The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martin, D. A.
Right arrow Articles by Wu, G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, D. A.
Right arrow Articles by Wu, G. E.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*(L)-HISTIDINE
The Journal of Immunology, 2003, 171: 4663-4671.
Copyright © 2003 by The American Association of Immunologists

Selection of Ig µ Heavy Chains by Complementarity-Determining Region 3 Length and Amino Acid Composition1

Denise A. Martin*, Harald Bradl{dagger}, Tara J. Collins*, Edith Roth{dagger}, Hans-Martin Jäck2,{dagger} and Gillian E. Wu*,{ddagger}

* Department of Immunology, University of Toronto, and Ontario Cancer Institute, Toronto, Canada; {dagger} Division of Molecular Immunology, Department of Internal Medicine III, Nikolaus Fiebiger Center, University of Erlangen-Nürnberg, Erlangen, Germany; and {ddagger} Faculty of Pure and Applied Science, York University, Toronto, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although it is generally accepted that Ig heavy chains (HC) are selected at the pre-B cell receptor (pre-BCR) checkpoint, the characteristics of a functional HC and the role of pre-BCR assembly in their selection have remained elusive. We determined the characteristics of HCs that successfully passed the pre-BCR checkpoint by examining transcripts harboring VH81X and JH4 gene segments from JH+/- and {lambda}5-/-mice. VH81X-JH4-HC transcripts isolated from cells before or in the absence of pre-BCR assembly had no distinguishing complementarity-determining region 3 traits. In contrast, transcripts isolated subsequent to passage through the pre-BCR checkpoint had distinctive complementarity-determining regions 3 of nine amino acids in length (49%) and a histidine at position 1 (73%). Hence, our data define specific structural requirements for a functional HC, which is instrumental in shaping the diverse B cell repertoire.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Blymphocyte development follows a complex series of events and decisions in which genetics, environmental, and stochastic processes all play a role in the outcome. Integral to the survival of a developing B cell is the productive rearrangement of the VH, D, and JH, and VL and JL gene segments of Ig heavy chain (HC)3 and light chain (LC) loci, respectively (1, 2). The joining of VH, DH, and JH gene segments generates the variable domain of a HC with its complementarity-determining region 3 (CDR3) encompassing the sites of the joins. Formation of a µHC demarcates a crucial checkpoint in B cell development. At this checkpoint, called the pre-B cell receptor (pre-BCR) stage, the µHC and the surrogate LC (SLC) components, VpreB and {lambda}5, assemble to form the pre-BCR. The µHC, if capable of pairing with the SLC, appears on the surface of the B cell, where much evidence implicates the successful formation of a pre-BCR in signaling events and the proliferative expansion associated with B cell progression (3, 4, 5). The ability or inability of a particular µHC to pair with SLC as well as the competence of that interaction determines whether a µHC protein and ultimately a B cell are selected to proliferate and survive/persist into the mature pool (4, 6, 7, 8).

The importance of µHC deposition and the SLC in B cell progression has been demonstrated in various murine models with targeted deletions. Mice with a deletion in the transmembrane exon of the µHC are unable to produce cells that progress beyond the pro-B cell stage of development (9). Mice that cannot make a complete SLC due to the absence of {lambda}5 protein also have a block in generating mature B cells, with most cells arrested at the pro-B stage (10).

Evidence is accumulating that the µHC is assessed for its ability to functionally associate with a LC before LC rearrangement, with the SLC functioning as the assessor (8, 11, 12). The presence of the SLC before LC rearrangement as well as its structural similarity to a conventional Ig LC make it an ideal candidate for this function. If a cell has passed the fitness test overseen by the pre-BCR, placement of a successful HC-LC pair in the plasma membrane provides the B cell with a receptor necessary for survival and persistence in the periphery (13). The features in the µHC protein important for successful LC pairing, however, remain to be determined.

Some evidence suggests that the V-D-J joint that encodes CDR3 can impact HC folding and the ability to form HC-LC heterodimers (6). In particular, rearrangements using the most D-proximal V gene segment, VH81X, have been found to generate HC proteins largely incapable of pairing with SLC (8). Evidence that impaired pairing has in vivo consequences comes from the finding that VH81X is under-represented in productive rearrangements (7, 12, 14, 15). In addition, few mature cells have been found with VH81X-containing BCRs, despite its presence in >50% of the initial HC rearrangements in the bone marrow (11, 12, 14, 16, 17).

A diverse repertoire is paramount for immunocompetency. Thus, it is crucial to understand the mechanisms restricting selection while ensuring an effective, functional repertoire. We have used a system that allows us to track VH81X rearrangements through stages of B cell development to identify the structure and type of rearrangements that persist in the periphery. By breeding, we have generated a mouse that carries one wild-type Ig HC allele and one allele with a targeted deletion at the JH locus. This arrangement allows each B cell to make only one productive VDJH rearrangement, ensuring that we are monitoring the gene structure of only the used HC in various B cell compartments. By isolating productive rearrangements using VH81X and JH4 gene segments and determining their potential to associate with SLC and be expressed on the cell surface, we were able to determine which specific variable region structures, differing only at the CDR3, render an HC successful.

These studies have revealed two characteristics common to successful HCs using VH81X and JH4 gene segments: a CDR3 length of nine amino acids and the presence of histidine in position 1. These traits have significant roles in determining which VH81X µHCs are selected into the peripheral pool. Other parameters, including isoelectric point (pI) and motifs, were not found to contribute substantially to HC selection. These data suggest a level of selection before µHC deposition in the plasma membrane, followed by further selection subsequent to cell surface expression. Our model implicates SLC in this paradigm, functioning to select protein by shape and fit before surface expression and signaling efficiency.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

JH-/- and {lambda}5-/- mice have been previously described (10, 18). JH-/-, {lambda}5-/-, and C57BL/6 mice were maintained under specific pathogen-free conditions in the animal colony at the Ontario Cancer Institute. JH+/- mice were generated by breeding C57BL/6 and JH-/- mice. JH+/- mice were identified by Southern blot analysis as previously described (18). Briefly, genomic DNA from mouse tails was digested with StuI, electrophoresed, and transferred to Hybond nylon membranes (Amersham Pharmacia Biotech, Little Chalfont, U.K.). Membranes were hybridized with a 475-bp EcoRI-StuI fragment of Eµ, which reveals a band of 4.7 kb for the wild-type allele and of 3.0 kb for the mutant allele. Mice identified by Southern analysis as having one mutant allele and one wild-type allele were used for further analysis.

Flow cytometry and cell sorting

Single-cell suspensions were prepared from bone marrow (BM) and spleen of the appropriate mice and were stained using standard procedures. BM cells were stained with FITC-conjugated anti-B220 (mAb RA3-6B2; BD PharMingen, San Diego, CA), PE-conjugated anti-CD43 (mAb S7; BD PharMingen), and biotinylated anti-µ IgH (mAb 33-60). Splenocytes were stained with FITC-conjugated anti-IgD (mAb 11-26c.2a; BD PharMingen), PE-conjugated anti-B220 (mAb RA3-6B2; BD PharMingen), and biotinylated anti-µ IgH (mAb 33-60). Staining with biotinylated Abs was revealed with the secondary reagent streptavidin Quantum Red (Sigma-Aldrich, St. Louis, MO). All collected cells were B220+. To isolate B cell precursors, BM populations were defined by the cell surface markers CD43 and µ; collected cells were CD43+µ- or CD43-µ-. To isolate newly emerging B cells, spleen populations were defined by cell surface expression of IgM and IgD; collected cells were IgM+IgDlow/-. Cells were sorted using FACStar Plus (BD Biosciences, Mountain View, CA) and MoFlo (Cytomation, Fort Collins, CO) instrumentation. Abelson murine leukemia virus (A-MuLV)-transformed pre-B cell lines, before (membrane staining) or after (cytoplasmic staining) fixation and permeabilization with formaldehyde/Tween 20, were stained using standard staining protocols (6). Unconjugated Abs were detected with the appropriate fluorochrome-conjugated secondary Abs. Cells were washed, and fluorescence was analyzed with a FACSCalibur (BD Biosciences). Flow diagrams were obtained by analyzing the primary data with the CellQuest software program (BD Biosciences). Rat IgG mAbs directed against the pre-BCR (clone SL156) (19) and the hamster anti-mouse {lambda}5 mAb, FS1 (20), have been previously described (21). FITC-conjugated as well as unconjugated affinity-purified goat Abs against mouse µHC were purchased from Southern Biotechnology Associates (Birmingham, AL).

RNA isolation, amplification, and sequencing

Total RNA was extracted from sorted cells using Tri-Reagent (Molecular Research Center, Cincinnati, OH). RNA was reverse transcribed using Superscript II (Life Technologies, Gaithersburg, MD), and the cDNA was used for RT-PCR. The primary PCR globally amplified >80% of VH gene rearrangements; the secondary PCR specifically amplified transcripts harboring the VH81X gene segment. cDNA was amplified for the primary PCR using VHALL sense 5'-AGGT(C/G)(A/C)A(A/G)CTGCAG(C/G)AGTC(A/T)GG-3' and JH4IN antisense 5'-GAGGAGACGGTGACTGAGGTTCCTTG-3', followed by a secondary PCR reaction using either V81X145 sense 5'-TGGTCGCAGCCATTCATAGT-3' or V81XEcoRI sense 5'-GAATTCCCTTCCCATGACATGTCTTG-3' and the JH4IN antisense primer. RT-PCR products were identified by resolution on a 1.0% agarose gel and fragments of expected length were ligated into TA cloning vectors (Invitrogen, Carlsbad, CA). Plasmid clones were sequenced with the T7 sequencing kit (Amersham Pharmacia Biotech). IgH CDR3 regions were identified as the amino acids between codon 94 and codon 102 (22). Codon 94 is the second amino acid residue following the conserved YYC motif coded by the VH gene segment (usually an arginine residue), and codon 102 is the conserved tryptophan encoded by the JH gene segment.

Retroviral vector construction for expression of VH81X gene rearrangements

The retroviral vector pELV81Cµ (Fig. 1A) was generated from pELVC (a gift from F. Melchers, Basel, Switzerland) (4). pELVC contains the leader (L) exon/intron sequence of the Sp6 µ gene (23) and a functional VDJH sequence fused to the cDNA sequence encoding the membrane form of µHC. The rearranged VH81X segments were isolated from a number of sources and inserted into pELV81. One set of VH81X sequences originated from genomic VH81XDJ clones reported previously (24). TdT refers to clones isolated from the BM of an adult transgenic TdT mouse (25), and MTFL and MTBM refer to clones isolated from fetal liver and adult BM, respectively, of a µMT mouse (9). Genomic VH81XDJ sequences were converted into cDNA-type sequences (the JH abutting the Cµ) by the following PCR cloning strategy. The forward primer was GAATTCCCTTCCCATGACATGTCTTG (containing an EcoRI site that is present in all VH81X sequences; Fig. 1A), and the backward primer is G A A G C T T T G A C T C T C T G A G G A G A C G G T G A C T G A G G T T C C T T G (containing HindIII, Cµ, and JH4 sequences; Fig. 1A). The amplified products were TA cloned, and EcoRI/HindIII VH81X fragments were isolated and inserted in the corresponding restriction sites of pELV81Cµ. TdT4-pELV81Cµ, MTFL8-pELV81Cµ, MTFL4-pELV81Cµ, TdT1-pELV81Cµ, MTBM4-pELV81Cµ, and MTBM27-pELV81Cµ were constructed in this manner. Plasmid expression vectors encoding BC2-V81X-Cµ and 31A-V81X-Cµ were gifts from J. Kearney (Birmingham, AL). F-V81X was cloned from the 18-81 subclone F, an A-MuLV pre-B cell line, and inserted into a conventional Ig expression vector (6). All VDJH regions were verified by complete sequencing.



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 1. Analysis of surface expression and assembly of VH81X-µHCs with SLC. A, The retroviral vector pELV81Cµ was generated from pELVC by replacing its SalI/HindIII VHDJH fragment with a corresponding fragment of a VH81XDJH1 rearrangement cloned from the BC2 hybridoma (see Materials and Methods). Part of the VH81XDJH sequence can be excised with EcoRI and HindIII and replaced with a corresponding sequence of another VH81XDJH fragment. bla, gene encoding {beta}-lactamase; ori, origin of replication of pBR322; pac, gene encoding puromycin N-acetyltransferase. B, Flow cytometric analyses of µHC synthesis in stably infected 38B9 pre-B cell clones. Cells were stained with FITC-conjugated Abs against mouse µHC before (membrane) or after (cytoplasmic (cyto)) cell permeabilization. Fluorescence intensities (F) of cytoplasmic (cyto) and cell surface (membrane) stainings are shown on the y-axis, and cell size (forward scatter) is shown on the x-axis. C, Electrophoretic analysis of µHC and SLC assembly in stably infected 38B9 pre-B cell clones. Cells were metabolically labeled with [35S]methionine, and labeled proteins were precipitated from pre-B cell lysates with Abs against mouse µHC (µ) or {lambda}5, followed by protein G-Sepharose. Radioactive bands were revealed by fluorography. Molecular masses of protein standards are shown in kilodaltons on the left, and the positions of VpreB, {lambda}5, and µHC are shown on the right of the blot.

 
Retroviral infection of the A-MuLV-transformed pre-B cell lines 38B9 and BINE4.8

The ectopic packaging line GP+E (26), grown to 80–90% confluence in 25-cm2 flasks, was first transfected with 5 µg of the respective retroviral plasmid vector with the calcium phosphate method using the Cal-Phos-Maximizer kit (Clontech, Palo Alto, CA) for 2 h at 37°C. After infection, the medium was removed, and the cells were washed with PBS and incubated in RPMI/10% heat-inactivated FCS at 37°C and 5% CO2. After 24 h the medium was replaced with 5 x 106 pre-B cells (BINE 4.8 or 328B9) in 5 ml of RPMI/10% heat-inactivated FCS supplemented with 40 µg of polybrene (Sigma-Aldrich). The culture was incubated for 24 h and then supplemented with 5 µg/ml puromycin. Single clones were generated from puromycin-resistant bulk cultures by the limiting dilution method and were analyzed for µHC production by flow cytometry.

Cell lines and culture conditions

The ectopic retroviral packaging line GP+E (26) and the A-MuLV-transformed mouse pre-B cell lines Bine4.8, TK, TKµ (27), and 38B9 (2, 4) were maintained at 37°C and 5% CO2 in RPMI medium supplemented with 50 U/ml penicillin, 50 µg/ml streptomycin, 5% FCS, 1 mM sodium pyruvate, and 2 mM L-glutamine. Bine4.8, TK, and 38B9 produce {lambda}5 and VpreB proteins, but lack a µHC; TKµ produces a completely assembled pre-BCR and served as a positive control for µHC/SLC pairing.

Immunoprecipitation and gel electrophoresis

Metabolic labeling was performed as previously described (8). Briefly, 5 x 106 of retrovirus-infected TK, TKµ, or 38B9 cells in 1 ml of methionine-free labeling medium were incubated overnight with 50 µCi/ml of Tran35S label (ICN Biomedicals, Eschwege, Germany). Cells were lysed for 30 min on ice in 1 ml of lysis buffer. Cell lysates were incubated with either 5 µg of affinity-purified goat anti-mouse µHC Abs (Jackson ImmunoResearch Laboratories, West Grove, PA) or FS1 mAb (anti-{lambda}5) for 3 h on ice. Immunocomplexes were precipitated by protein G-Sepharose (Pierce, Rockford, IL) for 2 h on ice, separated on a 10% SDS-Laemmli polyacrylamide gel, and detected by fluorography.

Modeling of IgH V regions

Virtually translated V regions of HCs were modeled using the SWISS-MODEL Protein Modeling Server (http://www.expasy.ch/swissmod/SWISS-MODEL.html). To analyze the structure of any VH region, the VH regions of the VH81X-HCs, TdT4-pELV81Cµ, V81XBC2-pELV81Cµ, and V81X31A-pELV81Cµ, all of which could form a pre-BCR in the A-MuLV line, 38B9 (see Results), were compared with all protein structures in the SWISS-PROT database. Protein 31AR1, a single HC Fv, had the most sequence similarity (~72% amino acid identity overall, including a structurally important cysteine) and was listed in each search. Protein 31AR1 was used as the template for the tested µHCs (Table I). The data received were converted and viewed using SWISS PDB viewer (28, 29). The theoretical models were then assembled identically and displayed together. The pI of the modeled VH81X-HC was calculated using Compute pI/Mw, a tool, which allows computation of the theoretical pI and Mw (http://www.expasy.ch/tools/pi_tool.html and (30, 31).


View this table:
[in this window]
[in a new window]
 
Table I. VH81X-µHCs and their potential to pair with SLC and to be transported to the cell surface.

 
Statistics

Statistics were performed by the Statistics Department at University of Toronto. Values were calculated using sampling distributions for counts and proportions. Significance was calculated under the null hypothesis of no difference in the proportion of occurrence of CDR3 lengths equal to 27 nt between the two populations or the null hypothesis of no difference in the proportion of occurrence of amino acid histidine at position 1 between the two populations.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The elements that dictate the configuration of biological systems remain important issues in understanding the development of the mature immune system. In any developing system, identifiable characteristics of a population may reflect the outcome of stochastic or selective mechanisms. In this study we sought to identify specific characteristics of µHC from splenic B cells and determine whether these characteristics would yield insights into the structural requirements of Ig HCs. These HCs exhibit representative traits that allowed the cell to passage through selection and persist in the spleen. We addressed these issues using a mouse with a single rearrangeable IgH allele that would allow us to compare HCs that passed the pre-BCR checkpoint and persisted in the periphery to those present before selection in the BM. These experiments were followed up with analysis of functional Ig rearrangements isolated from peripheral B cells of {lambda}5-/- mice, to examine the properties of HCs that persist in the absence of SLC. We then used an A-MuLV-transformed pre-B cell line that lacked its own HC (but had SLC protein) to assess by flow cytometry and immunoprecipitation the ability of µHCs to associate with the SLC and appear on the cell surface. The availability of modeling programs allowed us then to determine the characteristics of a functional, i.e., pairing, µHC that passes the pre-BCR checkpoint and persists in the periphery.

VH81X HC rearrangements in BM and spleen

Mice heterozygous for a deletion of the JH gene segments are only able to generate one productively rearranged allele per cell. In all other respects examined, the B cell populations isolated from spleen and BM were comparable to B cell compartments found in wild-type animals (18). We examined the expressed µHC allele first in cells from whole BM and spleen as described in Materials and Methods (15). For each reaction, 2–4% of the product was cloned, sequenced, and evaluated. Using the guidelines of Kabat and Wu (22), translated sequences were anchored at the conserved YYC (tyrosine-tyrosine-cysteine) encoded by the VH gene segment. DH segments were identified by sequence homology according to published sequences (32, 33, 34), but only if sequence identity could be demonstrated for 5 consecutive nt. CDR3 lengths were measured from the amino acids commencing at the third residue from the YYC motif and ending at (but not including) the conserved W (tryptophan) encoded by the JH gene segment.

The VH81X rearrangements, including DH usage, isolated from unsorted BM were for the most part unremarkable. Their CDR3 lengths ranged from 6–12 aa in length, with length values distributed without any significant bias (data not shown). The rearrangements in unsorted splenocytes were similar to those from whole BM, except that CDR3 had a length bias toward 9 aa (data not shown).

BM and spleen are heterogeneous populations containing B cells at multiple stages of B cell development. To examine µHC in the early stages of and subsequent to pre-BCR expression, it was necessary to isolate populations at specific stages. For the BM populations, we focused on the B220+CD43+surface µ- cells (pro-B cells), and the large B220+CD43- surface µ- cells, (transitional, early pre-B cells) as cells before and during pre-BCR selection, respectively. For the spleen populations, we isolated the B220+IgMhighIgDlow/- cells (newly emerging, immature B cells) as cells after pre-BCR selection. Fig. 2A shows typical profiles of the presorted populations. Four independent experiments, with one or two mice per group, generated the results presented. For each group at least 2 x 106 cells were sampled. Sorted populations were consistently >98% pure (Fig. 2B).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Flow cytometric sorting of B lymphoid populations from spleen and bone marrow. Flow cytometric profiles of presort (A) and postsort (B) BM and spleen (Spl) populations are depicted. A, BM suspensions (upper panels) were triple-stained with fluorochrome-conjugated Abs against surface B220, surface CD43, and surface µHC. Cells were gated for surface µHC-negative cells (a), and B220+/CD43+ as well as CD43- cells were sorted from the surface µHC-negative population (see sorting gate in b). Spleen cell suspensions (Spl; lower panels) were triple-stained with Abs against surface B220, IgM, and IgD. Cells were gated for B220-positive cells (c), and IgMhigh/IgDlow/- cells were sorted (see sorting gate in d). B, Staining profiles of representative populations isolated from BM of JH+/- mice (a and b) and from spleens of JH+/- (c) and {lambda}5-/- (d) mice. Collected populations were used to isolate Ig VDJ rearrangements for subsequent sequencing of CDR3 regions. The staining profiles are representative of four independent experiments. Sort purity was consistently >98%.

 
CDR3 length in B cell developmental compartments

The sorted population of cells from the BM before pre-BCR expression (B220+, CD43+/-, surface µ-) had µHC rearrangements exhibiting random DH gene segment usage and variable junctional sequences (n = 39; Fig. 3A). CDR3 lengths ranged from 5–15 aa in length: 5% of clones had regions 5 aa long, 2.5% of clones had regions 8 and 15 aa long, 23% were 9 and 10 aa long, 28% were 11 aa long, and ~8% were 12 and 13 aa long (Fig. 3A). Statistically, there was no significant bias toward any one particular CDR3 length. These data are consistent with our observations in total BM samples.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 3. CDR3 length distribution in VH81X-bearing VDJ rearrangements from sorted B cell populations. Transcripts isolated from JH+/- or {lambda}5-/- mice were translated as depicted at the top of the figure. CDR3 boundaries were identified as outlined by Kabat and Wu (22 ). Charts at the bottom summarize the distribution of Ig HC CDR3 lengths from the sequences described above. Distinct rearrangements were scored as individual clones. A, CDR3 length distribution in VH81X-bearing VDJ rearrangements from sorted B220+CD43+/-surface µ- BM of JH+/- mice. B, CDR3 length distribution in VH81X-bearing VDJ rearrangements from sorted B220+IgMhighIgDlow/- spleen cells of JH+/- mice. C, CDR3 length distribution in VH81X-bearing VDJ rearrangements from sorted B220+IgMhighIgDlow/- spleen cells of {lambda}5-/- mice. The pattern of CDR3 lengths in {lambda}5-/- splenocytes contrasts with the distribution seen in the spleen compartment of JH+/- mice, where most CDR3 lengths in the higher range are eliminated, and CDR3s 9 aa long clearly dominate the profile.

 
The splenic B220+IgMhighIgDlow/- B cell population represents cells that have survived selection in the BM and persisted in the periphery. In 37 clones analyzed from the JH heterozygous mouse, DH gene segment usage was random and comparable to VH81X rearrangements in the BM compartments (Fig. 3B), since DH gene segments from all families were represented in both populations, and over-representation or the absence of specific DH gene segments was not evident. In addition, there were no significant differences in hydrophobicity values between the populations before (average hydrophobicity, 0.82 ± 0.8) and after (average hydrophobicity, 1.08 ± 1.19) pre-BCR selection. The CDR3 length profiles were, however, distinct (Fig. 3B). There was a predominance of CDR3 regions 9 aa in length. Approximately 49% of rearrangements in this immature B cell population encode a CDR3 of 9 aa. Other CDR3 lengths isolated from this population were never >14% of the total. The occurrence of CDR3 lengths of 9 aa in the newly emerging splenic B cell compartment is significantly different from those in B220+, CD43+/-, surface µ- pro-B, and early pre-B cells in the BM (p < 0.02).

Histidine in the first position in CDR3

The CDR3 of a VDJH gene rearrangement is the only region encoded by all three gene segments. This circumstance allows for immense diversity due to combinatorial joining and end processing. Despite this extensive variability, examination of the amino acid sequences of CDR3 allowed us to identify constraints on the CDR3 structure imposed by the developmental selection process.

The 3' end of the VH81X gene segment has nucleotides CA in its germline configuration. In the absence of processing of the VH gene during V to DJH joining, these nucleotides will encode histidine or glutamine at the first position of the CDR3. Processing, theoretically, could introduce any amino acid. The earliest compartment analyzed, corresponding to the pro-B and pre-B cell compartments, appears to have no bias for any particular junctional sequence or encoded residue (Fig. 4A). Position 1 of these CDR3s encoded a range of amino acids varying in charge and polarity; 36% were histidine. The more mature population, however, exhibited an increasing propensity to encode histidine in CDR3 position 1 (Fig. 4B). Seventy-three percent of the HCs from cells of the selected, newly emerging splenic B cell population, had histidine at position 1. The predominance of histidine at this position is a clear bias that was not evident in the pro- and pre-B cell population (p < 0.0012). Glutamine, encoded by CAG and CAA, is not found at equal frequency, as it would be if there were no preference for CAC or CAT (both encode histidine). The presence of histidine with a pI of 6.0 is interesting because it is unusual. CDR3 regions of VH regions rarely have charged amino acids and are generally neutral or slightly hydrophilic (35, 36). Potentially, histidine is selected for its association with SLC. This convergence of the types of junctions that are preferred for the peripheral pool inevitably limits the VH81X-expressing clones that will survive and may play a role in the reduced number of mature B cells that use the VH81X gene segment. While the majority of sequences isolated from cells that have traversed the pre-BCR checkpoint code for a histidine at position 1 of the CDR3, a small number of isolates do not conform to this strategy. However, hydrophobicity, pI, and CDR3 analyses of His-less VH81X-µHCs that have successfully traversed the pre-BCR checkpoint did not reveal any distinguishing characteristics of these HCs.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 4. Amino acid usage in CDR3 regions of individual VH81X rearrangements. Graphs show the percentage of clones that encode histidine (His) at position 1 of the CDR3 compared with the percentage of clones that encode an alternate amino acid (X) at position 1. A, Histidine usage in B220+CD43+/-µ- BM cells from heterozygous JH mice. B, Histidine usage in B220+µhighIgDlow/- spleen cells from heterozygous JH mice. C, Histidine usage in B220+µhighIgDlow/- spleen cells from {lambda}5-deficient mice.

 
CDR3 characteristics in the absence of pre-BCR assembly

B220+IgMhighIgDlow/- B cells were isolated from the spleens of {lambda}5-/- mice. In the absence of SLC assembly, formation of the pre-BCR is blocked, although immature and mature B cells gradually accumulate in the periphery of {lambda}5-/- animals as the mice age (10, 37). This population potentially represents cells that have undergone premature LC assembly, but certainly represents cells that have not undergone any pre-BCR-mediated selection events. Analysis of 19 distinct clones isolated from {lambda}5-/- mice reveals that DH gene segment usage was random. The clones examined exhibited CDR3 lengths ranging from 5–14 aa in length; 14% of clones had regions 5 aa long, 24% of clones had regions 8 aa long, 28.5% of clones had regions 9 aa long, 5% of clones had regions 10 aa long, 14% of clones had regions 11 aa long, 9.5% of clones had regions 13 aa long, and 5% of clones had regions 14 aa long (Fig. 3C).

The propensity to encode the amino acid histidine in the first position of the CDR3, observed in splenic B cells that possess an intact SLC was not observed in splenic B cells from {lambda}5-deficient animals. The shift of histidine usage, from 36 to 73%, observed upon comparison of early BM and splenic B cell populations in the JH heterozygote does not occur in the absence of {lambda}5. Immature B cells from {lambda}5-/- animals encode histidine at position 1 of the CDR3 in ~32% of clones sequenced (Fig. 4C). This value is comparable to the level of histidine usage measured in JH+/- B cells before selection across the pre-B to immature transition.

Restrictions on pre-BCR assembly and cell surface expression

One requirement for a VH81X rearrangement to appear in the peripheral compartments includes the pairing-fitness of a VH81X-µHC with SLC (8, 27). The repertoire changes that we observed as a cell passes through SLC-dependent and independent compartments suggest a role for both a µHC and the SLC in choosing the structure of the VH regions that are maintained in the peripheral repertoire. To directly test the ability of various VH81X-µHCs to pair with SLC, we first cloned VH81X sequences (see Table I) isolated from primary T cells, A-MuLV pre-B lines, and hybridomas into either retroviral or conventional plasmid expression vectors and tested the pairing capability of VH81X-µHC with the SLC after introducing the Vµ81X-µHC genes either by retroviral transduction (clones TdT-4, MTBM-4, MTFL-8, MTFL-4, and TdT-1 in Fig. 1 and Table I) or electroporation (clones BC2, 31A, F, and BFL23 in Table I) in the µHC-negative A-MuLV pre-B lines 38B9 and Bine4.8 (see Materials and Methods). These VH81X-µHC sequences differed from each other only in the CDR3 region, that is, they used various DH gene segments with different joining sequences. µHC synthesis and association with SLC were evaluated in stably infected or transfected pre-B cell subclones by flow cytometry and immunoprecipitation of metabolically labeled cell lysates. An example of a typical analysis is shown in Fig. 1, B and C; Table I summarizes the findings of all analyzed sequences.

Nine Vµ81X-µHCs expression constructs were tested (see Table I). Although intracellular µHCs could be detected in all stable clones (Fig. 1, B and C, and Table I), three had clear surface expression of µHC, as revealed by Abs against µHC (clone TdT4 in Fig. 1B, and clones BC2 and 31A in Table I), one showed intermediate levels (clone MTBM-4 in Fig. 1B) and five were negative (clones TdT-1, MTFL-4, and MTFL-8 in Fig. 1B and F and BFL23 in Table I). Surface pre-BCR expression was verified with an mAb (SL156) that recognizes an assembled pre-BCR (data not shown). As expected, all four surface transport competent Vµ81X-µHCs coprecipitated with the SLC components VpreB and {lambda}5 (results for TdT-4 and MTBM-4 are shown in Fig. 1C). Interestingly, three of the four Vµ81X-µHCs (TdT-4, BC2, and 31A) that were transported to the cell surface (Fig. 1B and Table I) and coprecipitated with the SLC components VpreB and {lambda}5 (Fig. 1C and Table I) used a CDR3 region consisting of 9 aa (Table I; CDR3 defined as above, according to Kabat’s nomenclature (22)). Consistent with the trend observed in the splenic B cell compartment, all four pairing VH81X-µHCs contained a histidine residue at position 1 of the CDR3 (Table I). One of the four pairing and surface-competent VH81X-µHCs (clone MTBM-4 in Fig. 1, A and B) used a CDR3 with 12 aa (Table I). In contrast to the TdT-4-µHC, the MTBM-4-µHC showed a clearly reduced surface expression despite the fact that intracellular levels of both µHCs were very similar (compare fluorescence intensities for cytoplasmic and membrane staining in Fig. 1B). Therefore, these two VH81-µHC differ in their propensity to be transported to the surface, which might be due to CDR3-mediated differences in binding strength between a µHC and the SLC. However, compared with transport-incompetent VH81X-µHCs, there was no bias in the pI or hydrophobicity values of those VH81X-µHCs that were expressed on the cell surface (summarized in Table I).

Modeling of the CDR3 conformation

To examine whether the structures of VH81X-HCs might reveal a clue as to why some were expressed on the surface of the A-MuLV and some were not, we used the SWISS-MODEL Protein Modeling Server. As described in Materials and Methods, we searched the protein databases for an Ig crystal structure with an amino acid sequence similar to that of VH81X to use as a template for our modeling. A single HC Fv, named in the database Protein 31AR1, was identified as having the most sequence similarity to the VH81X variable domain (~72% identity). We then used protein 31AR1 as the template and modeled on it the 10 VH81X-HCs. The data generated by the modeling program were converted, assembled, and viewed using the SWISS PDB viewer (28, 29). These theoretical models were positioned to align the identical regions (the {beta} strands of the framework regions), while outlining their differences (the CDR3 regions). The results of this structure prediction analysis are presented in Fig. 5. The variable domains of the four molecules that were expressed on the cell surface were essentially superimposable in all regions, including the backbone tracing of the hypervariable loop of CDR3 (shown with R groups in blue). The CDR3 backbone is a simple loop in the single plane, although the R groups of the residues are distinct. On the other hand, the molecules that did not go on the surface have different CDR3 structures (backbone is shown in red). CDR1, CDR2, the framework region, and the C region, as expected by their near identities, are more similar to each other, although not completely superimposable; their positioning is probably influenced by the CDR3 residues. Thus, the four molecules that are expressed on the surface have a superimposable backbone structure despite differences in the sequences of their CDR3 regions.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 5. Protein modeling of VH81X-µHCs. Protein ribbon structures of VH81XDJ-HCs that are expressed on the cell surface with SLC (A) or unable to pair with SLC (B). CDR3 loops are shown at the top left portion of each structure. Solid lines superimposed upon the ribbon structures outline the amino acids that are part of the hypervariable region. Protein modeling was performed with the SWISS-MODEL Protein Modeling Server (SWISS-PROT at http://www.expasy.ch/swissmod/SWISS-MODEL.html).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study reveals specific characteristics in the VH81X µHC that have been allowed to passage through selection and be expressed in splenic B cells. The majority of such HC have CDR3 lengths of 9 aa and a histidine in position 1. A computer-generated model pictures the CDR3 backbone structure as planar.

The paradigm of B cell development in mice and humans is characterized by checkpoints and selection events that ultimately shape the mature repertoire. The structural complexity of the BCR and its various functions necessitates a systematic and rigorous testing of the receptor and its component parts. Many studies have highlighted the importance of the pre-BCR checkpoint (9, 10, 18). This stage, immediately following assembly of the HC gene segments, serves to select cells that have made productive rearrangements, expand clones with suitable receptors on the surface, and regulate the structure of assembled HCs (6, 8, 10, 37). The SLC components, VpreB and {lambda}5, are ideally positioned to play a role in testing and selecting the µHCs that will proceed beyond this checkpoint. Although the crystal structures of the SLC proteins have not yet been elucidated, sequence and modeling have indicated that together they form a LC-like structure (3, 38, 39). An amino terminal portion of the {lambda}5 protein appears to facilitate the proper folding and assembly of the SLC, while forming an Ig domain and a region that will be situated close to the CDR3 of the µHC upon displacement of BiP (40).

Other studies have revealed that the structure of a µHC, as dictated by its sequence, plays an important role in determining whether a pre-BCR can form. A number of HCs produced by V(D)J recombination are incapable of pairing with an assembled SLC (4, 8, 27). Our studies here with the retrovirus expression system revealed that the HC/SLC interaction seems to be largely influenced by the structure of the HC’s CDR3. In conditions where the VH sequence varies solely in the CDR3, only certain conformations allow for pairing with SLC. The finding of specific structural requirements for the CDR3 region of VH81X provides precise evidence for Minegishi’s findings (40) that only when the SLC achieves a particular shape can it interact with an HC. If the portion of the SLC that interacts in the vicinity of the CDR3 is disrupted by the conformation of the CDR3, it is reasonable to expect that the two proteins would have a less efficient interaction. If the CDR3 has a particular charge, it could potentially distort the SLC and disrupt the proper fold of the constant domain, thereby inhibiting the displacement of BiP. Alternatively, a bulky CDR3 structure might impede the positioning of the SLC for BiP supplantation.

We found that the persisting CDR3 structures of maturing B cells are largely skewed to 9 aa. At this length, the hypervariable region of the molecule takes on a structure distinct from the configuration assumed by CDR3 domains that were unable to pair with SLC. Although other lengths can survive in vivo, the majority are this length. HC that have other CDR3 lengths might bind the SLC less efficiently, and as a result, fewer complexes might be deposited on the surface. With a lower pre-BCR density, a B cell clone would be signaled less efficiently, resulting in less expansion or even deletion of that clone (37, 41).

A reduction in the average CDR3 length has been observed, as human B cells progress through development (42). Some evidence suggests that longer CDR3 regions are associated with autoreactivity (43, 44, 45). Thus, testing of HCs by the SLC could function as a screen to limit the production of autoreactive cells. In the JH+/- mouse splenic compartment, there was a notable reduction in the number of clones exhibiting longer CDR3s, a reduction not observed in the splenic compartment of {lambda}5-/- animals. This observation provides support for the hypothesis that longer CDR3s are associated with autoreactivity and consequently may be more readily eliminated under normal circumstances (46). In this fashion, the SLC could function to minimize or regulate autoreactivity by modulating the HC repertoire.

CDR3 length has been directly correlated to the potential for interaction between Ig HC and LC (47). In these analyses there were notable differences in the shape assumed by the coupled CDR3 regions depending on the lengths involved. Both HC/LC pairing and HC/SLC pairing may play a role in shaping the repertoire in the newly emerging B cell population. The correlations and structural limitations of these studies can easily be extended to the pairing of an HC and SLC. The fitness of the interaction would be determined by the shape created by the CDR3.

Our experiments reveal that the repertoire shift observed in the splenic B cell population subsequent to selection across the pre-B cell transition does not occur in the absence of pre-BCR formation. This finding directly implicates the pre-BCR and the SLC in particular in determining the final configuration of the B cell repertoire. This central role for the pre-BCR in repertoire selection extends the function of the receptor in the developmental paradigm. The limitations imposed by the SLC may actually serve to maximize the efficiency of the developing immune system. The ultimate goal of the system is to generate a B cell population where cells produce HCs capable of pairing efficiently with LCs, forming receptors that broaden and expand Ag binding capabilities. Facilitating progression of only those cells capable of competent HC/LC interactions later in development increases the probability of producing functional, viable cells. Testing through the SLC may also serve to recruit groups or families of preferred LCs that augment the diversity at the paired CDR3 domains. Studies have shown that particular HC and LC combinations are capable of assuming multiple conformations depending on the components involved (48). LCs that amplify this isomerism may have the potential to bind multiple Ags and thereby increase the efficiency of an immune response.

The biased representation of CDR3 lengths of 9 aa in the JH heterozygotes and the absence of this skewing in {lambda}5-deficient animals may represent structural restrictions that have evolved over time and are employed to augment the diversity of the HC in this context. Using 9 aa in the CDR3 loop may provide the greatest diversity for the CDR3 without compromising the structural integrity of the receptor. Some studies have indicated that too many residues in the loop may affect the stability and rigidity of the Ig fold (49). The interaction between framework regions and CDRs may also impact upon molecular structure in the vicinity of HC/LC association, affecting LC compatibility as well as the ability to bind Ag. The size and composition of the CDR3 have the potential to alter the conformation of the molecule in ways that may or may not be optimal for these contacts (50, 51). It is possible that at the length of 9 aa, optimization of diversity and structural integrity converge.

Compositional analysis of selected CDR3 sequences reveals a propensity for the amino acid histidine at position 1 (position 95 of the variable domain). Although the germline sequence of VH81X encodes the CA necessary for the histidine codon, this could also code for glutamine, which is not found in this position as frequently. The only explanation is that this amino acid provides optimal selective advantage to the VH81X-HC at all stages of development. In addition to the effects on conformation, there may be a role for this residue in ligand binding. CDR3 residues have been implicated in binding specific Ags (44, 45, 52, 53, 54). In the context of VH81X, the histidine may play a role in contacts with the extracellular matrix of stroma cells or other putative ligands for the pre-BCR. It is notable that there is a strong selection for histidine at position 1 in the CDR3 of VH10 rearrangements, another HC variable region gene associated with restricted expression patterns (55).

Our conclusions differ slightly from those of Hayden et al. (56), perhaps due to the approach taken by the authors. While their studies looked at the characteristics of VH81X-HCs that used a number of different JH gene segments (i.e., JH1 through JH4), we have focused on VH81X rearrangements using JH4. In this manner, we were able to attribute the selection or enrichment observed as being due solely to the differences in the CDR3 regions used. Therefore, structural contributions from amino acids encoded by the JH region and their confounding effects can be negated. This system allows us to directly test and assess the contribution of the CDR3 to the HCs that are used/successful in the periphery. Based on this approach we can for the first time look at specific characteristics of the HC that influence its association with the SLC, and thereby assess a direct function for SLC in shaping the mature repertoire and the manner in which this specific mechanism is implemented.

In fact, if one looks closely at the data presented by Hayden et al. (56), selection biases become apparent. For example, in one group 70% of the sequences use histidine at position 1, whereas only 15% of the sequences use glutamine at this position. In another group, 45% of CDR3s used were 9 aa long, with very few CDR3 lengths >11 aa. In the group of sequences using the JH4 gene segment, there is skewing to the CDR3 length of 9 aa as well as the use of histidine at position 1 of the CDR3. However, one could only make these contentions if larger sample sizes for each group and appropriate statistics were applied to the data to make the findings significant.

The fact that these biases exist in this population does not imply that these same characteristics are important in all populations, but does imply that these traits can play a significant role in determining HC selection and that the SLC is capable of distinguishing Ig proteins based on these characteristics.

The under-representation of the VH81X gene segment in the peripheral B cell pool is due to both molecular and cellular factors (6, 7, 8, 12, 14, 15, 16, 27, 57, 58). Our studies indicate that there are limitations placed on the VH81X HCs that are permitted to persist based on the amino acids that are encoded by the V(D)J junctional sequence. Clearly, the shape assumed by the HC plays a role in selecting the cells that survive. In addition to the other factors that restrict the presence of VH81X in the periphery, germline-encoded features of the VH81X HC protein may disfavor a competent interaction with SLC. Only under certain conditions is the complex suitably organized to warrant maintenance of the cell.

Functional assembly of a pre-BCR is an integral step in promoting the efficient transition of cells through the pro-B cell stage to an immature stage of development. The facility with which a particular HC associates with SLC has a direct impact on the survival of that cell (4). The studies that we have undertaken here indicate that the length of the CDR3 region can have implications for the suitability of fit and the subsequent fate of the cell. In these studies the most striking evidence of CDR3 length selection was observed across the pre-B transition; this was further confirmed by the lack of length selection in the absence of {lambda}5 and the pre-BCR. Further studies will reveal whether the absence of an SLC selection mechanism affects the characteristics of LCs that are able to pair with HC at later stages in development. Comparison of the LC repertoire in wild-type animals, in which pre-BCR-selective programs are intact, and in {lambda}5-/- animals will reveal whether the CDR3 restriction directly imposes identifiable features relevant to compatibility and LC pairing.


    Acknowledgments
 
We are grateful to Aaron Marshall, Anne Tran, Dirk Mielenz, and Ivan Fong for valuable comments. We thank Queenie Lam and Stacy Hirano for expert technical assistance. We thank Ana Cumano for critical reading of the manuscript and thoughtful comments, and Ton Rolink, Fritz Melchers and Jan Jongstra for providing mAbs against the pre-BCR and pre-BCR components.


    Footnotes
 
1 This work was supported in part by the Canadian Institutes for Health Research and the Terry Fox Marathon of Hope (to G.W.) and by Project Grant SFB466 and Research Grant JA 968/2 from the Deutsche Forschungsgemeinschaft (to H.-M.J.). D.M. is the recipient of a Canadian Institutes for Health Research Doctoral Research Award. This work was performed in partial fulfillment of Ph.D. requirements of D.M. Back

2 Address correspondence and reprint requests to Dr. Hans-Martin Jäck, Division of Molecular Immunology, Nikolaus Fiebiger Center, University of Erlangen-Nurnberg, Gluckstrasse 6, D-91054 Erlangen, Germany. E-mail address: hjaeck{at}molmed.uni-erlangen.de Back

3 Abbreviations used in this paper: HC, heavy chain of IgM; A-MuLV, Abelson murine leukemia virus; BCR, B cell receptor; BM, bone marrow; pI, isoelectric point; pre-BCR, pre-B cell receptor; SLC, surrogate light chain; VH81X-µHC, µHC using a VH81x-D-J rearrangement. Back

Received for publication April 10, 2003. Accepted for publication August 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Willerford, D. M., W. Swat, F. W. Alt. 1996. Developmental regulation of V(D)J recombination and lymphocyte differentiation. Curr. Opin. Genet. Dev. 6:603.[Medline]
  2. Alt, F. W., G. D. Yancopoulos, T. K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, D. Baltimore. 1984. Ordered rearrangement of immunoglobulin heavy chain variable region segments. EMBO J. 3:1209.[Medline]
  3. Melchers, F., H. Karasuyama, D. Haasner, S. Bauer, A. Kudo, N. Sakaguchi, B. Jameson, A. Rolink. 1993. The surrogate light chain in B-cell development. Immunol. Today 14:60.[Medline]
  4. ten Boekel, E., F. Melchers, A. G. Rolink. 1997. Changes in the VH gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity 7:357.[Medline]
  5. Lassoued, K., C. A. Nunez, L. Billips, H. Kubagawa, R. C. Monteiro, T. W. LeBien, M. D. Cooper. 1993. Expression of surrogate light chain receptors is restricted to a late stage in pre-B cell differentiation. Cell 73:73.[Medline]
  6. Kline, G. H., L. Hartwell, G. B. Beck-Engeser, U. Keyna, S. Zaharevitz, N. R. Klinman, H. M. Jäck. 1998. Pre-B cell receptor-mediated selection of pre-B cells synthesizing functional µ heavy chains. J. Immunol. 161:1608.[Abstract/Free Full Text]
  7. Decker, D. J., G. H. Kline, T. A. Hayden, S. N. Zaharevitz, N. R. Klinman. 1995. Heavy chain V gene-specific elimination of B cells during the pre-B cell to B cell transition. J. Immunol. 154:4924.[Abstract]
  8. Keyna, U., E. G. Beck, J. Jongstra, S. E. Applequist, H. M. Jäck. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155:5536.[Abstract]
  9. Kitamura, D., J. Roes, R. Kuhn, K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423.[Medline]
  10. Kitamura, D., A. Kudo, S. Schaal, W. Muller, F. Melchers, K. Rajewsky. 1992. A critical role of {lambda}5 protein in B cell development. Cell 69:823.[Medline]
  11. Decker, D. J., N. E. Boyle, J. A. Koziol, N. R. Klinman. 1991. The expression of the Ig H chain repertoire in developing bone marrow B lineage cells. J. Immunol. 146:350.[Abstract]
  12. Decker, D. J., N. E. Boyle, N. R. Klinman. 1991. Predominance of nonproductive rearrangements of VH81X gene segments evidences a dependence of B cell clonal maturation on the structure of nascent H chains. J. Immunol. 147:1406.[Abstract]
  13. Lam, K. P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073.[Medline]
  14. Huetz, F., L. Carlsson, U. C. Tornberg, D. Holmberg. 1993. V-region directed selection in differentiating B lymphocytes. EMBO J. 12:1819.[Medline]
  15. Marshall, A. J., G. E. Wu, G. J. Paige. 1996. Frequency of VH81x usage during B cell development: initial decline in usage is independent of Ig heavy chain cell surface expression. J. Immunol. 156:2077.[Abstract]
  16. Chukwuocha, R. U., A. J. Feeney. 1993. Role of homology-directed recombination: predominantly productive rearrangements of Vh81X in newborns but not in adults. Mol. Immunol. 30:1473.[Medline]
  17. Gu, H., D. Tarlinton, W. Muller, K. Rajewsky, I. Forster. 1991. Most peripheral B cells in mice are ligand selected. J. Exp. Med. 173:1357.[Abstract/Free Full Text]
  18. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. F. Loring, D. Huszar. 1993. Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5:647.[Abstract/Free Full Text]
  19. Winkler, T. H., A. Rolink, F. Melchers, H. Karasuyama. 1995. Precursor B cells of mouse bone marrow express two different complexes with the surrogate light chain on the surface. Eur. J. Immunol. 25:446.[Medline]
  20. Shinjo, F., R. R. Hardy, J. Jongstra. 1994. Monoclonal anti-{lambda}5 antibody FS1 identifies a 130 kDa protein associated with {lambda} and Vpre-B on the surface of early pre-B cell lines. Int. Immunol. 6:393.[Abstract/Free Full Text]
  21. Rolink, A. G., T. Winkler, F. Melchers, J. Andersson. 2000. Precursor B cell receptor-dependent B cell proliferation and differentiation does not require the bone marrow or fetal liver environment. J. Exp. Med. 191:23.[Abstract/Free Full Text]
  22. Kabat, E. A., T. T. Wu, M. Reid-Miller, H. M. Perry, K. S. Gottesman. 1991. Sequences of Proteins of Immunological Interest U.S. Department of Health and Human Services, National Institutes of Health, Washington, D.C.
  23. Iglesias, A., A. Nichogiannopoulou, G. S. Williams, H. Flaswinkel, G. Kohler. 1993. Early B cell development requires µ signaling. Eur. J. Immunol. 23:2622.[Medline]
  24. Marshall, A. J., N. Doyen, L. A. Bentolila, C. J. Paige, G. E. Wu. 1998. Terminal deoxynucleotidyl transferase expression during neonatal life alters DH reading frame usage and Ig-receptor-dependent selection of V regions. J. Immunol. 161:6657.[Abstract/Free Full Text]
  25. Bentolila, L. A., G. E. Wu, F. Nourrit, M. Fanton d’Andon, F. Rougeon, N. Doyen. 1997. Constitutive expression of terminal deoxynucleotidyl transferase in transgenic mice is sufficient for N region diversity to occur at any Ig locus throughout B cell differentiation. J. Immunol. 158:715.[Abstract]
  26. Markowitz, D., S. Goff, A. Bank. 1988. A safe packaging line for gene transfer: separating viral genes on two different plasmids. J. Virol. 62:1120.[Abstract/Free Full Text]
  27. Keyna, U., S. E. Applequist, J. Jongstra, E. G. Beck, H. M. Jäck. 1995. Ig µ heavy chains with VH81X variable regions do not associate with {lambda}5. Ann. NY Acad. Sci. 764:39.[Medline]
  28. Peitsch, M. C.. 1996. ProMod and Swiss-Model: internet-based tools for automated comparative protein modelling. Biochem. Soc. Trans. 24:274.[Medline]
  29. Guex, N., M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714.[Medline]
  30. Wilkins, M. R., E. Gasteiger, L. Tonella, K. Ou, M. Tyler, J. C. Sanchez, A. A. Gooley, B. J. Walsh, A. Bairoch, R. D. Appel, et al 1998. Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278:599.[Medline]
  31. Bjellqvist, B., G. J. Hughes, C. Pasquali, N. Paquet, F. Ravier, J. C. Sanchez, S. Frutiger, D. Hochstrasser. 1993. The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 14:1023.[Medline]
  32. Chang, Y., C. J. Paige, G. E. Wu. 1992. Enumeration and characterization of DJH structures in mouse fetal liver. EMBO J. 11:1891.[Medline]
  33. Feeney, A. J., R. Riblet. 1993. DST4: a new, and probably the last, functional DH gene in the BALB/c mouse. Immunogenetics 37:217.[Medline]
  34. Kurosawa, Y., S. Tonegawa. 1982. Organization, structure, and assembly of immunoglobulin heavy chain diversity DNA segments. J. Exp. Med. 155:201.[Abstract/Free Full Text]
  35. Raaphorst, F. M., C. S. Raman, B. T. Nall, J. M. Teale. 1997. Molecular mechanisms governing reading frame choice of immunoglobulin diversity genes. Immunol. Today 18:37.[Medline]
  36. Raaphorst, F. M., C. S. Raman, J. Tami, M. Fischbach, I. Sanz. 1997. Human Ig heavy chain CDR3 regions in adult bone marrow pre-B cells display an adult phenotype of diversity: evidence for structural selection of DH amino acid sequences. Int. Immunol. 9:1503.[Abstract/Free Full Text]
  37. Rolink, A., H. Karasuyama, U. Grawunder, D. Haasner, A. Kudo, F. Melchers. 1993. B cell development in mice with a defective {lambda}5 gene. Eur. J. Immunol. 23:1284.[Medline]
  38. Kerr, W. G., M. D. Cooper, L. Feng, P. D. Burrows, L. M. Hendershot. 1989. µ heavy chains can associate with a pseudo-light chain complex (psi L) in human pre-B cell lines. Int. Immunol. 1:355.[Abstract/Free Full Text]
  39. Pillai, S., D. Baltimore. 1987. Formation of disulphide-linked µ2{omega}2 tetramers in pre-B cells by the 18K {omega}-immunoglobulin light chain. Nature 329:172.[Medline]
  40. Minegishi, Y., L. M. Hendershot, M. E. Conley. 1999. Novel mechanisms control the folding and assembly of {lambda}5/14.1 and VpreB to produce an intact surrogate light chain. Proc. Natl. Acad. Sci. USA 96:3041.[Abstract/Free Full Text]
  41. Rolink, A. G., T. Winkler, F. Melchers, J. Andersson. 2000. Precursor B cell receptor-dependent B cell proliferation and differentiation does not require the bone marrow or fetal liver environment. J. Exp. Med. 191:23.
  42. Shiokawa, S., F. Mortari, J. O. Lima, C. Nunez, F. E. Bertrand, III, P. M. Kirkham, S. Zhu, A. P. Dasanayake, H. W. Schroeder, Jr. 1999. IgM heavy chain complementarity-determining region 3 diversity is constrained by genetic and somatic mechanisms until two months after birth. J. Immunol. 162:6060.[Abstract/Free Full Text]
  43. Bridges, S. L., Jr, S. K. Lee, M. L. Johnson, J. C. Lavelle, P. G. Fowler, W. J. Koopman, H. W. Schroeder, Jr. 1995. Somatic mutation and CDR3 lengths of immunoglobulin {kappa} light chains expressed in patients with rheumatoid arthritis and in normal individuals. J. Clin. Invest. 96:831.
  44. Eilat, D., D. M. Webster, A. R. Rees. 1988. V region sequences of anti-DNA and anti-RNA autoantibodies from NZB/NZW F1 mice. J. Immunol. 141:1745.[Abstract]
  45. Shlomchik, M., M. Mascelli, H. Shan, M. Z. Radic, D. Pisetsky, A. Marshak-Rothstein, M. Weigert. 1990. Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation. J. Exp. Med. 171:265.[Abstract/Free Full Text]
  46. Schettino, E. W., S. K. Chai, M. T. Kasaian, H. W. Schroeder, Jr, P. Casali. 1997. VHDJH gene sequences and antigen reactivity of monoclonal antibodies produced by human B-1 cells: evidence for somatic selection. J. Immunol. 158:2477.[Abstract]
  47. Schroeder, H. W., Jr, P. M. Kirkham. 2000. Marriage, divorce, and promiscuity in human B cells. Nat. Immunol. 1:187.[Medline]
  48. Foote, J., C. Milstein. 1994. Conformational isomerism and the diversity of antibodies. Proc. Natl. Acad. Sci. USA 91:10370.[Abstract/Free Full Text]
  49. Pfuhl, M., S. Improta, A. S. Politous, A. Pastore. 1997. When a module is also a domain: the role of the N terminus in the stability and the dynamics of immunoglobulin domains from titin. J. Mol. Biol. 265:242.[Medline]
  50. Kirkham, P. M., H. W. Schroeder, Jr. 1994. Antibody structure and the evolution of immunoglobulin V gene segments. Semin. Immunol. 6:347.[Medline]
  51. Wright, A., M. H. Tao, E. A. Kabat, S. L. Morrison. 1991. Antibody variable region glycosylation: position effects on antigen binding and carbohydrate structure. EMBO J. 10:2717.[Medline]
  52. Krishnan, M. R., N. T. Jou, T. N. Marion. 1996. Correlation between the amino acid position of arginine in VH-CDR3 and specificity for native DNA among autoimmune antibodies. J. Immunol. 157:2430.[Abstract]
  53. Radic, M. Z., M. Weigert. 1994. Genetic and structural evidence for antigen selection of anti-DNA antibodies. Annu. Rev. Immunol. 12:487.[Medline]
  54. Stollar, B. D.. 1994. Molecular analysis of anti-DNA antibodies. FASEB J. 8:337.[Abstract]
  55. Whitcomb, E. A., B. B. Haines, A. P. Parmelee, A. M. Pearlman, P. H. Brodeur. 1999. Germline structure and differential utilization of Igha and Ighb VH10 genes. J. Immunol. 162:1541.[Abstract/Free Full Text]
  56. Hayden, T. A., P. Riegert, G. H. Kline. 2002. Detection of functional VH81X heavy chains in adult mice with an assessment of complementarity-determining region 3 diversity and capacity to form pre-B cell rceptor. J. Immunol. 169:1970.[Abstract/Free Full Text]
  57. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore, F. W. Alt. 1984. Preferential utilization of the most JH-proximal VH gene segments in pre-B-cell lines. Nature 311:727.[Medline]
  58. Hamilton, A. M., J. F. Kearney. 1992. Effect of a VH81X-expressing IgM antibody on early B-cell development. Ann. NY Acad. Sci. 651:160.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
D. A. Martin, L. Lu, M. Cascalho, and G. E. Wu
Maintenance of Surrogate Light Chain Expression Induces Developmental Delay in Early B Cell Compartment
J. Immunol., October 15, 2007; 179(8): 4996 - 5005.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Kawano, S. Yoshikawa, Y. Minegishi, and H. Karasuyama
Pre-B Cell Receptor Assesses the Quality of IgH Chains and Tunes the Pre-B Cell Repertoire by Delivering Differential Signals
J. Immunol.,