leukemia virus reverse transcriptase mixed with 4 µl of 5x First Strand Buffer (Life Technologies, Merelbeke, Belgium), 2 µl of 20 µM oligo(dT)15, 20 U of RNasin (Promega, Madison, WI), 2 µl of 100 mM DTT (Life Technologies), 1 µl of each dNTP at 10 mM each (Takara, Shiga, Japan), and diethyl pyrocarbonate-treated water in a total volume of 20 µl. cDNA served as template for PCR amplifications using panels of V
- or V-specific upstream primers and one downstream C or C primer chosen on the basis of described panels of TCR V region oligonucleotides (20) and TCR sequences available at the International Immunogenetics Database of M.-P. Lefranc (http://imgt.cines.fr). PCR products were purified and sequenced to obtain a complete identification of the CDR3 region. The anti-MAGE-3.A1 CTL clones expressed the following rearranged TCR genes: CTL 35 of patient EB81: V12-J41 and V24-J1.2; CTL 103 of patient EB81: V21-J28 and V5-J2.7; CTL 1 of patient LAU147: V12-J43, V24.1-J2.7; and CTL 2 of patient NAP33: V29-J49 and V15-J1.2.
Clonotypic PCR
Frequency estimations using clonotypic PCR were based on limiting dilution analysis: PBMC were aliquoted in groups of 105–106 cells, and clonotypic RT-PCR was applied to all groups for the TCR - and -chains. The proportions of CD8 cells in the PBMC and of positive groups for the clonotypic PCR were used to calculate a frequency for a given CTL clone. Here follows the procedure for the anti-MAGE-3.A1 CTL clone of patient EB81. It involves three nested PCR amplifications. The rearranged TCR sequences were V12–1/J41 (5'-..ggtgaacGAGAAaaattcc..) and V24/J1–2 (5'-..cagtgatGCTGGGACAGCAATAtatggct..), with nucleotides that are not templated by V or J genes in capital letters and in lowercase letters the 3' and 5' ends of the V and J sequences, respectively. RNA was extracted from groups of PBMC using Tripure and converted to cDNA using the SuperScript II reverse transcriptase (Life Technologies) and an anchored oligo(dt)21 primer, which contains a T7 promoter sequence at its 5' end. All of the cDNA was used as template in a PCR amplification with forward primers corresponding to V24 (LUR353: 5'-cacaaagacaggaaagaggattatg) and V12 (LUR351: 5'-ttccagagggagccactg), and a reverse primer (5'-gccagtgaattgtaatacgactcac) matching the T7 sequence (for 94°C, 5 min (94°C, 45 s; 62°C, 60 s; 72°C, 120 s) for 22 cycles, 72°C, 10 min). Aliquots (1/100) of this amplified product were used as templates in nested PCR amplifications. For the TCR chain, a first amplification used LUR353 and a primer straddling the J1–2/C junction and a second amplification used another V24 primer, downstream to LUR353, and a primer matching the CDR3 sequence. For the TCR chain, a first amplification with LUR351 and a C primer and a second amplification with a CDR3 primer and a primer straddling the J41/C junction. The CDR3 primers did not completely cover the CDR3 regions, allowing us to check for the presence of the appropriate N nucleotides by sequencing the final PCR product.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Regressor patient EB81
This patient had 70 cutaneous metastases when she received the ALVAC-MAGE vaccine. About one-third of the metastases started to regress during these vaccinations, while the others regressed later during vaccination with the MAGE peptides (Fig. 3). All metastases eventually became undetectable, except for a new enlarged inguinal lymph node that was resected and found to contain tumor cells expressing MAGE-1 and MAGE-3. Subsequently, the other nodes of the same region were removed, but none of them contained melanoma cells. Three years after the onset of vaccination, the patient was still free of detectable melanoma.
|
|
and V rearrangements were applied directly to cDNA obtained from groups of PBMC. The observed frequencies closely matched those found by the MLPC/tetramer approach (Fig. 3). We conclude that the blood frequency of anti-MAGE-3.A1 CTL increased from <10-7 to 3 x 10-6 of the CD8 after ALVAC vaccination and that this response was essentially monoclonal. Lymph nodes were analyzed to find out whether they contained anti-MAGE-3.A1 CTL other than those found in blood. In a MLPC/tetramer experiment conducted with cells of the metastatic lymph node resected in April 2000, we found CTL 35 and CTL 103 and no other anti-MAGE-3.A1 CTL. In the surrounding lymph nodes, which did not contain tumor cells, MLPC/tetramer experiments indicated an anti-MAGE-3.A1 CTLp frequency of 2 x 10-6 of the CD8, and clonotypic PCR indicated that all of these CTL expressed TCR 35.
We explored whether a set of vaccinations given at short intervals could boost the anti-MAGE-3.A1 CTL response. From February 2001, the patient received five weekly injections of peptide MAGE-3.A1. Anti-MAGE-3.A1 CTLp frequencies were 10-6 of the CD8 before the boost (Fig. 3, post 6) and 1.7 x 10-6 one week after the fifth peptide injection (post 7). Six months later, the patient received 4 weekly injections of ALVAC-MAGE. The anti-MAGE-3.A1 CTLp frequency increased almost 10-fold to 10-5 of the CD8 one week after the fourth injection (post 12). Clonotypic PCR for TCR 35 indicated a frequency of 1.3 x 10-5 in this blood sample, confirming the increased CTL frequency and indicating that it corresponded to CTL 35 and not to a new CTL. New series of peptide and virus injections were administered in 2002. Here again, the blood frequency of CTL 35 did not increase significantly after the injections of peptide, but increased 3-fold after a single injection of ALVAC-MAGE (Fig. 3). It did not increase further after three additional ALVAC injections.
Regressor patient LAU147
This patient had one subcutaneous metastasis at study entry. It regressed completely after the fourth ALVAC-MAGE injection. But the detection of a brain metastasis resulted in patient withdrawal from the study before the injections of peptides. Before vaccination, the blood frequency of anti-MAGE-3.A1 CTLp was 4 x 10-7 of the CD8 cells (Fig. 5). At the time of the third ALVAC injection, this frequency was 2.5 x 10-4 of the CD8, and it increased up to 3 x 10-3 after the fourth injection. Five months later, it had decreased to 8 x 10-5 of the CD8. Nine anti-MAGE-3.A1 CTL clones were derived. All expressed the same TCR.
|
This patient had three subcutaneous metastases at the onset of vaccination. These tumors progressed and a fourth metastasis appeared. Approximately 6 mo after the first vaccination, all metastases regressed slowly until complete clinical disappearance. Before vaccination, the frequency of anti-MAGE-3.A1 CTLp was 3.8 x 10-7 of blood CD8 cells and it did not increase after vaccination (Fig. 5). However, TCR analysis of 18 anti-MAGE-3.A1 CTL clones obtained after vaccination indicated that one clonotype, TCR 2, was repeated 6 times, whereas the 11 others were different. We conclude that CTL 2 expanded following vaccination.
Patient NAP33 also received series of weekly booster injections of peptides and ALVAC-MAGE (Fig. 5). The frequency of anti-MAGE-3.A1 CTLp did not increase after these vaccinations.
Regressor patient CP67
This patient showed regression of subcutaneous and lymph node metastases after the vaccinations with ALVAC-MAGE. No anti-MAGE-3.A1 or anti-MAGE-1.A1 CTLp could be found among 18 x 106 postvaccination PBMC, indicating frequencies below 3.7 x 10-7 of CD8 cells.
Patients without tumor regression
Twelve of 16 HLA-A1-vaccinated patients who did not display tumor regression were analyzed (Table I). An anti-MAGE-3.A1 CTL response was observed in two patients. In patient NAP36, the pre- and postvaccination CTLp frequencies were <1.4 x 10-7 and 2.5 x 10-6 of the CD8, respectively. Six of seven postvaccination CTL clones shared the same TCR, indicating that this CTL expanded after vaccination. For patient VUB39, pre- and postvaccination frequencies were 1.1 x 10-6 and 9.3 x 10-6 of the CD8. One CTL clone was already repeated before vaccination, suggesting that this patient had mounted a spontaneous anti-MAGE-3.A1 CTL response.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The CTL responses that we have observed appear stable: when a responding CTL clone was detected, its blood frequency always remained detectable. But the intensities of the observed anti-MAGE-3.A1 CTL responses varied widely from one patient to another. In patients EB81, LAU147, and NAP33, the blood frequencies of the amplified CTL clone were 3 x 10-6, 3 x 10-3, and 10-7 of the CD8 cells, respectively. It is worth noting that with a total number of 4 x 1010 CD8 lymphocytes in a human individual, a frequency of 10-7 corresponds to a population of 4000 cells or 12 divisions after the activation of a naive precursor. Assuming that antivaccine T cells initiate the tumor regression process observed after peptide or ALVAC-MAGE vaccinations and that the CTL clones that we detected represent all of these antivaccine T cells, our results indicate that the initiation of the tumor regressions did not require a large number of antivaccine T cells.
The CTL responses observed after ALVAC-MAGE vaccination were monoclonal for patients LAU147 and NAP33. In patient EB81, one clone represented at least 95% of the response. Incidentally, the TCR sequences of the CTL found in all of these patients were completely different. Monoclonality has also been observed after vaccination with peptide MAGE-3.A1 without adjuvant (13, 15). It is, of course, impossible to exclude that other anti-MAGE-3.A1 T cells were activated in vivo, but failed to proliferate in vitro under our restimulation conditions. However, it is worth noting that when we applied the same MLPC/tetramer/cloning approach to metastatic melanoma patients receiving mature dendritic cells pulsed with peptide MAGE-3.A1, we observed polyclonal CTL responses (22). Presumably, the capacity of a peptide or ALVAC-MAGE injection to activate specific T cells is very limited in time and space, leading to at best a single hit. Improved vaccination modalities are expected to activate several T cell clones, and this is indeed the case in patients vaccinated with peptide-pulsed dendritic cells. In patients vaccinated with peptide or ALVAC-MAGE, the monoclonality of the response provides the opportunity to track down all of the antivaccine CTL directly in the blood using clonotypic PCR, to analyze their phenotype or function (15), and to assess their presence in regressing and nonregressing tumors.
In this study, we have analyzed four patients who showed tumor regression and we have observed three CTL responses. Assuming that a CTL response nevertheless occurred in the other patient, there are several plausible explanations for our inability to detect it. First, the patient could produce T cells against peptide MAGE-1.A1 or MAGE-3.A1 presented by a HLA molecule other than A1. Such T cells would escape detection by the tetramer method, which is locked on one presenting HLA molecule. In line with this possibility is our observation that peptides MAGE-1.A1 and MAGE-3.A1 can also be presented by HLA-B35 molecules (23, 24). However, we have actively explored alternative HLA-peptide combinations with peptides MAGE-1A.1 and MAGE-3.A1 in the regressor patient without detectable HLA-A1-restricted CTL, and we have failed to find a CTL response against a new combination. Another possibility is that a monoclonal CTL response escaped detection by the MLPC/tetramer approach due to the inability of these T cells to grow under our restimulation conditions. Finally, mice were shown to reject tumors of 0.5 cm3 with 20,000 tumor-specific CTL. In humans, with 4 x 1010 CD8 T cells, this number of CTL corresponds to a blood frequency of 5 x 10-7 (15). It is therefore possible that a tumor regression process could be initiated by antivaccine CTL present in the blood at a frequency of about or below 10-7 of the CD8, rendering their detection almost impossible with present methods.
The evolution of the patients of the ALVAC-MAGE vaccination study mentioned in this report will be described in detail elsewhere (N. van Baren, M. Marchand, B. Dreno, T. Dorval, S. Piperno, D. Lienard, B. Escudier, T. Boon, P. Coulie, M.-C. Bonnet, and P. Moingeon, manuscript in preparation). Thirty melanoma patients received at least four ALVAC-MAGE vaccinations and were considered evaluable for tumor response. Of these, 21 were HLA-A1. The other patients expressed HLA-B35, which also presents the MAGE-1.A1 and MAGE-3.A1 peptides (23, 24). Tumor regressions were observed in 5 of the 21 HLA-A1 patients and CTL responses in 3 of the 4 who were tested. For the 16 HLA-A1 progressor patients. CTL responses were observed in 2 of the 12 that were tested. Adding these results to those obtained in peptide vaccination studies ((9, 13) and our unpublished results), regressions of melanoma metastases were observed in 18 of 91 patients and anti-MAGE-3.A1 CTL responses were detected in 5 of 10 regressor patients and 2 of 18 progressors. These numbers suggest that there is a correlation between the occurrence of these CTL responses and the tumor regressions, but this needs to be confirmed with larger numbers.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Pierre G. Coulie, Cellular Genetics Unit, Université de Louvain, Avenue Hippocrate 74, UCL 7459, B-1200 Brussels, Belgium. E-mail address: coulie{at}gece.ucl.ac.be
3 Abbreviations used in this paper: MLPC, mixed lymphocyte-peptide culture; HS, human serum; CTLp, CTL precursor.
Received for publication April 11, 2003. Accepted for publication August 18, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur. J. Immunol. 22:1261.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Y. AKIYAMA, K. MARUYAMA, S. TAI, M. KOMIYAMA, A. IIZUKA, M. TAKIKAWA, C. OHSHITA, A. YAMAMOTO, N. YAMAZAKI, Y. KIYOHARA, et al. Characterization of a MAGE-1-derived HLA-A24 Epitope-specific CTL Line from a Japanese Metastatic Melanoma Patient Anticancer Res, February 1, 2009; 29(2): 647 - 655. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Connerotte, A. Van Pel, D. Godelaine, E. Tartour, B. Schuler-Thurner, S. Lucas, K. Thielemans, G. Schuler, and P. G. Coulie Functions of Anti-MAGE T-Cells Induced in Melanoma Patients under Different Vaccination Modalities Cancer Res., May 15, 2008; 68(10): 3931 - 3940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Speiser, P. Baumgaertner, C. Barbey, V. Rubio-Godoy, A. Moulin, P. Corthesy, E. Devevre, P.-Y. Dietrich, D. Rimoldi, D. Lienard, et al. A Novel Approach to Characterize Clonality and Differentiation of Human Melanoma-Specific T Cell Responses: Spontaneous Priming and Efficient Boosting by Vaccination J. Immunol., July 15, 2006; 177(2): 1338 - 1348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Wischnewski, K. Pantel, and H. Schwarzenbach Promoter Demethylation and Histone Acetylation Mediate Gene Expression of MAGE-A1, -A2, -A3, and -A12 in Human Cancer Cells Mol. Cancer Res., May 1, 2006; 4(5): 339 - 349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. van Baren, M.-C. Bonnet, B. Dreno, A. Khammari, T. Dorval, S. Piperno-Neumann, D. Lienard, D. Speiser, M. Marchand, V. G. Brichard, et al. Tumoral and Immunologic Response After Vaccination of Melanoma Patients With an ALVAC Virus Encoding MAGE Antigens Recognized by T Cells J. Clin. Oncol., December 10, 2005; 23(35): 9008 - 9021. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang, Z. Sun, H. Nicolay, R. G. Meyer, N. Renkvist, V. Stroobant, J. Corthals, J. Carrasco, A. M. M. Eggermont, M. Marchand, et al. Monitoring of Anti-Vaccine CD4 T Cell Frequencies in Melanoma Patients Vaccinated with a MAGE-3 Protein J. Immunol., February 15, 2005; 174(4): 2404 - 2411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. L. Smith, A. Tristram, K. M. Gallagher, A. N. Fiander, and S. Man Epitope specificity and longevity of a vaccine-induced human T cell response against HPV18 Int. Immunol., February 1, 2005; 17(2): 167 - 176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Germeau, W. Ma, F. Schiavetti, C. Lurquin, E. Henry, N. Vigneron, F. Brasseur, B. Lethe, E. De Plaen, T. Velu, et al. High frequency of antitumor T cells in the blood of melanoma patients before and after vaccination with tumor antigens J. Exp. Med., January 18, 2005; 201(2): 241 - 248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lurquin, B. Lethe, E. De Plaen, V. Corbiere, I. Theate, N. van Baren, P. G. Coulie, and T. Boon Contrasting frequencies of antitumor and anti-vaccine T cells in metastases of a melanoma patient vaccinated with a MAGE tumor antigen J. Exp. Med., January 18, 2005; 201(2): 249 - 257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Lonchay, P. van der Bruggen, T. Connerotte, T. Hanagiri, P. Coulie, D. Colau, S. Lucas, A. Van Pel, K. Thielemans, N. van Baren, et al. Correlation between tumor regression and T cell responses in melanoma patients vaccinated with a MAGE antigen PNAS, October 5, 2004; 101(suppl_2): 14631 - 14638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. N. Blattman and P. D. Greenberg Cancer Immunotherapy: A Treatment for the Masses Science, July 9, 2004; 305(5681): 200 - 205. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
