The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plotkin, J.
Right arrow Articles by Petrie, H. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plotkin, J.
Right arrow Articles by Petrie, H. T.
The Journal of Immunology, 2003, 171: 4521-4527.
Copyright © 2003 by The American Association of Immunologists

Critical Role for CXCR4 Signaling in Progenitor Localization and T Cell Differentiation in the Postnatal Thymus 1

Jason Plotkin*, Susan E. Prockop*, Ana Lepique* and Howard T. Petrie2,*,{dagger}

* Memorial Sloan-Kettering Cancer Center, New York, NY 10021; and {dagger} Joan and Sanford Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T cell differentiation in the thymus depends on sequential interactions between lymphoid progenitors and stromal cells in discrete regions of the cortex. Here we show that CXCL12/CXCR4 signaling is absolutely required for proper localization of early progenitors into the cortex and thus for successful steady state differentiation. All early progenitors in the thymus express CXCR4, and its ligand (CXCL12) is expressed only by stromal cells in the cortex, where early progenitors are found. Early progenitors migrate in response to CXCL12 in vitro, while thymus-specific deletion of CXCR4 in vivo results in failed cortical localization and developmental arrest. These findings indicate a crucial and nonredundant role for CXCR4 in facilitating localization of early lymphoid progenitors to tissue regions of the thymus, where lineage commitment and proliferation are controlled.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Like all cells of hemopoietic origin, T lymphocytes must be generated throughout life to replace losses from cellular senescence, trauma, and, in the case of lymphocytes, Ag-driven clonal expansion. The self-renewing progenitors that initiate this process do not reside in the thymus, but, rather, are recruited by the thymus from marrow-derived progenitors that circulate in the blood. Although progenitors with lymphoid lineage preference have been identified within the bone marrow itself (1), numerous studies suggest that T lineage commitment occurs mainly after thymic entry, since many early intrathymic progenitors display multilineage potential (reviewed in Ref.2). During intrathymic residence, these multilineage progenitors are induced to undergo a series of differentiative and proliferative events that produce mature T cells. Thymic stromal cells play a key role in this process, by providing uncommitted progenitors with the signals that induce progressive phases of lineage commitment and proliferative expansion, as well as other functions (3). Different stromal environments within the thymus perform discrete functions, and consequently, cells at various stages of development are found in different tissue regions. Blood-borne progenitors arrive through large venules deep in the tissue (4, 5, 6, 7, 8, 9, 10, 11), near the junction of cortical and medullary compartments (cortico-medullary junction (CMJ) 3). Early intrathymic progenitor cells (defined as CD4/CD8 lineage double-negative (DN)) then migrate specifically outward, undergoing a series of developmental events as they move across the cortex toward the capsule (4, 11). Residence in the subcapsular region coincides with differentiation to the CD4/CD8 lineage double-positive (DP) stage, and a subsequent reversal in the polarity of travel, back into the cortex toward the medulla (12). However, only cells that express TCR of appropriate specificity are allowed to move into the medulla and become fully mature. Thus, T cell differentiation in the postnatal thymus is intimately linked to migration into and between tissue regions that induce and support various elements of the differentiation process.

A number of requirements are implicit in the directional migration of cells within tissues. These include adhesive interactions between migrating cells and a stable matrix as well as signals that induce directional guidance. We have recently shown that the adhesive requirements include {alpha}4 integrin-mediated adhesion to a matrix consisting of VCAM-1+ stromal cells (13). In this manuscript we address the question of the directional signals for cortical migration. Using a variety of biochemical and functional assays in vitro and in vivo, we found a nonredundant and critical role for the CXCR4/CXCL12 axis in signaling progenitors arriving from the blood to migrate specifically in the direction of the cortex and thus to encounter the differentiative and proliferative signals required for proper T cell differentiation in the postnatal thymus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of progenitor thymocytes

Single-cell suspensions of thymocytes from 5-wk-old C57BL/6 male mice were depleted of small CD4+8+ cells by density gradient centrifugation, followed by staining with a cocktail of lineage Abs recognizing CD3 (clone KT3), CD4 (clone GK1.5), CD8 (clone 53-6.7), Mac-1 (clone M1/70), Gr-1 (clone RB6-8C5), and erythroid (clone TER-119). Depleted cells were stained with CD24, CD25, and CD44 Abs and sorted using the CD44/CD25 criteria described in the text, together with lymphoid forward and side scatter gates, a dead cell exclusion gate, a CD24+ gate, and a doublet exclusion gate (forward side scatter-width). Postsort purities were generally >99%.

RNA isolation and RT-PCR

RNA was extracted from purified progenitor populations using RNeasy Mini Kit columns (Qiagen, Valencia, CA). DNase I digestion was performed on the column, using 2 U of amplification grade DNase I (Invitrogen, Carlsbad, CA) for 20 min at 37°C. RNA was eluted in 30 µl of diethylpyrocarbonate-treated water and was used for RT-PCR. All RNA samples were tested for DNA contamination by PCR without RT. RT-PCR was performed using the Superscript One-Step RT-PCR with Platinum Taq (Invitrogen, San Diego, CA). Primer sequences were as follows: CXCR4 (GenBank accession no. NM_009911): forward, gtcagaggccaaggaaactg; reverse, cgaggaaggcatagaggatg; CXCL12 (GenBank accession no. NM_021704): forward, gtggcttcatggcaagattc; reverse, ctgtagcctgacggaccaat; and hypoxanthine guanine phosphoribosyl transferase (HPRT; GenBank accession no. NM_013556): forward, atcagtcaacgggggacata; reverse, ttgcgctcatcttaggcttt.

Microarray screening

Purified progenitor cells and RNA were isolated as described above. cDNA synthesis and labeling, hybridization to the Affymetrix U74A gene chip, imaging, and data analysis were performed by the Genomic Core Facility at Memorial Sloan-Kettering Cancer Center. Briefly, double-stranded cDNA was synthesized from a total of 5 µg of pooled RNA template from each progenitor population. Linear amplification with T7-RNA polymerase and biotin labeling were performed during an in vitro transcription step. The resulting biotin-labeled cRNA was fragmented and hybridized to the array for 16 h at 45°C. Following hybridization to the U74A array, an automated washing and staining protocol was performed on a dedicated fluidics station. The array was then immediately scanned on a GeneArray Scanner (Hewlett-Packard, Palo Alto, CA). Gene expression results were calculated using MicroArray Suite 5.0 and Wilcoxon rank analysis of differences for each of the eight matched and eight mismatched oligonucleotide probe sets in the array. For comparison of expression levels between progenitor populations (i.e., between arrays), the mean expression level for all genes characterized as present (i.e., where Wilcoxon rank differences between matched and mismatched probe sets had a null hypothesis significance of p < 0.04) was taken. This global mean was then scaled up or down, as appropriate, to an arbitrary value of 500, and all individual gene expression values from that array were adjusted proportionally.

RNA in situ hybridization

Transverse sections of 10-µm thickness were prepared from whole cryopreserved thymus. Sense and antisense probes for CXCL12 were cloned from PCR products amplified using the primers described above, after cloning into pCRII-TOPO using the TA Cloning Dual Promoter kit (Invitrogen) according to the manufacturer’s instructions. Orientation of the insert was confirmed by restriction mapping and sequencing. Digoxigenin-labeled probes were synthesized by in vitro transcription from linearized plasmid, using DIG RNA Labeling Mix (Roche, Indianapolis, IN) and the appropriate enzyme. For antisense probe, template was linearized with SpeI, and cRNA was synthesized using T7 polymerase (Roche). For sense probe, template was linearized with EcoRV, and cRNA was synthesized using SP6 polymerase (Promega, Madison, WI). All subsequent steps were performed at room temperature unless noted. Sections were fixed for 20 min in 4% formaldehyde/PBS, washed, and treated for 8–10 min with proteinase K at 7.5 µg/ml. Tissue sections were fixed again in formaldehyde and treated with 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min. Sections were then incubated in hybridization buffer (50% formamide, 5x SSC, 5x Denhardt’s reagent, and 250 µg/ml yeast tRNA) for 2 h and hybridized overnight at 55°C in fresh buffer containing a digoxygenin-labeled CXCL12 probe (0.8 µg/ml) and denatured herring sperm DNA (5 µg/ml). After sequential washes in 5x and 0.2x SSC at 60°C, bound probe was detected using peroxidase-conjugated, anti-digoxin Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) and tyramide signal amplification (PerkinElmer, Boston, MA) as recommended by the manufacturer. For immunohistochemistry, detection was performed using 3,3'-diaminobenzidine (Vector Laboratories, Burlingame, CA). For two-color detection, the RNA probe was imaged using Alexa594 streptavidin conjugate (Molecular Probes, Eugene, OR), followed by standard immunofluorescent staining for cytokeratin using FITC-conjugated clone C11 (Sigma-Aldrich, St. Louis, MO).

Laser microdissection

Transverse sections of 10-µm thickness were prepared from whole cryopreserved thymus. Sections were fixed in ice-cold 75% ethanol, stained for 20 s in Mayer’s hematoxylin, and dehydrated through 75, 95, and 100% ethanol. Dehydrated slides were stored desiccated at 4°C until used. At least 30 min before dissection, slides were brought to room temperature under desiccated conditions. Dissection was performed using the P.A.L.M. system (Carl Zeiss, Thornwood, NY) as recommended by the manufacturer. Briefly, computerized images were acquired, and regions of interest (see Fig. 2) were outlined on the screen. The margins of the regions of interest were ablated by exposure to a high power laser, and the central regions were catapulted into microfuge caps containing mineral oil. RNA extraction and RT-PCR were performed as described above.



View larger version (109K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of the CXCR4 ligand, CXCL12, on stromal cells in the cortex. a, RNA in situ hybridization of an antisense probe (left and right panels; original magnifications, x100 and x400, respectively) or a control sense probe (center panel; original magnification, x100). CXCL12 expression was found on scattered cells in the cortex, but not the medulla. The morphology of cells expressing CXCL12 was consistent with that of nonhemopoietic, reticular stromal cells. RT-PCR analysis of purified lymphoid progenitors or total thymic lymphocytes also showed the absence of CXCL12 expression (not shown). The expression of CXCL12 throughout the cortex, but not the medulla was confirmed by RT-PCR analysis using RNA template isolated from microdissected thymus tissues. b, Transverse section of thymus after laser microdissection of tissue from 1) the medulla; 2) the perimedullary cortex; 3) the midcortex; and 4) the subcapsular region. c, Semiquantitative RT-PCR analysis using primers specific for CXCL12 and RNA isolated from regions as shown in b. Again, the expression was found in all cortical regions, but not in the medulla. Comparison of expression levels to a housekeeping gene (HPRT) suggest that the highest levels probably occur in the outer cortex, consistent with the findings of others (16 ). The stromal nature of CXCL12-producing cortical cells was then evaluated by two-color in situ analysis using a CXCL12 antisense RNA probe (red) together with an Ab recognizing multiple isoforms of cytokeratin (green). d, x200 original magnification of such staining; the border of cortical and medullary regions is illustrated by a dashed line. e, x1000 magnification of a small cluster of CXCL12+ cells in the cortex, clearly illustrating coexpression of cytokeratin.

 
Transwell migration assay

Assays were performed using the ChemoTx 96 microplate system (NeuroProbe, Gaithersburg, MD). Briefly, plates containing 3.2-mm diameter wells and Transwell membranes with 5-µm pores were precoated with purified mouse fibronectin (Invitrogen) at 10 µg/ml for 1 h at 37°C, followed by air-drying. Murine CXCL12 (PeproTech, Rocky Hill, NJ) was added to the lower chamber in medium (RPMI 1640 containing 0.5% BSA and 5 mM HEPES); the optimal concentration, determined from a number of preliminary studies, was 8 nM. The fibronectin-coated membrane was placed carefully on top, and 25 µl of cell suspension containing 1–1.5 x 104 cells was added over the membrane. Controls included medium only in the bottom well or 25 µl of cell suspension plated directly in the bottom well. Plates were incubated for 90 min at 37°C, following which cells remaining above the membrane were carefully removed by wiping and rinsing with PBS. Cells remaining trapped within the membrane were loosened by treating each cell well with 25 µl of 2 mM EDTA in PBS for 5 min, followed by centrifugation. The contents of the wells were photographed, and the number of cells in a central field were counted. Cell counts were also confirmed by pooling the contents of replicate wells and counting on a hemocytometer. The percentage of cells migrating was calculated based on the controls where cells were added directly to the bottom chamber.

Generation of CXCR4loxP and lck[Cre]/CXCR4loxP/loxP mice

Generation of CXCR4loxP mice (D. Littman, Skirball Institute, New York University School of Medicine, New York, NY) will be described elsewhere. Briefly, loxP sites were introduced into the flanking regions surrounding exon 2 of CXCR4. Mice displaying germline transmission were bred to mice expressing Cre recombinase under the lck proximal promoter (14). The lck[Cre]-transgenic offspring of this cross (CXCR4loxP/+) were backcrossed to generate lck[Cre]/CXCR4loxp/loxP mice, which served as marrow donors. Mice expressing lck[Cre] only were used as controls.

Construction and analysis of stable bone marrow chimeras

Donor bone marrow was prepared by flushing marrow from tibias and fibulas of lck[Cre]/CXCR4loxP/loxP or control lck[Cre] mice, followed by hypotonic lysis of RBC. Recipients for marrow transplantation were sex-matched CD45.1 congenic mice (B6.SJL-Ptprca Pep3b/BoyJ; The Jackson Laboratory, Bar Harbor, ME). Recipient mice received 6 Gy of gamma irradiation ~20 h before transplantation. Irradiated recipients received ~3 x 107 donor cells in total, which were a mixture of mutant or control donor cells together with syngeneic (CD45.1) marrow. After 5–7 wk, chimeric mice were sacrificed, and hemopoietic tissues were harvested (thymus, bone marrow, blood, spleen). For analysis of CD4/CD8 phenotype in donor thymocytes, single-cell suspensions were stained with CD45.1-Alexa633, CD45.2-Alexa680, CD4-Alexa488, CD8-PE, and CD90-biotin/PE-Texas Red streptavidin. For analysis of progenitor thymocyte stages, suspensions were first stained with the cocktail of lineage Abs described above, followed by PE-Texas Red-conjugated anti-rat IgG, and then nonspecific rat IgG to block excess binding sites. Following this, cells were stained with the CD45 Abs described above as well as CD44-Alexa488 and CD25-PE. In all cases, 4',6-diamidino-2-phenylindole dihydrochloride was added at 0.1 µg/ml to discriminate dead from live cells. Analysis was performed on an LSR Cytometer (BD Biosciences, San Jose, CA) with modifications as previously described (15). For in situ localization of donor cells by immunofluorescent microscopy, 5-µm transverse sections of cryopreserved thymus were fixed in ice-cold acetone, followed by staining in PBS/5% FBS using the following Abs: CD45.2-Alexa594, FITC-conjugated pan cytokeratin (clone C-11; Sigma-Aldrich), CD25-Alexa488. 4',6-Diamidino-2-phenylindole dihydrochloride (0.25 µg/ml) was used as a counterstain, followed by fluorescent imaging using a mercury light source.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of chemokine receptor expression on thymic progenitors predicts the ability to respond to CXCL12

Chemokines are heavily implicated in the directional migration of lymphocytes, such as that which occurs during steady state differentiation in the thymus (4). To elucidate the role of chemokine signals in this process, we first performed semiquantitative RT-PCR screening for all known murine chemokine receptors, using RNA template extracted from defined progenitor stages: these were DN1 (CD3-4-8-25-44high), DN2 (CD3-4-8-25+44high), DN3 (CD3-4-8-25+44low), and pre-DP (CD3low4low8low 25-44low). A large variety of chemokine receptors was found to be expressed on one or more of these stages (data not shown). Among these, CXCR4 emerged as the most abundant and most ubiquitously expressed chemokine receptor message (Fig. 1). Message levels by RT-PCR were highest in the CD25+ stages (DN2 and DN3) that are actively migrating across the cortex (4), but were found in all progenitor cells at appreciable levels. These RT-PCR findings were confirmed by hybridization to the Affymetrix U74A microarray (Fig. 1b). Global expression analysis of microarray results (see Materials and Methods) indicated that the lowest levels of CXCR4 expression, occurring in DN1 and pre-DP cells, were equivalent to the average expression levels for all genes expressed, while expression in DN2 and DN3 cells was higher. Together, these data indicate that all early intrathymic progenitors are potentially synthesizing CXCR4 and therefore have the potential to respond to its ligand.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 1. Progenitor cells in the thymus express CXCR4. a, Semiquantitative RT-PCR analysis of CXCR4 expression, using either 25 or 35 cycles and RNA template from either 1000 (low template) or 5000 (high template) progenitor cell equivalents, as indicated. Expression was found in all progenitor stages, but was highest in CD25+ stages (DN2 and DN3). b, Confirmation of this result by microarray screening. Also shown are relative expression levels of two control genes, CD25 and RAG-1. Relative expression levels were calculated by normalizing the mean global expression level for all 12,000 probe sets on the chip to an arbitrary value (in this case, 500).

 
Production of CXCL12 by a subset of cytokeratin-expressing stromal cells in the thymic cortex

To further evaluate the involvement of CXCR4 in facilitating the migration of progenitors into the thymic cortex, expression of its ligand, CXCL12, was evaluated. RNA in situ hybridization showed that CXCL12 was expressed on scattered cells throughout the cortex, but not the medulla (Fig. 2a), consistent with the results of others (16). The morphology of cells expressing CXCL12 was reticular, consistent with that of cortical stromal cells (17). Differential expression of CXCL12 in thymic tissue regions was further evaluated by RT-PCR analysis (Fig. 2, b and c), using regionally dissected thymic tissue. Semiquantitative comparison to a ubiquitously expressed gene (HPRT; see Fig. 2) indicated that CXCL12 levels were highest in the outer regions of the cortex, but were detectable throughout, and were virtually undetectable in the medulla. To further characterize the nature of cells producing CXCL12 in the cortex, costaining of CXCL12 mRNA and cytokeratin protein was performed (Fig. 2d). Cells expressing CXCL12 were uniformly cytokeratin+, although not all cytokeratin+ cells expressed CXCL12. These data indicate that the ligand for CXCR4 is expressed in the thymus in a manner consistent with the ability to guide progenitors into the cortex and away from the medulla.

Progenitor cells from the postnatal thymus exhibit the ability to migrate in response to CXCL12 in vivo

The data in Figs. 1 and 2 indicate the potential of early intrathymic progenitors to respond to CXCL12 via CXCR4. Functional analysis of these correlative RNA expression results was next sought. In the first instance, Transwell migration assays were performed using CXCL12 as a chemoattractant and purified progenitors as target cells (Fig. 3). A variety of CXCL12 concentrations and incubation times were tested in initial experiments. All progenitor populations responded proportionally to changes in the CXCL12 concentration; preliminary experiments showed that optimal transmigration occurred at a concentration of 8 nM. Ninety minutes provided a maximal signal-to-noise ratio in this system, i.e., at longer times, response to chemokine did not increase proportionally to random migration (no CXCL12 added). Consistent with the activities predicted by receptor expression levels (Fig. 1), transition to the CD25+ stages of development correlated with the most robust migration response, but all progenitor populations demonstrated a significant response to CXCL12. These data confirm the prediction of mRNA screening, by showing that early intrathymic progenitors are indeed capable of responding to CXCL12-mediated signals via CXCR4.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. CXCR4-expressing lymphoid progenitors from the thymus respond to CXCL12 by migration in vitro. Purified CXCR4+ lymphoid progenitors from the thymus were tested for their ability to respond to the stromal ligand CXCL12, using ChemoTX Transwell plates with 5-µm pores (NeuroProbe). As described in the text, various incubation times and concentrations of chemokine were tested; the results shown here represent the pooled mean ± SD for two assays using 8 nM CXCL12 in the lower chamber and 90 min of incubation. The percentage of cells migrating was calculated by adding input cells directly to the lower chamber and defining this as the maximal count; random migration in response to medium alone is also shown for each cell population. Consistent with semiquantitative analysis of CXCR4 expression and the relative localization of CXCL12 expression and various progenitor stages in the cortex, responsiveness to CXCL12 was highest in CD25+ stages, but was observed in all progenitor stages.

 
In vivo analysis of CXCR4-deficient cells reveals a critical role for this receptor in mediating cortical localization and subsequent T lineage differentiation

Although progenitor thymocytes were capable of responding to optimal concentrations of CXCL12 in vitro, there was no way of accurately determining that these concentrations of CXCL12 recapitulated in vivo conditions. Therefore, confirmation of the role of CXCR4 signaling in the directional movement of early intrathymic progenitors in vivo was sought. To preclude potential complications related to a role for CXCR4 in the homing of circulating progenitors to the thymus, inactivation of CXCR4 was targeted specifically to thymocytes by constructing a mouse with lox-P recombination sites flanking the CXCR4 gene (CXCR4loxP), and crossing homozygous targeted mice offspring to mice expressing Cre recombinase under control of the lck proximal promoter (14). The lck promoter first becomes active in immature thymocytes (18), apparently during the DN1 stage (19), and can thus be used to target deletion very early during T cell differentiation. To evaluate such mutant cells in the context of a normal thymic microenvironment, stable bone marrow chimeras were constructed using donor marrow from lck[Cre]/CXCR4loxP/loxP mice or control lck[Cre]-only mice transplanted into sublethally irradiated, wild-type, CD45.1-congenic recipients. After return to the steady state (5–7 wk), thymuses from chimeric animals were removed, and the two lobes were separated. One lobe was used immediately for phenotypic analysis by flow cytometry, and the other was frozen for subsequent histology; in this way, developmental stage could be directly correlated with localization in a single chimeric organ.

Fig. 4 shows an example of results obtained from four lck[Cre]/CXCR4loxP/loxP chimeras, and three control chimeras (lck[Cre] only). In all four of the former, the proportion of thymocytes derived from lck[Cre]/CXCR4loxP/loxP donors was very low (0.2 ± 0.1%), especially when compared with non-T lineage cells in other tissues (such as granulocytes in bone marrow; Fig. 4a). When control (lck[Cre] only) marrow was used, DN, DP, and mature cells of donor origin were present in normal proportions (Fig. 4b) and, other than the CD45 congenic marker, were essentially indistinguishable from cells of recipient origin. In all four lck[Cre]/CXCR4loxP/loxP chimeras, however, all donor cells were DN, while DP and mature SP cells were completely absent (recipient thymocytes were present in normal numbers and proportions; data not shown). Further characterization of the DN progeny of transplanted lck[Cre]/CXCR4loxP/loxP donors showed that in three of these four chimeras, virtually all DN cells present were arrested at DN1 (93 ± 5%), with a few DN2 (3 ± 2%) and DN3 (2 ± 2%) cells. In the fourth case there were substantially more DN2 (24%) and DN3 (62%) cells; nonetheless, as stated above, no DP or SP cells were found. The basis for the differences in this chimera are not clear, but since thymic compartmentalization is somewhat amorphous, it is possible that discrimination between regulatory signaling environments is somewhat leaky. Nonetheless, the absence of DP and more mature cells is consistent in all lck[Cre]/CXCR4loxP/loxP donor progeny, indicating that signaling through CXCR4 is linked to the proper differentiation of early intrathymic progenitors. The nature of this linkage is further evaluated in the next section.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. Thymocyte-specific deletion of CXCR4 results in early developmental arrest. Stable bone marrow chimeras were prepared as described in the text, using donor marrow from mice that expressed Cre recombinase under a thymus-specific promoter (lck), and also carried loxP flanking sites on both CXCR4 alleles ({Delta}CXCR4). Control chimeras were prepared using bone marrow from lck[Cre] only mice. The top panel in a illustrates relative levels of chimerism in the thymus for conditional mutant cells vs wild-type (recipient) cells. Overall levels of chimerism in such mice, as measured by levels of nonlymphoid donor cells in other tissues, were substantially higher, as illustrated in the lower panel of a. The phenotype of mutant vs control donor cells from one lobe of chimeric thymuses is characterized in b. The left panels show the overall CD4/CD8 phenotype, while the right panels define early progenitor stages, based on CD44 and CD25 expression. Control (lck[Cre] only) progeny showed normal proportions of all thymocyte stages, including all CD4-8- subtypes, as well as CD4+8+ and mature cells. However, cells undergoing thymus-specific deletion of CXCR4 lacked CD4+8+ and more mature populations; further characterization of the CD4-8- that were present showed that most cells were blocked at the earliest (DN1) stage of development (see Results).

 
CXCR4 signaling is required to direct entry of thymic-homing progenitors into the thymic cortex

The fundamental mechanism for arrest at the DN stage in CXCR4-deficient thymocytes was further revealed by immunofluorescent localization of targeted donor cells in chimeric thymus lobes (Fig. 5). The progeny of control (lck[Cre] only) marrow donors were found throughout the thymus, consistent with the presence of all developmental stages (Fig. 4b). In contrast, thymocytes derived from lck[Cre]/CXCR4loxP/loxP donor cells were found only at the CMJ or, more rarely, in the deep cortex. Some cells with nonlymphoid morphology were also found in the medulla; these represent CD11c+ dendritic cells that normally develop in or home to the thymus (36). The location of CXCR4-targeted lymphoid progeny in the thymus correlates with the sites where thymus-homing progenitors first enter the organ (4, 5, 6, 7, 8, 9, 10, 11). These results indicate that in the absence of CXCR4 signaling, progenitors recruited from the blood fail to move efficiently into the cortex, where they would otherwise differentiate further. This is further emphasized by comparing the localization of mutant donor thymocytes to CD25+ progenitors of recipient origin (Fig. 5b); mutant donor cells fail to move into the regions where recipient CD25+ cells are found, and consequently fail to differentiate past the DN1 stage. Together, our findings show that CXCR4-mediated signaling in response to stromally derived CXCL12 is crucial for mediating cortical localization of progenitors homing to the thymus from the blood and consequently for the success of steady state T cell differentiation.



View larger version (91K):
[in this window]
[in a new window]
 
FIGURE 5. Thymocyte-specific deletion of CXCR4 results in failure of thymic homing progenitors to enter the cortex. To determine whether the developmental arrest shown in Fig. 4 resulted from atypical migration in the absence of CXCR4 signaling, the location of the intrathymic progeny of targeted (lck[Cre]/CXCR4loxP/loxP) or control (lck[Cre] only) donor cells was analyzed. Control progeny were found throughout the thymic cortex and medulla (a), consistent with the phenotype shown in Fig. 4b. However, cells bearing thymocyte-specific deletion of CXCR4 were found mainly at the CMJ, rarely elsewhere in the deep cortex, consistent with the mostly DN1 phenotype of such cells. The distinction between the intrathymic location of mutant donor cells and normal progenitor thymocytes is further emphasized by the staining shown in b, which reveals that the progeny of CXCR4-targeted donor cells do not enter the signaling environments where DN2 and DN3 progenitors (i.e., CD25+ cells) normally differentiate.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A role for chemokines in homing to or migration within the thymus has been indicated by several earlier studies (reviewed in Ref.20). In contrast to the present study, most of these have focused on migration of progenitors into the fetal primordium (21, 22), migration from the outer cortex toward the medulla (16, 23, 24, 25, 26), or migration out of the organ (27, 28). The role of chemokines in enabling progenitor migration outward across the cortex during steady state differentiation has not been characterized, although it is clearly implicated. Similar to the results presented here, studies of progenitor cells from fetal thymus indicated that they can respond to CXCL12 in Transwell migration assays (23), although it should be noted that the migratory requirements for fetal and postnatal progenitors cannot be assumed to be the same, since fetal progenitors do not migrate outward across the cortex during differentiation, nor do they enter the thymus through blood vessels at the CMJ, as the fetal organ is neither structured nor vascularized at the time of progenitor seeding (29). Numerous other chemokines have been shown to be expressed in the fetal thymic primordium (21, 22) and to induce chemotaxis of fetal thymic progenitors (21). The multiplicity of chemokines that can attract fetal progenitors (21) may explain the results obtained from CXCR4 germline knockouts, where fetal organs transplanted to wild-type mice developed normally (30), since other chemokines/chemokine receptors can compensate for the absence of CXCR4 signaling in the embryonic rudiment. In contrast, our studies show an absolute requirement for CXCR4 signaling in the postnatal thymus, a function that cannot be compensated by other signals despite the expression of numerous other chemokine receptors (data not shown). The inability of cells lacking CXCR4 to differentiate past the DN1 stage also clearly illustrates that migration into the cortex and interaction with signals found only in the cortical microenvironment are obligatory processes for continuous production of T lymphocytes during postnatal life. This does not preclude additional roles for CXCR4 in thymic T cell differentiation, such as recruitment of new progenitors into the thymus or movement of more mature thymocytes inward toward the medulla, although these associations remain to be proven.

Recently, two works from the same group have shown that germline mutation of the CXCR4 gene results in a reduction of T cells produced by the thymus (31, 32). One important fact is that the effects of CXCR4 deficiency are much more severe when deficient cells are placed in competition with wild-type cells using hemopoietic chimerism, as shown by our present work and that of Ara et al. (32). The effects of CXCR4 deficiency in our system are even more severe than those found in the germline mutant model; this could reflect the use of fetal progenitors (in germline mutant studies) vs adult marrow progenitors (in the present study) and could also be affected by the use of lethal (32) vs sublethal (present study) irradiation. Nonetheless, these studies and others (33) reveal an important role for CXCR4 signaling in the T cell development process. Our results reveal the mechanism for this effect by showing that CXCR4 signaling is required to facilitate entry of thymic homing progenitors into the thymic cortex. Nonetheless, it is important to note that the distribution of CXCL12-producing cells in the thymic cortex appears to be fairly homogenous, and thus it is not intuitive that CXCR4 should polarize migration all the way across the cortex to the capsule. However, several other mechanisms may participate in this process. First, although the producer cells themselves may be evenly distributed, the CXCL12 protein may not be and could, in fact, be present at higher levels in the outer cortical or subcapsular regions. However, it has been shown by others that once the direction of migration is polarized, it is not necessary to maintain a gradient of CXCL12, although CXCR4 signaling must be maintained (34). Thus, initial polarization of newly arrived progenitors in the direction of the cortex and away from the medulla together with continuous presence of CXCL12 throughout the cortex may be sufficient to facilitate the directional migration of early progenitors across the cortex to the capsule. It is also worth pointing out that our comprehensive screen of thymocyte progenitors (see Results) revealed the presence of numerous chemokine receptors, some of which were expressed in a stage-specific fashion (data not shown). Thus, it is possible that chemokines other than CXCL12 may ultimately induce the direction of migration, while CXCL12 serves to activate integrin-mediated adhesion to substrates for migration, consistent with its known functions (35). Experiments are now underway to determine the relative roles of other chemokines in the transcortical migration process. Nonetheless, it is clear that the CXCL12/CXCR4 axis is critical for the initial events in this process and thus for the successful differentiation of T lymphocytes in the fully formed, steady state thymus.


    Acknowledgments
 
We thank D. Littman (New York University, New York, NY) for bone marrow from lck[Cre] and CXCR4loxP/loxP mice, L. Berg (University of Massachusetts, Worcester, MA) for advice regarding RNA in situ hybridization, K. Gordon (Memorial Sloan-Kettering Cancer Center, New York, NY) for assistance with cell sorting, and A. Viale (Memorial Sloan-Kettering Cancer Center) for microarray analysis.


    Footnotes
 
1 This work was supported by U.S. Public Health Service Grants AI33940 and AI53739 (to H.T.P.) and CA08748 (to Memorial Sloan-Kettering Cancer Center). A.L. was supported by a fellowship grant from CNPq (200722101–8 PDE). Back

2 Address correspondence and reprint requests to Dr. Howard T. Petrie, Memorial Sloan-Kettering Cancer Center, Box 341, 1275 York Avenue, New York, NY 10021. E-mail address: petrieh{at}mskcc.org Back

3 Abbreviations used in this paper: CMJ, cortico-medullary junction; DN, double negative; DP, double positive; HPRT, hypoxanthine guanine phosphoribosyl transferase. Back

Received for publication May 29, 2003. Accepted for publication August 29, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kondo, M., I. L. Weissman, K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661.[Medline]
  2. Ceredig, R., T. Rolink. 2002. A positive look at double-negative thymocytes. Nat Rev Immunol. 2:888.[Medline]
  3. Anderson, G., N. C. Moore, J. J. Owen, E. J. Jenkinson. 1996. Cellular interactions in thymocyte development. Annu. Rev. Immunol. 14:73.[Medline]
  4. Lind, E. F., S. E. Prockop, H. E. Porritt, H. T. Petrie. 2001. Mapping precursor movement through the postnatal thymus reveals specific microenvironments supporting defined stages of early lymphoid development. J. Exp. Med. 194:127.[Abstract/Free Full Text]
  5. Penit, C.. 1988. Localization and phenotype of cycling and post-cycling murine thymocytes studied by simultaneous detection of bromodeoxyuridine and surface antigens. J. Histochem. Cytochem. 36:473.[Abstract]
  6. Ceredig, R., M. Schreyer. 1984. Immunohistochemical localization of host and donor-derived cells in the regenerating thymus of radiation bone marrow chimeras. Thymus 6:15.[Medline]
  7. Brahim, F., D. G. Osmond. 1970. Migration of bone marrow lymphocytes demonstrated by selective bone marrow labeling with thymidine-H3. Anat. Rec. 168:139.[Medline]
  8. Brumby, M., D. Metcalf. 1967. Migration of cells to the thymus demonstrated by parabiosis. Proc. Soc. Exp. Biol. Med. 124:99.[Medline]
  9. Kyewski, B. A.. 1987. Seeding of thymic microenvironments defined by distinct thymocyte-stromal cell interactions is developmentally controlled. J. Exp. Med. 166:520.[Abstract/Free Full Text]
  10. Ezine, S., I. L. Weissman, R. V. Rouse. 1984. Bone marrow cells give rise to distinct cell clones within the thymus. Nature 309:629.[Medline]
  11. Dunon, D., D. Courtois, O. Vainio, A. Six, C. H. Chen, M. D. Cooper, J. P. Dangy, B. A. Imhof. 1997. Ontogeny of the immune system: {gamma}/{delta} and {alpha}/{beta} T cells migrate from thymus to the periphery in alternating waves. J. Exp. Med. 186:977.[Abstract/Free Full Text]
  12. Penit, C.. 1986. In vivo thymocyte maturation: BUdR labeling of cycling thymocytes and phenotypic analysis of their progeny support the single lineage model. J. Immunol. 137:2115.[Abstract]
  13. Prockop, S. E., S. Palencia, C. M. Ryan, K. Gordon, D. Gray, H. T. Petrie. 2002. Stromal cells provide the matrix for migration of early lymphoid progenitors through the thymic cortex. J. Immunol. 169:4354.[Abstract/Free Full Text]
  14. Orban, P. C., D. Chui, J. D. Marth. 1992. Tissue- and site-specific DNA recombination in transgenic mice. Proc. Natl. Acad. Sci. USA 89:6861.[Abstract/Free Full Text]
  15. Gordon, K. M., L. Duckett, B. Daul, H. T. Petrie. 2003. A simple method for detecting up to five immunofluorescent parameters together with DNA staining for cell cycle or viability on a benchtop flow cytometer. J. Immunol. Methods 275:113.[Medline]
  16. Suzuki, G., H. Sawa, Y. Kobayashi, Y. Nakata, K. Nakagawa, A. Uzawa, H. Sakiyama, S. Kakinuma, K. Iwabuchi, K. Nagashima. 1999. Pertussis toxin-sensitive signal controls the trafficking of thymocytes across the corticomedullary junction in the thymus. J. Immunol. 162:5981.[Abstract/Free Full Text]
  17. van Ewijk, W., B. Wang, G. Hollander, H. Kawamoto, E. Spanopoulou, M. Itoi, T. Amagai, Y. F. Jiang, W. T. Germeraad, W. F. Chen, et al 1999. Thymic microenvironments, 3-D versus 2-D?. Semin. Immunol. 11:57.[Medline]
  18. Perlmutter, R. M., J. D. Marth, D. B. Lewis, R. Peet, S. F. Ziegler, C. B. Wilson. 1988. Structure and expression of lck transcripts in human lymphoid cells. J. Cell Biochem. 38:117.[Medline]
  19. Buckland, J., D. J. Pennington, L. Bruno, M. J. Owen. 2000. Co-ordination of the expression of the protein tyrosine kinase p56lck with the pre-T cell receptor during thymocyte development. Eur. J. Immunol. 30:8.[Medline]
  20. Norment, A. M., M. J. Bevan. 2000. Role of chemokines in thymocyte development. Semin. Immunol. 12:445.[Medline]
  21. Bleul, C. C., T. Boehm. 2000. Chemokines define distinct microenvironments in the developing thymus. Eur. J. Immunol. 30:3371.[Medline]
  22. Wilkinson, B., J. J. Owen, E. J. Jenkinson. 1999. Factors regulating stem cell recruitment to the fetal thymus. J. Immunol. 162:3873.[Abstract/Free Full Text]
  23. Kim, C. H., L. M. Pelus, J. R. White, H. E. Broxmeyer. 1998. Differential chemotactic behavior of developing T cells in response to thymic chemokines. Blood 91:4434.[Abstract/Free Full Text]
  24. Norment, A. M., L. Y. Bogatzki, B. N. Gantner, M. J. Bevan. 2000. Murine CCR9, a chemokine receptor for thymus-expressed chemokine that is up-regulated following pre-TCR signaling. J. Immunol. 164:639.[Abstract/Free Full Text]
  25. Uehara, S., K. Song, J. M. Farber, P. E. Love. 2002. Characterization of CCR9 expression and CCL25/thymus-expressed chemokine responsiveness during T cell development: CD3highCD69+ thymocytes and {gamma}{delta}TCR+ thymocytes preferentially respond to CCL25. J. Immunol. 168:134.[Abstract/Free Full Text]
  26. Campbell, J. J., J. Pan, E. C. Butcher. 1999. Cutting edge: developmental switches in chemokine responses during T cell maturation. J. Immunol. 163:2353.[Abstract/Free Full Text]
  27. Poznansky, M. C., I. T. Olszak, R. H. Evans, Z. Wang, R. B. Foxall, D. P. Olson, K. Weibrecht, A. D. Luster, D. T. Scadden. 2002. Thymocyte emigration is mediated by active movement away from stroma-derived factors. J. Clin. Invest. 109:1101.[Medline]
  28. Ueno, T., K. Hara, M. S. Willis, M. A. Malin, U. E. Hopken, D. H. Gray, K. Matsushima, M. Lipp, T. A. Springer, R. L. Boyd, et al 2002. Role for CCR7 ligands in the emigration of newly generated T lymphocytes from the neonatal thymus. Immunity 16:205.[Medline]
  29. Suniara, R. K., E. J. Jenkinson, J. J. Owen. 1999. Studies on the phenotype of migrant thymic stem cells. Eur. J. Immunol. 29:75.[Medline]
  30. Zou, Y. R., A. H. Kottmann, M. Kuroda, I. Taniuchi, D. R. Littman. 1998. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393:595.[Medline]
  31. Egawa, T., K. Kawabata, H. Kawamoto, K. Amada, R. Okamoto, N. Fujii, T. Kishimoto, Y. Katsura, T. Nagasawa. 2001. The earliest stages of B cell development require a chemokine stromal cell-derived factor/pre-B cell growth-stimulating factor. Immunity 15:323.[Medline]
  32. Ara, T., M. Itoi, K. Kawabata, T. Egawa, K. Tokoyoda, T. Sugiyama, N. Fujii, T. Amagai, T. Nagasawa. 2003. A role of CXC chemokine ligand 12/stromal cell-derived factor-1/pre-B cell growth stimulating factor and its receptor CXCR4 in fetal and adult T cell development in vivo. J. Immunol. 170:4649.[Abstract/Free Full Text]
  33. Onai, N., Y. Zhang, H. Yoneyama, T. Kitamura, S. Ishikawa, K. Matsushima. 2000. Impairment of lymphopoiesis and myelopoiesis in mice reconstituted with bone marrow-hematopoietic progenitor cells expressing SDF-1-intrakine. Blood 96:2074.[Abstract/Free Full Text]
  34. Pelletier, A. J., L. J. van der Laan, P. Hildbrand, M. A. Siani, D. A. Thompson, P. E. Dawson, B. E. Torbett, D. R. Salomon. 2000. Presentation of chemokine SDF-1{alpha} by fibronectin mediates directed migration of T cells. Blood 96:2682.[Abstract/Free Full Text]
  35. Springer, T. A.. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301.[Medline]
  36. Porritt, H. E., K. Gordon, H. T. Petrie. 2003. Kinetics of steady-state differentiation and mapping of intrathymic signaling environments by stem cell transplantation in non-irradiated mice. J. Exp. Med. 198:957.[Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2003 171: 4471-4472. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
H. Yang, Y.-H. Youm, and V. D. Dixit
Inhibition of Thymic Adipogenesis by Caloric Restriction Is Coupled with Reduction in Age-Related Thymic Involution
J. Immunol., September 1, 2009; 183(5): 3040 - 3052.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y.-W. Chu, S. Schmitz, B. Choudhury, W. Telford, V. Kapoor, S. Garfield, D. Howe, and R. E. Gress
Exogenous insulin-like growth factor 1 enhances thymopoiesis predominantly through thymic epithelial cell expansion
Blood, October 1, 2008; 112(7): 2836 - 2846.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M.-H. Fortier, E. Caron, M.-P. Hardy, G. Voisin, S. Lemieux, C. Perreault, and P. Thibault
The MHC class I peptide repertoire is molded by the transcriptome
J. Exp. Med., March 17, 2008; 205(3): 595 - 610.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Svensson, J. Marsal, H. Uronen-Hansson, M. Cheng, W. Jenkinson, C. Cilio, S. E. W. Jacobsen, E. Sitnicka, G. Anderson, and W. W. Agace
Involvement of CCR9 at multiple stages of adult T lymphopoiesis
J. Leukoc. Biol., January 1, 2008; 83(1): 156 - 164.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Itoi, N. Tsukamoto, H. Yoshida, and T. Amagai
Mesenchymal cells are required for functional development of thymic epithelial cells
Int. Immunol., August 1, 2007; 19(8): 953 - 964.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Tanaka, T. Era, S.-i. Nishikawa, and S. Kawamata
Forced expression of Nanog in hematopoietic stem cells results in a {gamma}{delta}T-cell disorder
Blood, July 1, 2007; 110(1): 107 - 115.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Assarsson, B. J. Chambers, K. Hogstrand, E. Berntman, C. Lundmark, L. Fedorova, S. Imreh, A. Grandien, S. Cardell, B. Rozell, et al.
Severe Defect in Thymic Development in an Insertional Mutant Mouse Model
J. Immunol., April 15, 2007; 178(8): 5018 - 5027.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. S. Perry, R. S. Welner, T. Kouro, P. W. Kincade, and X.-H. Sun
Primitive lymphoid progenitors in bone marrow with T lineage reconstituting potential.
J. Immunol., September 1, 2006; 177(5): 2880 - 2887.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Scimone, I. Aifantis, I. Apostolou, H. von Boehmer, and U. H. von Andrian
A multistep adhesion cascade for lymphoid progenitor cell homing to the thymus
PNAS, May 2, 2006; 103(18): 7006 - 7011.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Uehara, S. M. Hayes, L. Li, D. El-Khoury, M. Canelles, B. J. Fowlkes, and P. E. Love
Premature Expression of Chemokine Receptor CCR9 Impairs T Cell Development
J. Immunol., January 1, 2006; 176(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
J. L. Curtis
Cell-mediated Adaptive Immune Defense of the Lungs
Proceedings of the ATS, December 1, 2005; 2(5): 412 - 416.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Swainson, S. Kinet, N. Manel, J.-L. Battini, M. Sitbon, and N. Taylor
Glucose transporter 1 expression identifies a population of cycling CD4+CD8+ human thymocytes with high CXCR4-induced chemotaxis
PNAS, September 6, 2005; 102(36): 12867 - 12872.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Zubkova, H. Mostowski, and M. Zaitseva
Up-Regulation of IL-7, Stromal-Derived Factor-1{alpha}, Thymus-Expressed Chemokine, and Secondary Lymphoid Tissue Chemokine Gene Expression in the Stromal Cells in Response to Thymocyte Depletion: Implication for Thymus Reconstitution
J. Immunol., August 15, 2005; 175(4): 2321 - 2330.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Vielkind, M. Gallagher-Gambarelli, M. Gomez, H. J. Hinton, and D. A. Cantrell
Integrin Regulation by RhoA in Thymocytes
J. Immunol., July 1, 2005; 175(1): 350 - 357.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. A. Wysocki, A. Panoskaltsis-Mortari, B. R. Blazar, and J. S. Serody
Leukocyte migration and graft-versus-host disease
Blood, June 1, 2005; 105(11): 4191 - 4199.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Liu, T. Ueno, S. Kuse, F. Saito, T. Nitta, L. Piali, H. Nakano, T. Kakiuchi, M. Lipp, G. A. Hollander, et al.
The role of CCL21 in recruitment of T-precursor cells to fetal thymi
Blood, January 1, 2005; 105(1): 31 - 39.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
V. McNeil Coffield, W. S. Helms, Q. Jiang, and L. Su
G{alpha}13 Mediates a Signal That Is Essential for Proliferation and Survival of Thymocyte Progenitors
J. Exp. Med., November 15, 2004; 200(10): 1315 - 1324.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Ueno, F. Saito, D. H.D. Gray, S. Kuse, K. Hieshima, H. Nakano, T. Kakiuchi, M. Lipp, R. L. Boyd, and Y. Takahama
CCR7 Signals Are Essential for Cortex-Medulla Migration of Developing Thymocytes
J. Exp. Med., August 16, 2004; 200(4): 493 - 505.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Misslitz, O. Pabst, G. Hintzen, L. Ohl, E. Kremmer, H. T. Petrie, and R. Forster
Thymic T Cell Development and Progenitor Localization Depend on CCR7
J. Exp. Med., August 16, 2004; 200(4): 481 - 491.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. M. Witt and E. A. Robey
The Ins and Outs of CCR7 in the Thymus
J. Exp. Med., August 16, 2004; 200(4): 405 - 409.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Tabrizifard, A. Olaru, J. Plotkin, M. Fallahi-Sichani, F. Livak, and H. T. Petrie
Analysis of Transcription Factor Expression during Discrete Stages of Postnatal Thymocyte Differentiation
J. Immunol., July 15, 2004; 173(2): 1094 - 1102.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
W. Savino, D. A. Mendes-da-Cruz, S. Smaniotto, E. Silva-Monteiro, and D. M. S. Villa-Verde
Molecular mechanisms governing thymocyte migration: combined role of chemokines and extracellular matrix
J. Leukoc. Biol., June 1, 2004; 75(6): 951 - 961.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kwan and N. Killeen
CCR7 Directs the Migration of Thymocytes into the Thymic Medulla
J. Immunol., April 1, 2004; 172(7): 3999 - 4007.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plotkin, J.
Right arrow Articles by Petrie, H. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plotkin, J.
Right arrow Articles by Petrie, H. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS