|
|
||||||||

* Memorial Sloan-Kettering Cancer Center, New York, NY 10021; and
Joan and Sanford Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A number of requirements are implicit in the directional migration of cells within tissues. These include adhesive interactions between migrating cells and a stable matrix as well as signals that induce directional guidance. We have recently shown that the adhesive requirements include
4 integrin-mediated adhesion to a matrix consisting of VCAM-1+ stromal cells (13). In this manuscript we address the question of the directional signals for cortical migration. Using a variety of biochemical and functional assays in vitro and in vivo, we found a nonredundant and critical role for the CXCR4/CXCL12 axis in signaling progenitors arriving from the blood to migrate specifically in the direction of the cortex and thus to encounter the differentiative and proliferative signals required for proper T cell differentiation in the postnatal thymus.
| Materials and Methods |
|---|
|
|
|---|
Single-cell suspensions of thymocytes from 5-wk-old C57BL/6 male mice were depleted of small CD4+8+ cells by density gradient centrifugation, followed by staining with a cocktail of lineage Abs recognizing CD3 (clone KT3), CD4 (clone GK1.5), CD8 (clone 53-6.7), Mac-1 (clone M1/70), Gr-1 (clone RB6-8C5), and erythroid (clone TER-119). Depleted cells were stained with CD24, CD25, and CD44 Abs and sorted using the CD44/CD25 criteria described in the text, together with lymphoid forward and side scatter gates, a dead cell exclusion gate, a CD24+ gate, and a doublet exclusion gate (forward side scatter-width). Postsort purities were generally >99%.
RNA isolation and RT-PCR
RNA was extracted from purified progenitor populations using RNeasy Mini Kit columns (Qiagen, Valencia, CA). DNase I digestion was performed on the column, using 2 U of amplification grade DNase I (Invitrogen, Carlsbad, CA) for 20 min at 37°C. RNA was eluted in 30 µl of diethylpyrocarbonate-treated water and was used for RT-PCR. All RNA samples were tested for DNA contamination by PCR without RT. RT-PCR was performed using the Superscript One-Step RT-PCR with Platinum Taq (Invitrogen, San Diego, CA). Primer sequences were as follows: CXCR4 (GenBank accession no. NM_009911): forward, gtcagaggccaaggaaactg; reverse, cgaggaaggcatagaggatg; CXCL12 (GenBank accession no. NM_021704): forward, gtggcttcatggcaagattc; reverse, ctgtagcctgacggaccaat; and hypoxanthine guanine phosphoribosyl transferase (HPRT; GenBank accession no. NM_013556): forward, atcagtcaacgggggacata; reverse, ttgcgctcatcttaggcttt.
Microarray screening
Purified progenitor cells and RNA were isolated as described above. cDNA synthesis and labeling, hybridization to the Affymetrix U74A gene chip, imaging, and data analysis were performed by the Genomic Core Facility at Memorial Sloan-Kettering Cancer Center. Briefly, double-stranded cDNA was synthesized from a total of 5 µg of pooled RNA template from each progenitor population. Linear amplification with T7-RNA polymerase and biotin labeling were performed during an in vitro transcription step. The resulting biotin-labeled cRNA was fragmented and hybridized to the array for 16 h at 45°C. Following hybridization to the U74A array, an automated washing and staining protocol was performed on a dedicated fluidics station. The array was then immediately scanned on a GeneArray Scanner (Hewlett-Packard, Palo Alto, CA). Gene expression results were calculated using MicroArray Suite 5.0 and Wilcoxon rank analysis of differences for each of the eight matched and eight mismatched oligonucleotide probe sets in the array. For comparison of expression levels between progenitor populations (i.e., between arrays), the mean expression level for all genes characterized as present (i.e., where Wilcoxon rank differences between matched and mismatched probe sets had a null hypothesis significance of p < 0.04) was taken. This global mean was then scaled up or down, as appropriate, to an arbitrary value of 500, and all individual gene expression values from that array were adjusted proportionally.
RNA in situ hybridization
Transverse sections of 10-µm thickness were prepared from whole cryopreserved thymus. Sense and antisense probes for CXCL12 were cloned from PCR products amplified using the primers described above, after cloning into pCRII-TOPO using the TA Cloning Dual Promoter kit (Invitrogen) according to the manufacturers instructions. Orientation of the insert was confirmed by restriction mapping and sequencing. Digoxigenin-labeled probes were synthesized by in vitro transcription from linearized plasmid, using DIG RNA Labeling Mix (Roche, Indianapolis, IN) and the appropriate enzyme. For antisense probe, template was linearized with SpeI, and cRNA was synthesized using T7 polymerase (Roche). For sense probe, template was linearized with EcoRV, and cRNA was synthesized using SP6 polymerase (Promega, Madison, WI). All subsequent steps were performed at room temperature unless noted. Sections were fixed for 20 min in 4% formaldehyde/PBS, washed, and treated for 810 min with proteinase K at 7.5 µg/ml. Tissue sections were fixed again in formaldehyde and treated with 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min. Sections were then incubated in hybridization buffer (50% formamide, 5x SSC, 5x Denhardts reagent, and 250 µg/ml yeast tRNA) for 2 h and hybridized overnight at 55°C in fresh buffer containing a digoxygenin-labeled CXCL12 probe (0.8 µg/ml) and denatured herring sperm DNA (5 µg/ml). After sequential washes in 5x and 0.2x SSC at 60°C, bound probe was detected using peroxidase-conjugated, anti-digoxin Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) and tyramide signal amplification (PerkinElmer, Boston, MA) as recommended by the manufacturer. For immunohistochemistry, detection was performed using 3,3'-diaminobenzidine (Vector Laboratories, Burlingame, CA). For two-color detection, the RNA probe was imaged using Alexa594 streptavidin conjugate (Molecular Probes, Eugene, OR), followed by standard immunofluorescent staining for cytokeratin using FITC-conjugated clone C11 (Sigma-Aldrich, St. Louis, MO).
Laser microdissection
Transverse sections of 10-µm thickness were prepared from whole cryopreserved thymus. Sections were fixed in ice-cold 75% ethanol, stained for 20 s in Mayers hematoxylin, and dehydrated through 75, 95, and 100% ethanol. Dehydrated slides were stored desiccated at 4°C until used. At least 30 min before dissection, slides were brought to room temperature under desiccated conditions. Dissection was performed using the P.A.L.M. system (Carl Zeiss, Thornwood, NY) as recommended by the manufacturer. Briefly, computerized images were acquired, and regions of interest (see Fig. 2) were outlined on the screen. The margins of the regions of interest were ablated by exposure to a high power laser, and the central regions were catapulted into microfuge caps containing mineral oil. RNA extraction and RT-PCR were performed as described above.
|
Assays were performed using the ChemoTx 96 microplate system (NeuroProbe, Gaithersburg, MD). Briefly, plates containing 3.2-mm diameter wells and Transwell membranes with 5-µm pores were precoated with purified mouse fibronectin (Invitrogen) at 10 µg/ml for 1 h at 37°C, followed by air-drying. Murine CXCL12 (PeproTech, Rocky Hill, NJ) was added to the lower chamber in medium (RPMI 1640 containing 0.5% BSA and 5 mM HEPES); the optimal concentration, determined from a number of preliminary studies, was 8 nM. The fibronectin-coated membrane was placed carefully on top, and 25 µl of cell suspension containing 11.5 x 104 cells was added over the membrane. Controls included medium only in the bottom well or 25 µl of cell suspension plated directly in the bottom well. Plates were incubated for 90 min at 37°C, following which cells remaining above the membrane were carefully removed by wiping and rinsing with PBS. Cells remaining trapped within the membrane were loosened by treating each cell well with 25 µl of 2 mM EDTA in PBS for 5 min, followed by centrifugation. The contents of the wells were photographed, and the number of cells in a central field were counted. Cell counts were also confirmed by pooling the contents of replicate wells and counting on a hemocytometer. The percentage of cells migrating was calculated based on the controls where cells were added directly to the bottom chamber.
Generation of CXCR4loxP and lck[Cre]/CXCR4loxP/loxP mice
Generation of CXCR4loxP mice (D. Littman, Skirball Institute, New York University School of Medicine, New York, NY) will be described elsewhere. Briefly, loxP sites were introduced into the flanking regions surrounding exon 2 of CXCR4. Mice displaying germline transmission were bred to mice expressing Cre recombinase under the lck proximal promoter (14). The lck[Cre]-transgenic offspring of this cross (CXCR4loxP/+) were backcrossed to generate lck[Cre]/CXCR4loxp/loxP mice, which served as marrow donors. Mice expressing lck[Cre] only were used as controls.
Construction and analysis of stable bone marrow chimeras
Donor bone marrow was prepared by flushing marrow from tibias and fibulas of lck[Cre]/CXCR4loxP/loxP or control lck[Cre] mice, followed by hypotonic lysis of RBC. Recipients for marrow transplantation were sex-matched CD45.1 congenic mice (B6.SJL-Ptprca Pep3b/BoyJ; The Jackson Laboratory, Bar Harbor, ME). Recipient mice received 6 Gy of gamma irradiation
20 h before transplantation. Irradiated recipients received
3 x 107 donor cells in total, which were a mixture of mutant or control donor cells together with syngeneic (CD45.1) marrow. After 57 wk, chimeric mice were sacrificed, and hemopoietic tissues were harvested (thymus, bone marrow, blood, spleen). For analysis of CD4/CD8 phenotype in donor thymocytes, single-cell suspensions were stained with CD45.1-Alexa633, CD45.2-Alexa680, CD4-Alexa488, CD8-PE, and CD90-biotin/PE-Texas Red streptavidin. For analysis of progenitor thymocyte stages, suspensions were first stained with the cocktail of lineage Abs described above, followed by PE-Texas Red-conjugated anti-rat IgG, and then nonspecific rat IgG to block excess binding sites. Following this, cells were stained with the CD45 Abs described above as well as CD44-Alexa488 and CD25-PE. In all cases, 4',6-diamidino-2-phenylindole dihydrochloride was added at 0.1 µg/ml to discriminate dead from live cells. Analysis was performed on an LSR Cytometer (BD Biosciences, San Jose, CA) with modifications as previously described (15). For in situ localization of donor cells by immunofluorescent microscopy, 5-µm transverse sections of cryopreserved thymus were fixed in ice-cold acetone, followed by staining in PBS/5% FBS using the following Abs: CD45.2-Alexa594, FITC-conjugated pan cytokeratin (clone C-11; Sigma-Aldrich), CD25-Alexa488. 4',6-Diamidino-2-phenylindole dihydrochloride (0.25 µg/ml) was used as a counterstain, followed by fluorescent imaging using a mercury light source.
| Results |
|---|
|
|
|---|
Chemokines are heavily implicated in the directional migration of lymphocytes, such as that which occurs during steady state differentiation in the thymus (4). To elucidate the role of chemokine signals in this process, we first performed semiquantitative RT-PCR screening for all known murine chemokine receptors, using RNA template extracted from defined progenitor stages: these were DN1 (CD3-4-8-25-44high), DN2 (CD3-4-8-25+44high), DN3 (CD3-4-8-25+44low), and pre-DP (CD3low4low8low 25-44low). A large variety of chemokine receptors was found to be expressed on one or more of these stages (data not shown). Among these, CXCR4 emerged as the most abundant and most ubiquitously expressed chemokine receptor message (Fig. 1). Message levels by RT-PCR were highest in the CD25+ stages (DN2 and DN3) that are actively migrating across the cortex (4), but were found in all progenitor cells at appreciable levels. These RT-PCR findings were confirmed by hybridization to the Affymetrix U74A microarray (Fig. 1b). Global expression analysis of microarray results (see Materials and Methods) indicated that the lowest levels of CXCR4 expression, occurring in DN1 and pre-DP cells, were equivalent to the average expression levels for all genes expressed, while expression in DN2 and DN3 cells was higher. Together, these data indicate that all early intrathymic progenitors are potentially synthesizing CXCR4 and therefore have the potential to respond to its ligand.
|
To further evaluate the involvement of CXCR4 in facilitating the migration of progenitors into the thymic cortex, expression of its ligand, CXCL12, was evaluated. RNA in situ hybridization showed that CXCL12 was expressed on scattered cells throughout the cortex, but not the medulla (Fig. 2a), consistent with the results of others (16). The morphology of cells expressing CXCL12 was reticular, consistent with that of cortical stromal cells (17). Differential expression of CXCL12 in thymic tissue regions was further evaluated by RT-PCR analysis (Fig. 2, b and c), using regionally dissected thymic tissue. Semiquantitative comparison to a ubiquitously expressed gene (HPRT; see Fig. 2) indicated that CXCL12 levels were highest in the outer regions of the cortex, but were detectable throughout, and were virtually undetectable in the medulla. To further characterize the nature of cells producing CXCL12 in the cortex, costaining of CXCL12 mRNA and cytokeratin protein was performed (Fig. 2d). Cells expressing CXCL12 were uniformly cytokeratin+, although not all cytokeratin+ cells expressed CXCL12. These data indicate that the ligand for CXCR4 is expressed in the thymus in a manner consistent with the ability to guide progenitors into the cortex and away from the medulla.
Progenitor cells from the postnatal thymus exhibit the ability to migrate in response to CXCL12 in vivo
The data in Figs. 1 and 2 indicate the potential of early intrathymic progenitors to respond to CXCL12 via CXCR4. Functional analysis of these correlative RNA expression results was next sought. In the first instance, Transwell migration assays were performed using CXCL12 as a chemoattractant and purified progenitors as target cells (Fig. 3). A variety of CXCL12 concentrations and incubation times were tested in initial experiments. All progenitor populations responded proportionally to changes in the CXCL12 concentration; preliminary experiments showed that optimal transmigration occurred at a concentration of 8 nM. Ninety minutes provided a maximal signal-to-noise ratio in this system, i.e., at longer times, response to chemokine did not increase proportionally to random migration (no CXCL12 added). Consistent with the activities predicted by receptor expression levels (Fig. 1), transition to the CD25+ stages of development correlated with the most robust migration response, but all progenitor populations demonstrated a significant response to CXCL12. These data confirm the prediction of mRNA screening, by showing that early intrathymic progenitors are indeed capable of responding to CXCL12-mediated signals via CXCR4.
|
Although progenitor thymocytes were capable of responding to optimal concentrations of CXCL12 in vitro, there was no way of accurately determining that these concentrations of CXCL12 recapitulated in vivo conditions. Therefore, confirmation of the role of CXCR4 signaling in the directional movement of early intrathymic progenitors in vivo was sought. To preclude potential complications related to a role for CXCR4 in the homing of circulating progenitors to the thymus, inactivation of CXCR4 was targeted specifically to thymocytes by constructing a mouse with lox-P recombination sites flanking the CXCR4 gene (CXCR4loxP), and crossing homozygous targeted mice offspring to mice expressing Cre recombinase under control of the lck proximal promoter (14). The lck promoter first becomes active in immature thymocytes (18), apparently during the DN1 stage (19), and can thus be used to target deletion very early during T cell differentiation. To evaluate such mutant cells in the context of a normal thymic microenvironment, stable bone marrow chimeras were constructed using donor marrow from lck[Cre]/CXCR4loxP/loxP mice or control lck[Cre]-only mice transplanted into sublethally irradiated, wild-type, CD45.1-congenic recipients. After return to the steady state (57 wk), thymuses from chimeric animals were removed, and the two lobes were separated. One lobe was used immediately for phenotypic analysis by flow cytometry, and the other was frozen for subsequent histology; in this way, developmental stage could be directly correlated with localization in a single chimeric organ.
Fig. 4 shows an example of results obtained from four lck[Cre]/CXCR4loxP/loxP chimeras, and three control chimeras (lck[Cre] only). In all four of the former, the proportion of thymocytes derived from lck[Cre]/CXCR4loxP/loxP donors was very low (0.2 ± 0.1%), especially when compared with non-T lineage cells in other tissues (such as granulocytes in bone marrow; Fig. 4a). When control (lck[Cre] only) marrow was used, DN, DP, and mature cells of donor origin were present in normal proportions (Fig. 4b) and, other than the CD45 congenic marker, were essentially indistinguishable from cells of recipient origin. In all four lck[Cre]/CXCR4loxP/loxP chimeras, however, all donor cells were DN, while DP and mature SP cells were completely absent (recipient thymocytes were present in normal numbers and proportions; data not shown). Further characterization of the DN progeny of transplanted lck[Cre]/CXCR4loxP/loxP donors showed that in three of these four chimeras, virtually all DN cells present were arrested at DN1 (93 ± 5%), with a few DN2 (3 ± 2%) and DN3 (2 ± 2%) cells. In the fourth case there were substantially more DN2 (24%) and DN3 (62%) cells; nonetheless, as stated above, no DP or SP cells were found. The basis for the differences in this chimera are not clear, but since thymic compartmentalization is somewhat amorphous, it is possible that discrimination between regulatory signaling environments is somewhat leaky. Nonetheless, the absence of DP and more mature cells is consistent in all lck[Cre]/CXCR4loxP/loxP donor progeny, indicating that signaling through CXCR4 is linked to the proper differentiation of early intrathymic progenitors. The nature of this linkage is further evaluated in the next section.
|
The fundamental mechanism for arrest at the DN stage in CXCR4-deficient thymocytes was further revealed by immunofluorescent localization of targeted donor cells in chimeric thymus lobes (Fig. 5). The progeny of control (lck[Cre] only) marrow donors were found throughout the thymus, consistent with the presence of all developmental stages (Fig. 4b). In contrast, thymocytes derived from lck[Cre]/CXCR4loxP/loxP donor cells were found only at the CMJ or, more rarely, in the deep cortex. Some cells with nonlymphoid morphology were also found in the medulla; these represent CD11c+ dendritic cells that normally develop in or home to the thymus (36). The location of CXCR4-targeted lymphoid progeny in the thymus correlates with the sites where thymus-homing progenitors first enter the organ (4, 5, 6, 7, 8, 9, 10, 11). These results indicate that in the absence of CXCR4 signaling, progenitors recruited from the blood fail to move efficiently into the cortex, where they would otherwise differentiate further. This is further emphasized by comparing the localization of mutant donor thymocytes to CD25+ progenitors of recipient origin (Fig. 5b); mutant donor cells fail to move into the regions where recipient CD25+ cells are found, and consequently fail to differentiate past the DN1 stage. Together, our findings show that CXCR4-mediated signaling in response to stromally derived CXCL12 is crucial for mediating cortical localization of progenitors homing to the thymus from the blood and consequently for the success of steady state T cell differentiation.
|
| Discussion |
|---|
|
|
|---|
Recently, two works from the same group have shown that germline mutation of the CXCR4 gene results in a reduction of T cells produced by the thymus (31, 32). One important fact is that the effects of CXCR4 deficiency are much more severe when deficient cells are placed in competition with wild-type cells using hemopoietic chimerism, as shown by our present work and that of Ara et al. (32). The effects of CXCR4 deficiency in our system are even more severe than those found in the germline mutant model; this could reflect the use of fetal progenitors (in germline mutant studies) vs adult marrow progenitors (in the present study) and could also be affected by the use of lethal (32) vs sublethal (present study) irradiation. Nonetheless, these studies and others (33) reveal an important role for CXCR4 signaling in the T cell development process. Our results reveal the mechanism for this effect by showing that CXCR4 signaling is required to facilitate entry of thymic homing progenitors into the thymic cortex. Nonetheless, it is important to note that the distribution of CXCL12-producing cells in the thymic cortex appears to be fairly homogenous, and thus it is not intuitive that CXCR4 should polarize migration all the way across the cortex to the capsule. However, several other mechanisms may participate in this process. First, although the producer cells themselves may be evenly distributed, the CXCL12 protein may not be and could, in fact, be present at higher levels in the outer cortical or subcapsular regions. However, it has been shown by others that once the direction of migration is polarized, it is not necessary to maintain a gradient of CXCL12, although CXCR4 signaling must be maintained (34). Thus, initial polarization of newly arrived progenitors in the direction of the cortex and away from the medulla together with continuous presence of CXCL12 throughout the cortex may be sufficient to facilitate the directional migration of early progenitors across the cortex to the capsule. It is also worth pointing out that our comprehensive screen of thymocyte progenitors (see Results) revealed the presence of numerous chemokine receptors, some of which were expressed in a stage-specific fashion (data not shown). Thus, it is possible that chemokines other than CXCL12 may ultimately induce the direction of migration, while CXCL12 serves to activate integrin-mediated adhesion to substrates for migration, consistent with its known functions (35). Experiments are now underway to determine the relative roles of other chemokines in the transcortical migration process. Nonetheless, it is clear that the CXCL12/CXCR4 axis is critical for the initial events in this process and thus for the successful differentiation of T lymphocytes in the fully formed, steady state thymus.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Howard T. Petrie, Memorial Sloan-Kettering Cancer Center, Box 341, 1275 York Avenue, New York, NY 10021. E-mail address: petrieh{at}mskcc.org ![]()
3 Abbreviations used in this paper: CMJ, cortico-medullary junction; DN, double negative; DP, double positive; HPRT, hypoxanthine guanine phosphoribosyl transferase. ![]()
Received for publication May 29, 2003. Accepted for publication August 29, 2003.
| References |
|---|
|
|
|---|
/
and
/
T cells migrate from thymus to the periphery in alternating waves. J. Exp. Med. 186:977.
TCR+ thymocytes preferentially respond to CCL25. J. Immunol. 168:134.
by fibronectin mediates directed migration of T cells. Blood 96:2682.Related articles in The JI:
This article has been cited by other articles:
![]() |
H. Yang, Y.-H. Youm, and V. D. Dixit Inhibition of Thymic Adipogenesis by Caloric Restriction Is Coupled with Reduction in Age-Related Thymic Involution J. Immunol., September 1, 2009; 183(5): 3040 - 3052. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Chu, S. Schmitz, B. Choudhury, W. Telford, V. Kapoor, S. Garfield, D. Howe, and R. E. Gress Exogenous insulin-like growth factor 1 enhances thymopoiesis predominantly through thymic epithelial cell expansion Blood, October 1, 2008; 112(7): 2836 - 2846. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Fortier, E. Caron, M.-P. Hardy, G. Voisin, S. Lemieux, C. Perreault, and P. Thibault The MHC class I peptide repertoire is molded by the transcriptome J. Exp. Med., March 17, 2008; 205(3): 595 - 610. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Svensson, J. Marsal, H. Uronen-Hansson, M. Cheng, W. Jenkinson, C. Cilio, S. E. W. Jacobsen, E. Sitnicka, G. Anderson, and W. W. Agace Involvement of CCR9 at multiple stages of adult T lymphopoiesis J. Leukoc. Biol., January 1, 2008; 83(1): 156 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Itoi, N. Tsukamoto, H. Yoshida, and T. Amagai Mesenchymal cells are required for functional development of thymic epithelial cells Int. Immunol., August 1, 2007; 19(8): 953 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tanaka, T. Era, S.-i. Nishikawa, and S. Kawamata Forced expression of Nanog in hematopoietic stem cells results in a {gamma}{delta}T-cell disorder Blood, July 1, 2007; 110(1): 107 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Assarsson, B. J. Chambers, K. Hogstrand, E. Berntman, C. Lundmark, L. Fedorova, S. Imreh, A. Grandien, S. Cardell, B. Rozell, et al. Severe Defect in Thymic Development in an Insertional Mutant Mouse Model J. Immunol., April 15, 2007; 178(8): 5018 - 5027. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Perry, R. S. Welner, T. Kouro, P. W. Kincade, and X.-H. Sun Primitive lymphoid progenitors in bone marrow with T lineage reconstituting potential. J. Immunol., September 1, 2006; 177(5): 2880 - 2887. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Scimone, I. Aifantis, I. Apostolou, H. von Boehmer, and U. H. von Andrian A multistep adhesion cascade for lymphoid progenitor cell homing to the thymus PNAS, May 2, 2006; 103(18): 7006 - 7011. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uehara, S. M. Hayes, L. Li, D. El-Khoury, M. Canelles, B. J. Fowlkes, and P. E. Love Premature Expression of Chemokine Receptor CCR9 Impairs T Cell Development J. Immunol., January 1, 2006; 176(1): 75 - 84. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Curtis Cell-mediated Adaptive Immune Defense of the Lungs Proceedings of the ATS, December 1, 2005; 2(5): 412 - 416. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Swainson, S. Kinet, N. Manel, J.-L. Battini, M. Sitbon, and N. Taylor Glucose transporter 1 expression identifies a population of cycling CD4+CD8+ human thymocytes with high CXCR4-induced chemotaxis PNAS, September 6, 2005; 102(36): 12867 - 12872. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Zubkova, H. Mostowski, and M. Zaitseva Up-Regulation of IL-7, Stromal-Derived Factor-1{alpha}, Thymus-Expressed Chemokine, and Secondary Lymphoid Tissue Chemokine Gene Expression in the Stromal Cells in Response to Thymocyte Depletion: Implication for Thymus Reconstitution J. Immunol., August 15, 2005; 175(4): 2321 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vielkind, M. Gallagher-Gambarelli, M. Gomez, H. J. Hinton, and D. A. Cantrell Integrin Regulation by RhoA in Thymocytes J. Immunol., July 1, 2005; 175(1): 350 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wysocki, A. Panoskaltsis-Mortari, B. R. Blazar, and J. S. Serody Leukocyte migration and graft-versus-host disease Blood, June 1, 2005; 105(11): 4191 - 4199. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, T. Ueno, S. Kuse, F. Saito, T. Nitta, L. Piali, H. Nakano, T. Kakiuchi, M. Lipp, G. A. Hollander, et al. The role of CCL21 in recruitment of T-precursor cells to fetal thymi Blood, January 1, 2005; 105(1): 31 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. McNeil Coffield, W. S. Helms, Q. Jiang, and L. Su G{alpha}13 Mediates a Signal That Is Essential for Proliferation and Survival of Thymocyte Progenitors J. Exp. Med., November 15, 2004; 200(10): 1315 - 1324. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ueno, F. Saito, D. H.D. Gray, S. Kuse, K. Hieshima, H. Nakano, T. Kakiuchi, M. Lipp, R. L. Boyd, and Y. Takahama CCR7 Signals Are Essential for Cortex-Medulla Migration of Developing Thymocytes J. Exp. Med., August 16, 2004; 200(4): 493 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Misslitz, O. Pabst, G. Hintzen, L. Ohl, E. Kremmer, H. T. Petrie, and R. Forster Thymic T Cell Development and Progenitor Localization Depend on CCR7 J. Exp. Med., August 16, 2004; 200(4): 481 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Witt and E. A. Robey The Ins and Outs of CCR7 in the Thymus J. Exp. Med., August 16, 2004; 200(4): 405 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tabrizifard, A. Olaru, J. Plotkin, M. Fallahi-Sichani, F. Livak, and H. T. Petrie Analysis of Transcription Factor Expression during Discrete Stages of Postnatal Thymocyte Differentiation J. Immunol., July 15, 2004; 173(2): 1094 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Savino, D. A. Mendes-da-Cruz, S. Smaniotto, E. Silva-Monteiro, and D. M. S. Villa-Verde Molecular mechanisms governing thymocyte migration: combined role of chemokines and extracellular matrix J. Leukoc. Biol., June 1, 2004; 75(6): 951 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kwan and N. Killeen CCR7 Directs the Migration of Thymocytes into the Thymic Medulla J. Immunol., April 1, 2004; 172(7): 3999 - 4007. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |