The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kubes, P.
Right arrow Articles by Power, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kubes, P.
Right arrow Articles by Power, C.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2003, 171: 4801-4808.
Copyright © 2003 by The American Association of Immunologists

In Vivo Impairment of Neutrophil Recruitment during Lentivirus Infection1

Paul Kubes2, Bryan Heit, Guido van Marle, James B. Johnston, Derrice Knight, Adil Khan and Christopher Power

Departments of Physiology and Biophysics and Medicine, Immunology Research Group, and Departments of Clinical Neuroscience, Microbiology, and Infectious Diseases, Neuroscience Research Group, University of Calgary, Calgary, Alberta Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Evidence indicates that the lentivirus, HIV, infection affects neutrophil response to bacteria and bacterial products in vitro. We used a novel model of rapid onset immunosuppression following infection with a similar lentivirus, feline immunodeficiency virus (FIV), in cats to examine neutrophil function within the microvasculature in vivo and to determine the steps that are impaired in the neutrophil recruitment cascade. In uninfected cats and cats infected neonatally with FIV, the mesentery was exteriorized, but remained autoperfused during intravital microscopy for 4 h. When the tissue was superfused with 10 µg/ml of LPS for 4 h, intravital microscopy displayed a profound increase in neutrophil rolling at both 8 and 12 wk of age in uninfected cats. At 12 wk of age, FIV-infected animals showed a profound decrease in the number of rolling neutrophils. In vitro studies revealed that neutrophils from infected and uninfected animals rolled equally well on surrogate selectin substrata. In addition, in vivo neutrophil adhesion and emigration out of the vasculature were severely reduced, and in vitro neutrophil chemotaxis from FIV-infected animals was significantly impaired in response to fMLP or IL-8. However, FIV infection of neutrophils could not be detected. In summary, in vivo lentivirus infection with immunosuppression leads to a severe impairment in neutrophil rolling, adhesion, and emigration in response to bacterial stimulants potentially involving both endothelial and neutrophil dysfunction. These in vivo studies also indicate that neutrophil dysfunction should be taken into account when treating infections and tissue injury.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lentiviruses, including HIV, SIV, and feline (FIV)3 immunodeficiency viruses, are associated with immunological impairment in their respective hosts, and the latter two serve as important models for the study of HIV pathogenesis (1, 2). HIV and FIV share many properties, including genomic organization, replication strategy, cell tropism, and a common mechanism of infection involving the chemokine receptors (2). Both HIV and FIV infections increase the likelihood of secondary bacterial infections, although the mechanism of action remains unclear (1). Although neither HIV nor FIV is thought to infect neutrophils (the primary leukocytes involved in innate immunity), there is a growing body of literature to suggest impairment of neutrophil function from HIV-infected patients in response to bacterial infections despite the preservation of absolute neutrophil counts with advanced immunosuppression. In fact, in the case of HIV, isolated neutrophils have been shown to have decreased oxidant production (3), protease release (3), bacterial killing (4), phagocytosis (5), and chemotaxis (4, 6). Although the increased susceptibility to infections in HIV- and FIV-infected patients may be related to impaired antimicrobial functions related to bacterial killing (oxidant production, protease release, phagocytosis), it might also be associated with impaired neutrophil recruitment (rolling, adhesion, or emigration). To our knowledge, a systematic in vivo assessment of efficacy of recruitment of neutrophils to inflammatory stimuli in lentivirus-infected humans or animals has not been performed.

Neutrophil recruitment to sites of infection is a complex, multistep event that requires the coordinated expression of multiple proteins (7, 8). The first step of the recruitment cascade is the tethering and rolling of neutrophils within postcapillary venules (9). The rapid endothelial expression of presynthesized P-selectin from endothelial stores as well as de novo synthesis of E-selectin allow for leukocyte rolling (10, 11). The rolling event is thought to bring the neutrophils in close proximity to the endothelial surface where integrin-activating molecules, including proinflammatory phospholipids and chemokines, stimulate the rolling neutrophils to firmly adhere (12). This latter event is dependent in part upon {beta}2 integrins, requiring both up-regulation and activation for full adhesive function (13). Once firmly adherent, the neutrophils can emigrate across the endothelium and chemotaxis toward the invading organism. Clearly, lentiviruses could potentially impact at any stage of this multistep cascade of neutrophil recruitment.

Although some aspects of this multistep cascade can be recapitulated in vitro, it is extremely difficult to reconstruct the entire event. Therefore, in this study we used intravital microscopy, a system that allowed us to visualize the postcapillary venules within FIV-infected and uninfected cats, and tested the hypothesis that neutrophil recruitment was impaired by lentivirus infection at one or more steps of the leukocyte recruitment pathway. We tested the ability of FIV-infected and uninfected animals to respond to LPS, the primary cell wall component of Gram-negative bacteria. Our results suggest a marked impairment in neutrophil rolling, adhesion, as well as emigration in response to this inflammatory signal.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell cultures

Feline PBMC used for infection studies and preparation of viral stocks were isolated from blood obtained from specific pathogen-free adult felines by density gradient centrifugation, as described previously (14). PBMC were initially stimulated for 3 days with Con A (5 µg/ml; Sigma-Aldrich, Oakville, Canada), then maintained in RPMI 1640 medium with 15% FCS and IL-2 (100 IU/ml; Sigma-Aldrich). Primary monocyte-derived macrophages were isolated from unstimulated PBMC by adherence on polystyrene flasks for 24 h, differentiated for 7 days, and cultured in RPMI 1640 medium containing 20% FCS.

Virus infection

The FIV strain used in this study was the infectious molecular clone, FIV-Ch, derived by transfection of CrFK cells and selection in feline PBMC, as described previously (15). Culture supernatants from FIV-infected feline PBMC, which served as sources of infectious virus for these experiments, were cleared of cellular debris by centrifugation and titrated by limiting dilution as described previously (14). For infection with FIV, primary monocyte-derived macrophages were inoculated with 100 µl of viral stock containing 104.5 50% tissue culture infectious doses/ml, incubated for 2 h at 37°C, washed twice, and cultured in serum-free medium until supernatants (conditioned medium) and cells were harvested. Infection was assessed by measuring reverse transcriptase activity in conditioned medium as described previously (14).

Animals and virus inoculation

Adult specific pathogen-free pregnant cats (queens) were obtained from Unique Ventures (Winnipeg, Canada) and housed according to University of Calgary Animal Resource Center guidelines. All queens were found to be negative for feline retroviruses by PCR analysis and serological testing. On day 1 postdelivery, neonatal kittens were inoculated i.p. with 0.2 ml of infectious (104.5 50% tissue culture infectious doses/ml) or heat-inactivated virus (control cats) using a 30-gauge needle and syringe. Kittens were weaned at 6 wk and were monitored until 12 wk of age, during which changes in body weight were assessed weekly. PBMC and plasma were isolated from blood collected at 8 and 12 wk postinfection (PI), and the levels of CD4+ and CD8+ cells were analyzed by flow cytometry. Neutrophil counts were performed using Giemsa stain. After 12 wk, animals were euthanized.

Real-time RT-PCR measurement of plasma viral load

A real-time RT-PCR protocol using primers that detect the FIV pol gene from multiple strains was used to determine the number of copies of viral RNA per milliliter of plasma. To obtain a standard curve, in vitro RNA transcripts of the FIV pol region were generated from pBS-FIV pol. This plasmid contained a 3.1-kb pol gene fragment (positions 2137–5282) generated from the FIV molecular clone p34TF10 by PCR using primers (POL-KpnI, GAAAATGGTACCCAAAATATGATTGG; POL-XhoI, CTCCTCCTCGAGCACTGCAAAG) that introduced unique KpnI and XhoI restriction sites at the 5' and 3' ends of the amplicon, respectively. The PCR fragment was digested with KpnI and XhoI and ligated into the KpnI and XhoI sites downstream of the T7 promoter in pBluescript SK II+, resulting in pBS-FIV pol. Correct insertion of the fragment was confirmed by restriction enzyme analysis and sequencing. The plasmid was linearized with XhoI, treated with proteinase K (0.2 mg/ml, 0.5% SDS, 50°C for 30 min), and purified by phenol/chloroform extraction and ethanol precipitation. Two to 3 µg of linearized DNA was used as a template to generate in vitro run-off RNA transcripts using a T7 in vitro RNA transcription kit (Ambion, Austin, TX), and RNA transcripts were purified by phenol/chloroform extraction and isopropanol precipitation. The amount of RNA was measured by spectrophotometry, and the concentration was converted to RNA copies per microliter. A standard curve was generated with serial 10-fold dilutions (1011 copy/8 µl to 1 copy/8 µl) of the in vitro transcribed RNA. Subsequently, the transcripts were treated with RNase-free DNase I (Promega, Madison, WI) and reverse transcribed using Superscript II and random N6 oligomers to prime cDNA synthesis (Invitrogen, Burlington, Canada). Viral RNA was extracted by spin column (Roche, Indianapolis, IN) from plasma harvested at each time point, and subsequently cDNA synthesis was performed (15). The cDNA was diluted 1/1 with ddH20(water), and 5 µl was used per PCR reaction. Real-time quantitative PCR was performed using the iCycler IQ system (Bio-Rad, Mississauga, Canada), with each 25 µl reaction containing 5 µl of cDNA (standard or sample), 11.5 µl of Supermix, 6.5 µl of SYBR-Green (1/50,000 dilution; Bio-Rad), 1 µl of fluorescein (1/10,000; Bio-Rad), and 1 µl of primer mix (5 µM of each primer). The primers used (pol3860, CCA GAT ATG ATG GAG GGA ATC T; pol4052C, CAT ATC CTG CAT CTT CTG AAC T) yield a 192-bp product. The amplification protocol consisted of an initial denaturation step of 3 min at 95°C, followed by 45 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Following a final elongation step of 72°C for 1 min, the amplicons were subjected to a melt curve analysis to ensure proper amplification, in which the temperature was raised from 65 to 99°C in 1°C increments, and data were acquired for 8 s at each temperature increment. Viral loads in plasma were expressed as copies per milliliter plasma.

Flow cytometry

Whole blood was collected in K3 EDTA tubes and incubated for 5 min at room temperature with four parts ammonium chloride lysing solution (17 mM NH4Cl, 100 mM KHCO3, and 0.1 mM EDTA) to lyse erythrocytes. PBMC were pelleted by centrifugation, resuspended in PBS containing 0.1% sodium azide (1 x 106 cells), and incubated for 20 min at room temperature with anti-CD4 or CD8 mAbs (3 µg/ml; provided by Dr. P. Moore, University of California, Davis, CA). Cells were again washed, incubated for 20 min with FITC-conjugated goat anti-mouse IgG (0.25 µg/µl; BD Biosciences, San Jose, CA), and resuspended in 0.5 ml of 1% formalin in PBS for analysis. Using a FACScan flow cytometer (BD Biosciences) with the argon laser excitation set at 488 nm, data were collected from ~15,000 events for each experimental condition, and results were expressed as a single-parameter log fluorescence histogram. Cells incubated in the absence of Abs or with 1 µg/ml of FITC-labeled, isotype-matched murine IgG1 (BD Biosciences) served as controls.

Intravital microscopic studies

The surgical preparation used in this study is the same as described previously (16, 17). Briefly, age-matched uninfected (control) and FIV-infected cats (1.2–2.4 kg) were fasted for 24 h and initially anesthetized with ketamine hydrochloride (75 mg, i.m.). The jugular vein was cannulated, and anesthesia was maintained by the administration of pentobarbital sodium. A tracheotomy was performed to support breathing by artificial ventilation. Systemic arterial pressure was monitored by a pressure transducer (Statham P23A; Gould, Oxnard, CA), connected to a catheter in the left carotid artery. A midline abdominal incision was made, and a segment of small intestine was isolated from the ligament of Treitz to the ileocecal valve. The remainder of the small and large intestines was extirpated. Body temperature was maintained at 37°C using an infrared heat lamp. All exposed tissues were moistened with saline-soaked gauze to prevent evaporation. Heparin sodium (10,000 U; Elkins-Sinn, Cherry Hill, NJ) was administered, then an arterial circuit was established between the superior mesenteric artery (SMA) and the left femoral artery. SMA blood flow was continuously monitored using an electromagnetic flow meter (Carolina Medical Electronics, King, NC). Blood pressures were continuously recorded with a physiological recorder (Grass Instruments, Quincy, MA).

Cats were placed in a supine position on an adjustable Plexiglas microscope stage, and a segment of midjejunum was exteriorized through the abdominal incision. The mesentery was prepared for in vivo microscopic observation as previously described (16, 17). The mesentery was draped over an optically clear viewing pedestal that allowed for transillumination of a 3-cm segment of tissue. The temperature of the pedestal was maintained at 37°C with a constant temperature circulator (model 80; Fisher Scientific, Pittsburg, PA). The exposed bowel was draped with saline-soaked gauze, while the remainder of the mesentery was covered with Saran Wrap (Dow Corning, Midland, MI). The exposed mesentery was suffused with warmed bicarbonate-buffered saline (pH 7.4) that was bubbled with a mixture of 5% CO2 and 95% N2. The mesenteric preparation was observed through an intravital microscope (Optiphot-2; Nikon, Mississauga, Canada) with a x25 objective lens (Wetzlar L25/0.35; Leitz, Munich, Germany) and a x10 eyepiece. The image of the microcirculatory bed (x1400 magnification) was recorded using a video camera (Digital 5100; Panasonic, Osaka, Japan) and a video recorder (NV8950; Panasonic).

Single unbranched mesenteric venules (25- to 40-µm diameter, 250-µm length) were selected for each study. Venular diameter was measured either on- or off-line using a video caliper (Microcirculation Research Institute, Texas A&M University, College Station, TX). The number of rolling and adherent neutrophils was determined off-line during playback analysis. Rolling neutrophils were defined as white blood cells that moved at a velocity less than that of erythrocytes in a given vessel. The number of rolling neutrophils (flux) was counted using frame-by-frame analysis. To obtain a complete neutrophil rolling velocity profile, the rolling velocity of all neutrophils entering the vessel was measured. A neutrophil was defined as adherent to venular endothelium if it remained stationary for >30 s. Adherent cells were measured at 10-min intervals as described in the experimental protocol and were expressed as the number per 100-µm length of venule. RBC velocity (VRBC) was measured using an optical Doppler velocitometer (Microcirculation Research Institute), and mean VRBC (Vmean) was determined as VRBC/1.6 (18). Wall shear rate was calculated based on the Newtonian definition: shear rate = (Vmean/Dv) x (8 (s-1), where Dv is the venular diameter.

Experimental protocol: in vivo experiments

Baseline measurements of blood pressure, SMA blood flow, VRBC, and vessel diameter were obtained, and neutrophil-endothelial cell interactions were determined at 8 and 12 wk of age. Endotoxin (Escherichia coli, 1.0 µg/ml) was superfused over the exteriorized mesentery for 4 h. This prevented any systemic, hemodynamic disturbances and permitted the direct assessment of neutrophil-endothelial cell interactions in FIV-infected animals. The microvasculature was videotaped for the last 10 min of every hour. In previous work we established that the LPS-induced neutrophil rolling was indeed endothelial selectin dependent, and the adhesion was dependent upon neutrophil integrins (19, 20).

Histology

A section of cat mesentery was removed immediately after intravital microscopy and was placed in 10% formalin. The tissue was embedded in paraffin, sectioned (4 µm), and stained with H&E. Images were captured using an IX70 widefield microscope (Olympus, Melville, NY) and Openlab software (Improvision, Guelph, Canada). Images were taken at x200 (air) and x600 (oil immersion). Infiltrating leukocytes were identified via morphology.

Neutrophil isolation and preparation

Blood was collected from FIV-infected and uninfected cats. Erythrocytes were removed using dextran sedimentation (6% dextran/0.9% NaCl), followed by two rounds of hypotonic lysis using ddH2O. Neutrophils were isolated from the resulting cell suspension using Ficoll-Histopaque density centrifugation. The entire isolation was performed at 4°C. Purified neutrophils were suspended in HBSS at a concentration of 1.0 x 107 cells/ml and were kept on ice until needed. Neutrophils were >95% viable and >97.5% pure, as determined by FACS.

Under agarose assay procedure

The under agarose assay was performed as previously described (21, 22, 23) with minor modifications. Falcon 35 x 10-mm culture dishes were filled with 3 ml of a 1.2% agarose solution containing 50% H2CO3-buffered HBSS and 50% RPMI 1640 culture medium with 20% heat-inactivated FCS. After the agarose solidified, three wells, 3.5 mm in diameter and 2.4 mm apart, were cut into a straight line in the gel. The gels were allowed to equilibrate for 1 h in a 37°C/5% CO2 incubator. The outer wells were loaded with purified neutrophils, and the central well was loaded with varying concentrations of chemoattractant. Once loaded, the gels were incubated for 2 h in a 37°C/5% CO2 incubator, which allowed sufficient time for neutrophils to migrate the entire distance between the wells. Results were recorded using a video camera attached to an Axiovert 135 microscope (Zeiss, Thornwood, NY).

Neutrophil cell counts

The number of blood neutrophils was determined using a Diff-Quick staining kit (Richard Allen Scientific, Kalamazoo, MN) according to instructions provided. Cells were counted using an Axiolab microscope (Zeiss) at x100 magnification. Neutrophils were identified by morphology.

Statistics

The data were analyzed using standard statistical analysis, i.e., ANOVA and Student’s t test with Bonferroni’s correction for multiple comparisons when appropriate. Values are the mean ± SE. Statistical significance was set at p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Systemic changes in FIV-infected neonates

The systemic features of FIV infection were assessed by measuring changes in body weight and peripheral blood cell populations over the 12-wk period. Weekly determinations of body weights indicated that progressive weight gains occurred in both uninfected (control) and FIV-infected animals. However, the mean weight gain of the FIV-infected group was significantly lower than that in control animals (p < 0.05) and accounted for ~10% of the weight difference at 12 wk (data not shown). Analysis by flow cytometry of PBMC isolated at wk 8 PI from FIV-infected and uninfected cats revealed no significant differences between groups in the percentage of CD4+ cells (Fig. 1). In contrast, CD4+ cell levels were significantly lower at wk 12 PI (p < 0.001) in animals infected with FIV-Ch compared with mock-infected cats (Fig. 1A). These differences reflected an increase in the number of CD4+ cells in control animals (80%), while levels in FIV-Ch animals decreased over the same time period (50%). Comparison of CD8+ cells at the same time points indicated that levels were increased significantly in the FIV-infected group compared with controls at wk 8 PI, which declined by 12 wk PI (Fig. 1B). Analysis of CD4+/CD8+ ratios at both time points indicated that for uninfected animals, the ratio was >2.0, while the ratio was <1.0 for the FIV-infected group at each time point. This is similar to lymphocyte ratios among HIV-infected patients with advanced immunosuppression (24). Total leukocyte counts in blood did not show any significant differences among groups at 8 wk of age (Table I). Although a 50% increase in total leukocyte counts was noted at 12 wk in both groups; it did not achieve statistical significance. Neutropenia was not a major feature of FIV infection (Table I), similar to HIV infection.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. CD4+ and CD8+ lymphocytes in blood. PBMC isolated from whole blood at 8 and 12 wk PI were analyzed for CD4+ and CD8+ lymphocyte percentages by FACS. A, CD4+ cells were significantly reduced in FIV-infected animals at 12 wk PI, but not at 8 wk PI. B, CD8+ cells were significantly higher at both time points in FIV-infected animals relative to controls.

 

View this table:
[in this window]
[in a new window]
 
Table I. Total leukocyte counts and neutrophil counts for experimental groupsa

 
Viral quantitation

To assess viral quantity in blood, a quantitative real-time RT-PCR assay was established (Fig. 2). The plasma viral load of the infected animals was determined from a standard curve, generated using known quantities of RNA from which corresponding cycle thresholds were measured (Fig. 2A). Analysis of plasma viral load revealed detectable viral RNA at both 8 and 12 wk in all FIV-infected animals (Fig. 2B). The viral load ranged from 1.84–4.6 log viral RNA copies/ml of plasma among FIV-infected animals, and no significant difference was observed between 8 and 12 wk groups of FIV-infected animals. In contrast, FIV was not detected in plasma from uninfected controls. Nested PCR, RT-PCR, as well as FACS were also used in an attempt to detect viral load in purified neutrophils. None of these approaches revealed any detectable FIV infection in neutrophils from FIV-infected cats.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. A, Real-time RT-PCR quantitation of FIV RNA in a standard curve was established using known quantities of an in vivo transcript of FIV pol region from which the plasma viral load could be interpreted. B, Viral RNA was not detected in uninfected (Control) animals, but ranged from 1.84–4.60 log viral copies/ml of plasma among FIV-infected animals at 8 and 12 wk PI.

 
Neutrophil recruitment is impaired at 12 wk, but not at 8 wk

Fig. 3 summarizes the number of rolling neutrophils in 25- to 35-µm-long postcapillary venules. At 8 wk of age (Fig. 3A), the number of rolling neutrophils under basal conditions was ~40 cells/min. In uninfected cats the number of rolling leukocytes approximately tripled (120 cells/min) in response to 4 h of LPS treatment. In the FIV-infected group there was no difference from uninfected animals in the number of neutrophils that rolled under basal conditions, suggesting no impairment in neutrophil surveillance of the microvasculature. In FIV-infected animals there was a modest increase in neutrophil rolling, but the response appeared blunted and reached significance only at 3 h. A profound difference between FIV-infected and uninfected groups was seen by 12 wk (Fig. 3B). In the 12-wk-old uninfected cats the number of rolling neutrophils increased >5-fold to 150–175 rolling neutrophils/min. Although similar levels of rolling were observed under basal conditions in 12-wk FIV-infected cats, the ability to increase the number of rolling neutrophils in response to LPS was greatly impaired, such that the number of rolling neutrophils was significantly less in FIV-infected than uninfected cats (p < 0.05).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 3. Rolling leukocyte flux in response to LPS in 8-wk-old animals (A) and 12-wk-old animals (B). *, p < 0.05 compared with control animals, by single-sample t test. +, p < 0.05 compared with LPS control in same time group, by single-sample t test. n = 4 for all groups except for 12-wk-old FIV+, where n = 5.

 
Since much of the neutrophil rolling is dependent on endothelial P-selectin, based on previous experiments (16, 20) we perfused whole blood from FIV-infected and uninfected animals over a set number of platelet-derived P-selectin molecules (using a surrogate platelet monolayer). Fig. 4 demonstrates that the same number of rolling neutrophils from uninfected and FIV-infected cats was present on the inert selectin substratum, suggesting no inherent global impairment in the ability of neutrophils to tether and roll.



View larger version (9K):
[in this window]
[in a new window]
 
FIGURE 4. Rolling of leukocytes from LPS-treated animals on platelet monolayers. n = 4 for control animals; n = 5 for FIV-infected animals.

 
Fig. 5 summarizes the number of adherent neutrophils in response to LPS in uninfected and FIV-infected animals. There was a significant increase in the number of adherent neutrophils in both groups of 8-wk-old animals with LPS superfusion (Fig. 5A). By contrast, neutrophil adhesion in 12-wk-old cats was dramatically reduced in FIV-infected animals compared with uninfected animals (Fig. 5B). Over 4 h >30 neutrophils adhered/100-µm-long venule in uninfected animals, whereas fewer than five neutrophils adhered in FIV-infected animals.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 5. Number of adherent leukocytes in response to LPS in 8-wk-old animals (A) and 12-wk-old animals (B). *, p < 0.05 compared with control animals, by single-sample t test. +, p < 0.05 compared with LPS control in same time group, by single-sample t test. n = 4 for all groups except for 12 wk FIV+, where n = 5.

 
Similar results were observed in the number of neutrophils that emigrated out of the vasculature and into the interstitium. In 8-wk-old uninfected animals, 25–30 neutrophils emigrated out of the vasculature per field of view over 4 h in response to LPS (Fig. 6A). Similar numbers of neutrophils emigrated over the same period of time in FIV-infected animals (Fig. 6A). Conversely, very few neutrophils from FIV-infected animals emigrated out of the vasculature in response to LPS in 12-wk-old cats (Fig. 6B). In uninfected 12-wk-old cats the number of neutrophils that emigrated into the surrounding interstitium was >75 cells/field of view (Fig. 6B), which was significantly greater than that in both 8-wk-old and FIV-infected 12-wk-old animals.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 6. Number of emigrating leukocytes in response to LPS treatment in 8-wk-old animals (A) and 12-wk-old animals (B). *, p < 0.05 compared with control animals, by single-sample t test. +, p < 0.05 compared with LPS control in same time group, by single sample t test. n = 4 for all groups except for 12-wk-old FIV+, where n = 5.

 
Immunohistochemistry was performed to determine the types of cells recruited in response to LPS superfusion. Immediately after the intraviatal microscopy was completed a section of the mesentery was removed and stained using H&E dyes. Under control conditions few cells are found in the mesentery. Those that are present have a mononuclear morphology (Fig. 7A). After 4 h LPS superfusion the number of emigrated cells increases dramatically. The inflammatory infiltrate consists almost exclusively of polymorphonuclear cells (Fig. 7B).



View larger version (114K):
[in this window]
[in a new window]
 
FIGURE 7. H&E staining of cat mesentery before and after LPS superfusion. A, Untreated cat mesentery (x600 magnification). Infiltrating leukocytes are stained black. Few leukocytes are present, and most appear mononuclear. B, Mesentery from a cat after 4-h LPS superfusion (x600 magnification). Infiltrating leukocytes are stained black. Infiltrate consists predominantly of neutrophils.

 
To further examine whether there is an impairment in neutrophil function per se, we used an under agarose migration assay that allows neutrophils to migrate toward a chemoattractant via an integrin-dependent mechanism (23). Dose responses were conducted to determine the optimal concentrations of chemoattractants (data not shown). The optimal concentrations of chemoattractants were found to be 1.0 µM for IL-8 and 0.1 µM for fMLP. These concentrations are very similar to those published previously using human cells (23). The data clearly demonstrate that in vitro, neutrophils from uninfected cats migrate very effectively toward bacterial products such as fMLP as well as toward endogenous chemokines like IL-8 (Fig. 8). By contrast, neutrophils from FIV-infected animals were not able to respond to either bacterial or endogenous chemoattractants. The cells were found to change shape (data not shown), but simply did not chemotax as effectively, clearly demonstrating an impairment in neutrophil chemotaxis.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of FIV infection on the chemotaxis of neutrophils to the bacterial peptide fMLP and to the endogenous chemokine IL-8. *, p < 0.05, by paired t test. n = 20.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FIV and SIV viruses have been the two most commonly used in vivo experimental models of HIV infection (1, 2). The similarities between HIV and FIV are striking in that CD4+ T cell number and function decline with resulting immunosuppression, viremia, and an increased incidence of acute and chronic opportunistic infections. Based on in vitro experiments, the prevailing view is that neutrophil biology including chemotaxis (4, 6), oxidant production, and bacterial killing (4) are affected in HIV infections, such that the innate immune response dominated by these leukocytes is depressed. Although a key feature of the innate immune response is the rapid recruitment of neutrophils, to date a systematic assessment of the potentially affected mechanisms in this multistep process has not been evaluated in lentiviral infections. In this study we have made use of the FIV model system, which results in rapid immunosuppression with high viral loads, and used intravital microscopy to visualize the behavior of neutrophils in vivo in their normal physiologic milieu (intact blood vessels). These studies demonstrated that each of the steps (rolling, adhesion, and emigration) of the multistep recruitment cascade is impaired in lentivirus-infected animals.

Our data clearly demonstrate that with age and increasing immunosuppression, lentivirus-infected animals developed a significant impairment in the ability of the innate immune system to respond to a bacterial stimulus like LPS. Unexpectedly, the first step of the leukocyte recruitment cascade, i.e., selectin-dependent neutrophil rolling, was reduced in lentivirus-infected cats. The rolling event is regulated by de novo expression of endothelial selectins and constitutively expressed molecules on neutrophils. The impairment of rolling could be a result of either neutrophil or endothelial impairment. A direct in vitro assay revealed that neutrophil tethering/rolling in vivo was not globally impaired as neutrophils from FIV-infected and uninfected animals rolled equally well on equivalent numbers of selectins. Alternatively, impairment in vivo may exist in endothelium rather than the leukocytes. Presynthesized P-selectin can be rapidly released from prestored pools in endothelial Weibel-Palade bodies. In addition, depending upon the stimulus, P-selectin and E-selectin can also be synthesized to support further neutrophil rolling. Synthesis of E-selectin and P-selectin generally takes 3–4 h. Our present data show that both rapid (first 2 h of LPS) and more delayed (3 and 4 h) neutrophil rolling was reduced in lentivirus-infected animals consistent with FIV affecting endothelial P- and E-selectin production/expression. The virus could affect endothelial adhesion molecule synthesis indirectly, perhaps by reducing proinflammatory cytokine release and/or increasing the release of suppressive molecules from macrophages and CD4+ T cells (or other/infected cells). Although lymphocytes and macrophages are primarily susceptible to infection by HIV, recent literature suggests that endothelial cells per se may also be permissive to HIV infection via CXCR4 and other receptors, independent of CD4 (25). Indeed, FIV infects endothelia in vitro (26), implying a direct mechanism by which the virus can influence endothelial-dependent rolling.

Interestingly, the basal neutrophil rolling (pre-LPS administration) appeared to be similar in both groups of animals, suggesting that only the up-regulation of selectins during the inflammatory response was affected by FIV. The basal rolling cells are thought to be surveying the blood vessel environment, and so the surveillance is not impaired in lentivirus-infected animals, but the ability to subsequently respond to an infection is altered.

Although it is well established that a reduction in rolling can affect adhesion and emigration, our data would suggest impaired neutrophil function beyond rolling. For example, there was a clear impairment in neutrophil chemotaxis in vitro (a rolling-independent event), an observation consistent with numerous other in vitro studies using neutrophils from HIV patients (4, 6). In addition, we observed that the basal rolling was not impaired, and previously we observed that basal rolling was sufficient to support subsequent adhesion and emigration in other models of inflammation (16). The fact that neutrophil adhesion and emigration were reduced in the face of sufficient rolling would support the view that events downstream of rolling were impaired in lentivirus-infected animals following challenge with bacterial products such as LPS. In the neutrophil recruitment paradigm, the process of adhesion and emigration requires a series of events, including activation of G protein-coupled chemotactic receptors on neutrophils, that signal to increase both affinity and avidity of the {beta}2 integrin (CD11/CD18), causing firm adhesion of the rolling granulocytes. Our present in vitro data suggest that there was a key impairment in the ability of the neutrophils to respond to chemotactic agents, suggesting that neutrophil function in vivo was impaired. Taken together, our in vivo demonstration of impaired neutrophil recruitment combined with in vitro studies that suggest reduced chemotaxis (4, 6) and impaired fungal and bacterial killing (4, 5) certainly support the view that there is neutrophil impairment in HIV.

Whether the neutrophil dysfunction is related to reduced T cell numbers remain unclear, but it is well appreciated that GM-CSF, a major regulator of neutrophil function, is primarily produced by T cells, and as CD4+ T cells are depleted, levels of GM-CSF decline (27). Whether this impairs neutrophil functions remains uncertain, but addition of GM-CSF to HIV patients, improved clinical outcomes, consistent with the view that decline of the adaptive immune system is associated with dysregulation of the innate immune system (28). Treatment with antiretroviral inhibitors directed against the viral protease improved both CD4+ T cell counts and neutrophil function (29). Although in our study the impaired neutrophil response was associated with increasing immunosuppression, the effect on the innate immune response (90% decrease in adhesion, emigration, and chemotaxis) was disproportionately greater than the impairment of the acquired immune response (50% decrease in the numbers of CD4+ lymphocytes), raising the possibility that other mechanisms may also underline the very severe neutrophil impairment.

The current in vivo data provide credence to the existing in vitro data that there is an impairment in neutrophil biology in lentivirus-infected humans and animals. In fact, our work highlights a significant impairment in the ability of neutrophils to be recruited to sites of infection. The impairment includes selectin-dependent rolling and integrin-dependent adhesion and emigration that were consistent with impaired neutrophil migration in an in vitro chemotaxis assay. This study provides further rationale for the use of adjunct immunotherapies in HIV infection that enhance neutrophil function.


    Acknowledgments
 
We thank Julie Ethier, Megan Patrick, and Claudia Silva for technical assistance.


    Footnotes
 
1 This work was supported by a Canadian Institutes of Health group grant and Canadian Foundation for AIDS Research. P.K. is an Alberta Heritage Foundation for Medical Research Senior Scientist and Canadian Research Chair. G.V.M. is a Canadian Institutes of Health/Alberta Heritage Foundation for Medical Research Fellow. J.B.J. is an Robarts Research Institute Fellow. C.P. is a Alberta Heritage Foundation for Medical Research Scholar/Canadian Institutes of Health Investigator. Back

2 Address correspondence and reprint requests to Dr. Paul Kubes, Department of Physiology and Biophysics, University of Calgary Health Sciences Center, 3330 Hospital Drive NW, Calgary, Alberta, Canada T2N 4N1. E-mail address: pkubes{at}ucalgary.ca Back

3 Abbreviations used in this paper: FIV, feline immunodeficiency virus; PI, postinfection; SMA, superior mesenteric artery; VRBC, RBC velocity. Back

Received for publication February 3, 2003. Accepted for publication August 25, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Overbaugh, J., P. A. Luciw, E. A. Hoover. 1997. Models for AIDS pathogenesis: simian immunodeficiency virus, simian-human immunodeficiency virus and feline immunodeficiency virus infections. AIDS 1:(Suppl. A):S47.
  2. Hartmann, K.. 1998. Feline immunodeficiency virus infection: an overview. Vet. J. 155:123.[Medline]
  3. Meddows-Taylor, S., D. J. Martin, C. T. Tiemessen. 1999. Impaired interleukin-8-induced degranulation of polymorphonuclear neutrophils from human immunodeficiency virus type 1-infected individuals. Clin. Diagn. Lab. Immunol. 6:345.[Abstract/Free Full Text]
  4. Mastroianni, C. M., G. D’Ettorre, G. Forcina, M. Lichtner, F. Mengoni, C. D’Agostino, A. Corpolongo, A. P. Massetti, V. Vullo. 2000. Interleukin-15 enhances neutrophil functional activity in patients with human immunodeficiency virus infection. Blood 96:1979.[Abstract/Free Full Text]
  5. Schaumann, R., J. Krosing, P. M. Shah. 1998. Phagocytosis of Escherichia coli and Staphylococcus aureus by neutrophils of human immunodeficiency virus-infected patients. Eur. J. Med. Res. 3:546.[Medline]
  6. Meddows-Taylor, S., D. J. Martin, C. T. Tiemessen. 1998. Reduced expression of interleukin-8 receptors A and B on polymorphonuclear neutrophils from persons with human immunodeficiency virus type 1 disease and pulmonary tuberculosis. J. Infect. Dis. 177:921.[Medline]
  7. Springer, T. A.. 1995. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57:827.[Medline]
  8. Kubes, P.. 2002. Introduction: the complexities of leukocyte recruitment. Semin. Immunol. 14:65.[Medline]
  9. Kubes, P., S. M. Kerfoot. 2001. Leukocyte recruitment in the microcirculation: the rolling paradigm revisited. News Physiol. Sci. 16:76.[Abstract/Free Full Text]
  10. Kansas, G. S.. 1996. Selectins and their ligands: current concepts and controversies. Blood 88:3259.[Free Full Text]
  11. Bevilacqua, M. P., R. M. Nelson. 1993. Selectins. J. Clin. Invest. 91:379.
  12. Campbell, J. J., J. Hedrick, A. Zlotnik, M. A. Siani, D. A. Thompson, E. C. Butcher. 1998. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 279:381.[Abstract/Free Full Text]
  13. Smith, C. W., R. Rothlein, B. J. Hughes, M. M. Mariscalco, H. E. Rudloff, F. C. Schmalstieg, D. C. Anderson. 1988. Recognition of an endothelial determinant for CD18-dependent human neutrophil adherence and transendothelial migration. J. Clin. Invest. 82:1746.
  14. Power, C., R. Buist, J. B. Johnston, M. R. Del Bigio, W. Ni, M. R. Dawood, J. Peeling. 1998. Neurovirulence in feline immunodeficiency virus-infected neonatal cats is viral strain specific and dependent on systemic immune suppression. J. Virol. 72:9109.[Abstract/Free Full Text]
  15. Johnston, J. B., Y. Jiang, G. van Marle, M. B. Mayne, W. Ni, J. Holden, J. C. McArthur, C. Power. 2000. Lentivirus infection in the brain induces matrix metalloproteinase expression: role of envelope diversity. J. Virol. 74:7211.[Abstract/Free Full Text]
  16. Kubes, P., M. Jutila, D. Payne. 1995. Therapeutic potential of inhibiting leukocyte rolling in ischemia/reperfusion. J. Clin. Invest. 95:2510.
  17. Ostrovsky, L., R. C. Woodman, D. Payne, D. Teoh, P. Kubes. 1997. Antithrombin III prevents and rapidly reverses leukocyte recruitment in ischemia/reperfusion. Circulation 96:2302.[Abstract/Free Full Text]
  18. House, S. D., H. H. Lipowsky. 1987. Leukocyte-endothelium adhesion: microhemodynamics in mesentery of the cat. Microvasc. Res. 34:363.[Medline]
  19. Woodman, R. C., D. Teoh, D. Payne, P. Kubes. 2000. Thrombin and leukocyte recruitment in endotoxemia. Am. J. Physiol. 279:H1338.
  20. Johnston, B., U. M. Walter, A. C. Issekutz, T. B. Issekutz, D. C. Anderson, P. Kubes. 1997. Differential roles of selectins and the a4-integrin in acute, subacute, and chronic leukocyte recruitment in vivo. J. Immunol. 159:4514.[Abstract]
  21. Heit, B., P. Kubes. 2003. Measuring chemotaxis and chemokinesis: the under-agarose cell migration assay. Sci. STKE. 2003:L5.
  22. Foxman, E. F., J. J. Campbell, E. C. Butcher. 1997. Multistep navigation and the combinatorial control of leukocyte chemotaxis. J. Cell Biol. 139:1349.[Abstract/Free Full Text]
  23. Heit, B., S. Tavener, E. Raharjo, P. Kubes. 2002. An intracellular signaling hierarchy determines direction of migration in opposing chemotactic gradients. J. Cell Biol. 159:91.[Abstract/Free Full Text]
  24. Levy, J. A.. 1998. HIV and the Pathogenesis of AIDS 259. American Society for Microbiology, Washington, DC.
  25. Mukhtar, M., S. Harley, P. Chen, M. BouHamdan, C. Patel, E. Acheampong, R. J. Pomerantz. 2002. Primary isolated human brain microvascular endothelial cells express diverse HIV/SIV-associated chemokine coreceptors and DC-SIGN and L-SIGN. Virology 297:78.[Medline]
  26. Steffan, A. M., M. E. Lafon, J. L. Gendrault, B. Smedsrod, H. Nonnenmacher, F. Koehren, J. P. Gut, M. de Monte, J. P. Martin, C. Royer, et al 1996. Productive infection of primary cultures of endothelial cells from the cat liver sinusoid with the feline immunodeficiency virus. Hepatology 23:964.[Medline]
  27. Hober, D., F. Ajana, M. C. Petit, C. Sartiaux, M. Boniface, M. Caillaux, Y. Mouton, P. Wattre, M. Maniez-Montreuil. 1993. Granulocyte-macrophage colony-stimulating factor and tumor necrosis factor alpha in patients with human immunodeficiency virus (HIV) type 1 infection. Microbiol. Immunol. 37:785.[Medline]
  28. Angel, J. B., K. High, F. Rhame, D. Brand, J. B. Whitmore, J. M. Agosti, M. J. Gilbert, S. Deresinski. 2000. Phase III study of granulocyte-macrophage colony-stimulating factor in advanced HIV disease: effect on infections, CD4 cell counts and HIV suppression. Leukine/HIV Study Group. AIDS 14:387.[Medline]
  29. Mastroianni, C. M., F. Mengoni, M. Lichtner, C. D’Agostino, G. D’Ettorre, G. Forcina, M. Marzi, G. Russo, A. P. Massetti, V. Vullo. 2000. Ex vivo and in vitro effect of human immunodeficiency virus protease inhibitors on neutrophil apoptosis. J. Infect. Dis. 182:1536.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. Elbim, V. Monceaux, Y. M. Mueller, M. G. Lewis, S. Francois, O. Diop, K. Akarid, B. Hurtrel, M.-A. Gougerot-Pocidalo, Y. Levy, et al.
Early Divergence in Neutrophil Apoptosis between Pathogenic and Nonpathogenic Simian Immunodeficiency Virus Infections of Nonhuman Primates
J. Immunol., December 15, 2008; 181(12): 8613 - 8623.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Andruski, D.-M. McCafferty, T. Ignacy, B. Millen, and J. J. McDougall
Leukocyte trafficking and pain behavioral responses to a hydrogen sulfide donor in acute monoarthritis
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R814 - R820.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Heit, G. Jones, D. Knight, J. M. Antony, M. J. Gill, C. Brown, C. Power, and P. Kubes
HIV and Other Lentiviral Infections Cause Defects in Neutrophil Chemotaxis, Recruitment, and Cell Structure: Immunorestorative Effects of Granulocyte-Macrophage Colony-Stimulating Factor
J. Immunol., November 1, 2006; 177(9): 6405 - 6414.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kubes, P.
Right arrow Articles by Power, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kubes, P.
Right arrow Articles by Power, C.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS