The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agadjanyan, M. G.
Right arrow Articles by Weiner, D. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agadjanyan, M. G.
Right arrow Articles by Weiner, D. B.
The Journal of Immunology, 2003, 171: 4311-4319.
Copyright © 2003 by The American Association of Immunologists

Costimulatory Molecule Immune Enhancement in a Plasmid Vaccine Model Is Regulated in Part Through the Ig Constant-Like Domain of CD80/86 1

Michael G. Agadjanyan*,{ddagger}, Michael A. Chattergoon*, Mark J. Holterman§, Behjatolah Monzavi-Karbassi*, J. Joseph Kim*, Tzvete Dentchev*, Darren Wilson*, Velpandi Ayyavoo*, Luis J. Montaner{dagger}, Thomas Kieber-Emmons*, Rafick-P. Sekaly and David B. Weiner2,*

* Department of Pathology and Laboratory Medicine, University of Pennsylvania, School of Medicine, and {dagger} The Wistar Institute, Philadelphia, PA 19104; {ddagger} Institute for Molecular Medicine, Huntington Beach, CA 92649; § Department of Surgery, University of Illinois, Chicago, IL 60612; and Centre de Recherche du Centre hospitalier de l’Université de Montréal, Montreal, Québec, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There is great interest in understanding the role of costimulatory molecules in immune activation. In both the influenza and HIV DNA immunization models, several groups have reported that coimmunization of mice with plasmids encoding immunogen and CD86, but not CD80, effectively boosts Ag-specific T cell activation. This difference in immune priming provided an opportunity to examine the functional importance of different regions of the B.7 molecules in immune activation. To examine this issue, we developed a series of chimeric CD80 and CD86 constructs as well as deletion mutants, and examined their immune activating potential in the DNA vaccine model. We demonstrate that the lack of an Ig constant-like region in the CD80 molecule is critically important to the enhanced immune activation observed. CD80 C-domain deletion mutants induce a highly inflammatory Ag-specific cellular response when administered as part of a plasmid vaccine. The data suggest that the constant-like domains, likely through intermolecular interactions, are critically important for immune regulation during costimulation and that engineered CD80/86 molecules represent more potent costimulatory molecules and may improve vaccine adjuvant efficacy.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well established that one of the principal costimulatory pathways for naive T cells is initiated when, in the context of a primary signal delivered through the TCR, the CD28 TCR engages B7 molecules (CD80 or CD86) on APC (1, 2). T cell activation is also regulated by the CTLA-4 (CD152) TCR: modulatory signals to T cells are delivered upon binding of CTLA-4 to the same CD80 or CD86, and functional knockouts of these molecules demonstrate the phenotype of chronic T cell activation (3, 4, 5, 6). CD80/86 engagement of CTLA-4 and CD28 also drives opposing responses in activated T cells. Specifically, CD28 engagement increases IL-2 mRNA stability, enhances production of this cytokine (7), and up-regulates Bcl-xL and other antiapoptotic genes that facilitate effector T cell expansion (8). This signal also drives the accumulation of CTLA-4 at the immunological synapse thereby promoting the interaction of CTLA-4 and CD80/86 molecules (9). Accumulation of CTLA-4 eventually leads to engagement and signaling through CTLA-4. This initiates inhibitory signals to the T cell: IL-2 is reduced, and expression of molecules critical to T cell expansion such as cyclin D3, cyclin dependent kinase-4 and -6 are suppressed (4, 5, 10).

CD80 and CD86 are members of the Ig gene superfamily. Both molecules have a cytoplasmic tail (T domain), a trans-membrane spanning domain (TM) 3 as well as two extracellular Ig-like domains: the N-terminal domain most closely resembles the Ig variable-like region (V-domain) and the membrane proximal domain shows homology with the Ig constant-like domain (C-domain) (11, 12). Amino acid substitution studies have shown that both the V- and C-domains of the CD80 and CD86 molecule are important in CTLA-4 binding and immune suppression activity (13, 14, 15, 16, 17). In contrast, T cell activation can be accomplished in the presence of C-domain-deleted mutant molecules, suggesting that CD28 stimulatory function can be ascribed to binding of the V-domain in isolation (18, 19). However, most of these experiments were performed in vitro, with purified fusion proteins or with mutant molecules expressed in transfected cell lines, not in vivo. Recent confounding structural studies have illustrated that direct contact occurs between only the V-domain of CD80 or CD86 and the CTLA-4 inhibitory molecule. In contrast, there is no direct connection between the C-domain of CD80 or CD86 and CTLA-4 (20, 21). This conflict in data suggests that an important limitation in our understanding of the biology of these molecules and their interactions remains unclear.

Of relevance, in a DNA immunization model, the cDNA for an HIV env glycoprotein was injected alone or in combination with cDNA encoding human CD80 and CD86 (22, 23). In this model, CD86 was a very effective "molecular adjuvant" eliciting a strong CTL response. In contrast, CD80 was unable to provide the costimulatory signal required for expansion of the immune response and little CTL were elicited. Identical results were reported by other groups studying immune responses in both the influenza and HIV models using a DNA immunogen covaccinated with plasmids encoding murine CD80 and CD86 (24, 25), illustrating the parity of these Ags in the two model systems. Recent use of B7 knockout mice in vaccine studies has confirmed that induction of immune responses to a DNA encoded Ag is critically dependent on B7-2, but not B7-1 (26). A follow-up study by this group also concluded that the timing of expression of B7.1 versus B7.2 was important in this knockout model system (27). Accordingly, the CD80/CD86-related costimulation pathways might be used to manipulate the immune response in vaccination and gene therapy techniques. In this regard, it is important to explore further the outcome of the complex interplay between CD28/CTLA-4 and CD80/CD86 molecules in a relevant in vivo model.

To further investigate the functional differences between CD80 and CD86 in the induction of an immune response after DNA immunization, we focused on the domain structure of the B7 molecules. We hypothesized that the observed activities may segregate along the separate external domains of these molecules. Importantly, dramatic improvement in in vivo costimulation was observed after removal of the C-domain of CD80. Expression of these deletion mutants increased both inflammation at the site of injection and the CTL response. These data suggest that the C-domain plays an important role in controlling the potency of the so-called second-signal to the T cell. Potentially this might be explained by the hypothesis that the C-domain is needed to stabilize the interaction between CTLA-4 and the CD80 molecule; further, this stabilization likely dominates the activity of CD86 for its interaction with CD28.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of constructs

A DNA vaccine construct encoding the HIV-1MN envelope protein (pcEnv) was prepared as previously described (28). Human CD80 and CD86 genes were cloned from a B cell cDNA library (Clontech Laboratories, Palo Alto, CA) and placed into the pSR{alpha}neo1+ expression vector. Gene expression in this vector is under the control of the SR{alpha} promoter that is composed of the SV40 early promoter and the R-segment and part of the U5 sequence (R-U5') of the long terminal repeat of human T cell leukemia virus (HTLV)-1 (29). CD80 and CD86 genes were PCR amplified (30) and ligated into pSR{alpha}neo1+ downstream of the SR{alpha} promoter to make pCD80 and pCD86 expression vectors. The chimeric and truncated variants of these genes (Table I) were generated by PCR amplification using the Expand High Fidelity Polymerase system (Boehringer Mannheim, Mannheim, Germany). For construction of all these forms of costimulatory molecules, we used pCD80 or pCD86 as the PCR templates. The following primers have been used in these reactions: A, CTGCTTGCTCAACTCTACGTC (forward, vector); B, CTGAAGTTAGCTTTGACTGATAACG (reverse, CD80); C, GCAATAGCATCACAAATTTCA (reverse, vector); D, TCAGTCAAAGCTAACTTCAGTCAACC (forward, CD86); E, GGGAAGTCAGCAAGCACTGACAGTTC (reverse, CD86); F, TCAGTGCTTGCTGACTTCCCTACACC (forward, CD80); G, TCTTGCTTGGCTTTGACTGATAACGTCAC (reverse, CD80); H, TCAGTCAAAGCCAAGCAAGAGCATTTTCC (forward, CD80); I, TCCTCAAGCTCAAGCACTGACAGTTC (reverse, CD86); J, TCAGTGCTTGAGCTTGAGGACCC (forward, CD86); K, TCTGGATCCTCATCTTGGGGCA (reverse, CD80); L, TCTGGATCCTCATTTCCATAG (reverse, CD86).


View this table:
[in this window]
[in a new window]
 
Table I. Wild-type, chimeric, or truncated forms of CD80 and CD86 moleculesa

 
The V-domain of CD80 was amplified using A and B primers, the C-domain, TM, and cytoplasmic tail of CD86 were amplified using C and D primers. These fragments were then purified, combined, and used as templates in second step PCR using forward (A) and reverse (C) primers. The PCR product was ligated into the pSR{alpha}neo1+ vector and the resultant plasmid (pV80C86T86) encodes a chimeric costimulatory molecule expressing the V-domain of CD80 and C-domain and T regions of CD86. The chimeric crossover point is at the conserved alanine 106 in CD80 and alanine 111 in CD86 position and respects the exon boundary. The plasmid pV86C80T80 was created in a similar manner using primers A + D, and C + F as the first step and the resulting fragments combined and expanded with the A + C primers. A truncated form of the costimulatory molecule without the C-domain (pV80C{Delta}T80) was also prepared by a two-step PCR technique. In the case of pV80C{Delta}T80, the CD80 V-domain was amplified using the A and G primer. The TM/T fragments of the C-domain truncated molecule were amplified using C/H primers in case of pV80C{Delta}T80. The resultant constructs were prepared by amplification and cloning of the PCR products into the pSR{alpha}neo1+ expression vector. All chimeric and truncated constructs as well as the wild-type molecules were cloned into the SR{alpha}neo1+ vector. All clones were sequenced through the promoter regions on the 5' end and through the poly-A site on the 3' end.

Expression of plasmids encoding CD80/86 costimulatory molecules

Expression of all constructs listed in Table I was analyzed by immunofluorescence microscopy and flow cytometry. Human rhabdomyosarcoma (RD) cells were transfected with experimental or control plasmids by electroporation (500 µF, 250 V) using Gene Pulse (Bio-Rad, Hercules, CA) as described (30). For immunofluorescence assay transfected cells were incubated first with anti-CD80 or anti-CD86 mAbs and then with FITC-labeled goat-anti mouse IgG. For FACS analysis, RD cells were cotransfected with the construct of interest and green fluorescent protein expression vector (10 µg pEGFP from Clontech Laboratories). The latter was used as a control plasmid for calculation of the transfection efficiency. The expression of experimental plasmids was confirmed, using labeled mAbs to the V-domain of CD80 or CD86 molecules (BD PharMingen, San Diego, CA) (14). Data were acquired using FACScan and analyzed using CellQuest (BD Immunocytometry Systems, San Jose, CA). Expression of CD80 and 86 on activated and resting dendritic cells was detected by flow analysis.

Plasmid formulation and immunization of animals

BALB/c mice were immunized by i.m. injection as previously described (28). We selected the dose of DNA immunogen to maximize the enhancement of antiviral immune responses provided by the simultaneous delivery of different molecular adjuvants and immunogen. The pcEnv was injected i.m. alone or adjusted to concentration with vector backbone (to control for nonspecific backbone effects). For experimental groups, a mixture of 50 µg of pcEnv plus 50 µg of the various CD80/86 constructs were mixed prior to the infection and delivered i.m. into the quadriceps muscle. Two weeks after the last immunization, splenocytes were harvested from experimental and control animals and used for determination of T cell responses and cytokine production. Importantly, immunization of mice with DNA encoding human CD80 or CD86 or chimeras did not induce mouse polyclonal Abs against these molecules as demonstrated by specific ELISA analysis (data not shown).

Histopathology of plasmid immunization site

The quadriceps muscle at the site of injection was examined for lymphocyte infiltration as previously described (24). Briefly, mouse quadriceps muscle was immunized with 50 µg of pcEnv mixed with 50 µg of experimental CD80/CD86 plasmids or control plasmids. Five days after inoculation, the mice were sacrificed and their quadriceps muscles were harvested. The fresh muscle tissue was then frozen in OCT compound (Sakura Finetek, Torrance, CA) and 4-µm frozen sections were made. The degree of inflammation was determined by examining H&E-stained muscle sections.

Differentiation of dendritic cells from the bone marrow

The femur and tibia were isolated from 8-wk-old naive BALB/c mice. The ends of the bone were cut and the bone marrow plug was removed by flushing the shaft of the bone with sterile media. The cells of the marrow plug were resuspended and erythrocytes lysed with ACK buffer. The bone marrow was then plated in tissue culture-treated plates (Falcon-3003) in Iscove’s medium 10% FBS supplemented with 50 ng/ml recombinant murine GM-CSF (R&D Systems, Minneapolis, MN) for 7 days before use in experiments or analysis.

Flow cytometry assay

For flow cytometry analysis, 3–5 x 105 cells were washed twice in FACS buffer (1% BSA, in 1x PBS) and incubated for 30 min at 4°C with fluorochrome-labeled isotype-matched control Ig or labeled Abs against CD11c, CD80, and CD86 (BD PharMingen). The cells were washed twice in FACS buffer and fixed in PBS containing 1% paraformaldehyde. Analysis was performed on a Coulter EPICS Flow Cytometer (Fullerton, CA).

CTL assay

A 5-h 51Cr-release CTL assay was performed as previously described (30). As target cells we used P815 cells infected with the recombinant (vMN462, specific) or with wild-type (WR, nonspecific) vaccinia virus. Both target cells were labeled with 100 µCi/ml Na251CrO4 and mixed with effector cells at E:T ratios ranging from 50:1 to 12.5:1. The percent-specific lysis was determined as described (30). An assay was not considered valid if the value for the "spontaneous release" counts were in excess of 20% of the "maximum release." To calculate specific lysis of targets, the percent lysis of nonspecific targets was subtracted from the percent lysis of specific targets.

Quantification of IFN-{gamma} production

The relative level of various cytokines released by immune cells reflects the direction and magnitude of the immune response. Therefore, we collected supernatant from the effector cells stimulated in vitro for CTL assay and tested them for IFN-{gamma} release using appropriate ELISA kits (Biosource International, Camarillo, CA) (23, 31).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of CD80/86 chimeric constructs

To map the functional domains of CD80 (pV80C80T80) and CD86 (pV86C86T86) molecules in the activation of the CTL response by DNA immunization, we constructed chimeric forms of these molecules (Table I). The constructs were generated as described in Materials and Methods, sequenced, and tested for expression by in vitro transfection assays (Fig. 1). For this analysis, we prepared transiently transfected RD cell lines, after 48 h, we analyzed expression of the constructs using Abs specific for the V-domain of either CD80 or CD86. Fig. 1 demonstrates the ability of anti-V-domain CD80 mAb to detect protein expression in RD cells transfected with pV80C80T80 and pV80C86T86. Conversely anti-V-domain CD86 mAb detects protein expression in RD transfected with pV86C86T86 and pV86C80T80. These data support the ability of these constructs to express the chimeric Ags.



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of plasmids encoding wild-type and chimeric forms of CD80/86. RD cells were transfected with the appropriate constructs and incubated for 2 days in T25 flasks before transferring the cells onto Falcon culture slides (BD Biosciences). The following day, the cells were washed, fixed with methanol (30', room temperature), and incubated with anti-CD80 (Beckman Coulter, Fullerton, CA) or CD86 (BD PharMingen) mouse mAbs (1.5 h, 37°C) against the V-region of these molecules and developed with FITC-labeled goat-anti mouse IgG (Boehringer Mannheim). Slides were viewed with a Nikon OPTIPHOT fluorescence microscope (Nikon, Tokyo, Japan) and photographs were obtained. The data are representative of two independent experiments with similar results.

 
Adjuvant properties of CD86 segregate with the V-domain

Previous reports have established that (pV86C86T86) is a better immune adjuvant than (pV80C80T80) in DNA vaccine models (22, 23, 24, 25, 26). We hypothesized that this activity would segregate with the external binding portions of the molecule. To test whether adjuvant activity segregates with the V- or the C-domain of these molecules we covaccinated cDNA, encoding human CD86 (pV86C86T86) or CD80 (pV80C80T80) or mutant molecules along with the plasmid immunogen pcEnv. Two weeks after the last immunization, Ag-specific CTL responses were analyzed from the cultures of splenocytes.

As previously reported, coimmunization with pV86C86T86, but not pV80C80T80, significantly enhanced Ag-specific CTL activity above the level achieved with the plasmid Ag alone (~5-fold at 50:1 E:T) (Fig. 2A). Among mice immunized with the V-domain chimeras, the V-domain swap mutant pV80C86T86 had a similar adjuvant activity to pV86C86T86, both plasmids induce specific CTL >30% at 50:1 E:T ratio. However, the converse construction, pV86C80T80, did not boost antiviral responses and this molecule functioned similarly to native pV80C80T80 (<20% specific CTL). Yet, in all cases, covaccination with a costimulatory molecule increased the specific CTL above the resulting CTL in animals immunized with pcEnv alone. This data was corroborated by IFN-{gamma} production upon Ag restimulation. Splenocytes from pV80C86T86 coimmunized animals, as well as pV86C86T86, produced significant quantities of IFN-{gamma} (>500 pg/ml) as compared to mice immunized pV86C80T80, the wild-type pV80C80T80, both <100 pg/ml (Fig. 2B). Altogether these results suggest that V-domains, although important in the binding of CD28 and or CTLA-4, do not control the magnitude of the T cell response.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 2. Plasmid CD86 elicits strong CTL and IFN-{gamma} activity, no dependence on V-region. A, Groups of three mice were immunized with pcEnv alone or in conjunction with wild-type pV86C86T86, wild-type pV80C80T80, pV80C86T86, or pV86C80T80 as described in Table I and in Materials and Methods. Two weeks after the last immunization, splenocytes from all experimental and control animals were isolated and viral-specific CTL evaluated. The data are representative of at least three independent experiments with similar results. B, Splenocytes from all experimental and control animals were isolated and restimulated with recombinant envelope protein. Supernatants from these cultures were tested for levels of soluble IFN-{gamma} by ELISA. These experiments have been repeated twice with similar results.

 
CD80 C-domain is a negative regulator of costimulatory molecules adjuvant properties

In a similar manner, we determined the adjuvant activity of the C-regions of CD80 and CD86. C-region swaps were generated as described in Table I and tested as described previously. Among mice immunized with the B7 chimeras, the wild-type pV86C86T86 and C-domain swap mutant pV80C86T80 had a similar adjuvant activity: both plasmids induce specific CTL >40% at a 50:1 E:T ratio and >500 pg/ml IFN-{gamma} secretion upon Ag restimulation (Fig. 3). However, the converse construction, pV86C80T86, did not boost antiviral responses and this molecule functioned similarly to native pV80C80T80 (<20% specific CTL). Again, vaccination with a costimulatory molecule increased the specific CTL above the resulting CTL in animals immunized with pcEnv alone. These results suggest that it is the combination of the V- and C-domains that determines the adjuvant activity of the costimulatory molecule; this concept is consistent with the hypothesis that the C-domain of CD80 imparts a regulatory signal to either the CD80 or 86 V-domains thus affecting its ability to stimulate T cells. The data also indicate that the C-domain of CD86 does not exert a similar negative effect, thus it is likely that the C-domain of CD80 is particularly important for interactions with CTLA-4.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Induction of strong CTL and IFN-{gamma} activity segregates with the C-region of CD86. A, Groups of three mice were immunized with pcEnv alone or in conjunction with wild-type pV86C86T86, wild-type pV80C80T80, pV86C80T86, or pV80C86T80 as described in Table I and in Materials and Methods. Two weeks after the last immunization, splenocytes from all experimental and control animals were isolated and viral-specific CTL evaluated. The data are representative of at least three independent experiments with similar results. B, Splenocytes from all experimental and control animals were isolated and restimulated with recombinant envelope protein. Supernatants from these cultures were assayed for levels of soluble IFN-{gamma} by ELISA. These experiments have been repeated twice with similar results.

 
CD80 C-Domain exerts a dominant-negative effect on costimulation

To test this hypothesis, we constructed a mutant in which the entire C-domain of CD80 was deleted and the V-domain was directly fused to the membrane spanning the domain and tail of CD80 (Table I). We hypothesized that if the C-domain of CD80 were important for CTLA-4 binding then this molecule would function more like CD86 than CD80. Deletion of C-domains did not influence the expression of these constructs. Fig. 4C demonstrates protein expression in RD cells transfected with the pV80C80T80 and pV86C86T86 C-domain deletion mutants: pV80{Delta}CT80 and pV86{Delta}CT86 (Fig. 4, A and B). We compared these molecules to pV80C80T80 and pV86C86T86 in the DNA immunization model. Interestingly, the immune response was quite strong in the absence of the CD80 C-domain deletion (pV80{Delta}CT80) as evidenced by the CTL elicited: >50% at the E:T of 25:1, while pV86C86T86 induced <50% specific CTL at this E:T (Fig. 4C). In fact, in repeated assays the CTL induction appears stronger for the CD80 C-domain deletion mutant than the CD86 molecule (n = 4). Analysis of IFN-{gamma} cytokine secretion suggests a similar trend (Fig. 4D): splenocytes from mice coimmunized with the pV80{Delta}CT80 plasmid produce >800 pg/ml IFN-{gamma} upon restimulation in vivo ~10-fold higher than the wild-type pV80C80T80 construct. Furthermore, these results also suggest that the interactions between CD28 and only the V-domain of CD80 and CD86 are sufficient for effective costimulation in vivo. These results are in agreement with recent structural studies of these molecules and support the hypothesis that the C-domain of the CD80 molecule has an inhibitory function on the initiation of a cellular immune response.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 4. C-domain of CD80 is inhibitory. CTL (A) and IFN-{gamma} (B) priming were measured in mice immunized with pcEnv, pcEnv along with wild-type pV86C86T86 and pV80C80T80, or C-domain-deleted constructs as described in Materials and Methods. Two weeks after the last injection, splenocytes from all experimental and control animals were isolated and used for detection of antiviral CTL responses and IFN-{gamma} production by ELISA. The data are representative of at least three independent experiments with similar results for CTL and two independent experiments for IFN-{gamma} ELISA. Three mice were used in each group for each independent experiment.

 
CD80 C-domain deletion mutant induces greater lymphocyte infiltration

Lymphocyte infiltration is an in vivo indicator of inflammation and immune activation. We have previously reported a markedly greater infiltration of CD4+ and CD8+ lymphocytes into the muscle of mice coimmunized with pcEnv and pV86C86T86, but not pcEnv and pV80C80T80 (23). Remarkably, we observed that the infiltration was further enhanced in the muscle of mice coimmunized with pcEnv and pV80{Delta}CT80 as compared to mice coimmunized with pcEnv+ pV86C86T86 (Fig. 5). Therefore these results imply again that deletion of the C-domain changes the costimulatory properties of CD80 to resemble those of wild-type CD86.



View larger version (126K):
[in this window]
[in a new window]
 
FIGURE 5. Lymphocytic infiltrate in the muscle at the site of immunization. Infiltration of cells in the muscle following single i.m. injection with a mixture of the plasmid immunogen and the plasmid encoding wild-type pV86C86T86, wild-type pV80C80T80, or CD80 C-domain-deleted construct. Wild-type CD86 (B) and in particular the C-domain deleted CD80 (D) induced much higher infiltration of inflammatory cells into the muscle of immunized animals, than wild-type CD80 (C). Frozen muscle sections were prepared as described in Materials and Methods and stained with H&E (51 ). Slides from sham-immunized controls (A) and experimental animals are shown at x10 and x40 magnification.

 
Dendritic cell expression of CD80 expression is increased upon activation

The expression pattern of CD80 and CD86 were analyzed on bone marrow-derived dendritic cells. Dendritic cells (CD11c+) were prepared as described in Materials and Methods. The dendritic cells were then cultured in medium alone (Fig. 6A) or in the presence of (1 µg/ml) LPS (Fig. 6B) for 12 h, after which expression of the costimulatory molecules was then analyzed by flow cytometry. As shown, prior to activation dendritic cells express low levels of CD80 as compared to CD86. Upon activation of the dendritic cell, CD80 expression increases and reaches levels comparable to CD80.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Dendritic cell expression of CD80 and CD86. Dendritic cells were generated in vitro by culture of the bone marrow with recombinant GM-CSF. Dendritic cells derived in this manner are CD86high/low, and CD80high/low at 7 days in culture (A), indicating this is the phenotype of the "immature," dendritic cell. Upon stimulation with LPS (B), the dendritic cells maintain their CD86 expression but significantly increase (10-fold) their expression of CD80, suggesting that this is the phenotype of the "mature" dendritic cell.

 
Loss of the CD80 C-domain prevents modulation of the immune activating signal

We then tested coimmunization with pV86C86T86 and pV80C80T80 as well as the CD80 C-deletion mutant pV80{Delta}CT80. A C-domain interaction model would predict that the pV86C86T86 + pV80C80T80 coimmunization would actually result in a negative signal. In contrast, the pV86C86T86 + pV80{Delta}CT80 C-deletion should still result in the strong positive signal as the pV80{Delta}CT80 cannot stabilize significant dimer formation. In fact, this was the result observed, the combination of pV86C86T86 and pV80{Delta}CT80 provided a very strong immune activation signal and primed for very strong CTL activity. As expected, the combination of pV86C86T86 + pV80C80T80 resulted in a lower CTL activity as compared to the wild-type CD86 alone. The results support the hypothesis that the negative interactions between the C-domains contribute to loss of the positive costimulatory signal (Fig. 7) observed in this model.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. Loss of the CD80 C-domain prevents modulation of the immune-activating signal. Mice were immunized with either pcEnv alone or mixed with the CD80 wild-type, or CD80 C-domain deletion or both CD80 and CD86 wild-type or both CD86 and CD80 C-domain deletions. The CTL response was muted in CD80 + CD86 wild-type immunized animals. In contrast, the CTL response was not muted in the CD80C deletion + CD86 wild.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Manipulation of the quantitative and qualitative immune response to an Ag through manipulation of costimulatory molecule structure has important implications for immune therapy and vaccination. In this report, we demonstrate that the CD80 C-domain has a negative/regulatory effect on the immune response to a plasmid DNA vaccine. In previous work, using multiple Ags in the murine DNA immunization model, we as well as others demonstrated that homologous and heterologous CD86 molecules costimulate T cells more effectively than CD80 (Figs. 2 and 3) (24, 25, 30, 32). This is manifested by increased inflammatory cytokine production and viral-specific CTL activity upon Ag challenge and dramatic lymphocyte infiltration at the injection site (23). Although further investigation is required to refine these observations, the majority of reported studies agree that codelivery of plasmid CD86 and not CD80 in the DNA vaccine model induces a potent signal, which either initiates or expands in vivo cellular immune responses.

Additionally, functional differences between CD80 and CD86 have been documented in many disease models (24, 25, 30, 32, 33, 34, 35, 36, 37) including HIV infection (38, 39, 40, 41, 42), where continuous CD28 signaling of HIV-1-infected cultured T cells resulted in viral clearance, whereas CTLA-4 signaling allowed for virus propagation (39, 40, 41, 43). These results already suggest that there are differences between CD80 and CD86 leading to different functional interactions with CD28 and CTLA-4 receptors. These differences may be due to a combination of several factors including differential expression patterns, timing and location, differences in binding affinities to CD28 and CTLA-4, and differences in signals sent through the APC upon CD80 vs CD86 cross-linking (3, 4, 5, 6). In the present study, temporal differences in expression were not likely as we transfected CD80 and CD86 simultaneously and their expression levels appear similar (data not shown).

We address the differences in CD80/86 interaction with CD28 and CTLA-4, by first constructing chimeras of the B7 molecules then by looking for segregation of their costimulation potential with a particular domain. Chimeric pV80C86T86 as well as pV86C86T86, but not pV80C80T80, enhanced T cell activation (Fig. 2). These results suggest that the V-domains of both CD80 and CD86 are sufficient to activate T cells through CD28. These data also confirm that the C-domain and the cytoplasmic tail of CD86 are important for T cell activation. Of note, the opposite construction, pV86C80T80, did not provide the necessary costimulatory signal for Ag-specific T cell stimulation. Thus, the CD80 C-domain appears to have an inhibitory or regulatory role in T cell activation. For example, the C-domain-deleted mutant of CD80 demonstrated significantly increased T cell activation in these experiments, whereas the wild-type molecule did not (Fig. 4).

The data suggest that the CD80 C-domain is not only poor at supporting T cell activation, but also affects the structure/function relationships of this molecule with CTLA-4. Earlier studies using site-directed mutagenesis experiments have investigated the structure/function relationships of CD80/86 and CD28/CTLA-4 molecules (13, 14, 15, 16, 17). Collectively, these studies have implicated >20 residues in both the V- and C-domains of CD80 critical for CTLA-4 binding. Importantly, addition of only two amino acids between the V- and C-domains of CD80, but not those of CD86 had a profound effect on CTLA-4 binding (13). It has been also reported that deletion of the C-domain of CD80 had a greater effect on binding to CTLA-4-Ig than CD28-Ig (17). Interestingly, Inobe et al. (19, 44) isolated a functionally active, alternatively spliced form of CD80 that lacks the C-domain from the spleen and lymph nodes of mice. This molecule binds to CD28-Ig very well (comparable to CD80), although its binding to CTLA-4 was suppressed significantly (44). Most recently, the structural interactions between CTLA-4 and CD80/86 have been defined at the molecular level (20, 21). These studies clearly demonstrate that there is no direct connection between the C-domain of CD80 and CTLA-4. This suggests that the C-domain changes the conformation of the V-domain so that binding to CTLA-4 is compromised in its absence and facilitated by its presence. All contacts are manifest through the V-region of CD80. Taken together, prior studies and the results presented in this paper suggest that the two domains of CD80, and to a lesser extent CD86, interact in a functionally important way that collectively affect CTLA-4 binding.

Recent studies report that T cell inactivation is mediated, at least in part, through CTLA-4 interactions with the TCR-{zeta} chain (45). Our data indicate that both the V- and C-domains of CD80 are essential for CTLA-4 functional activity and may imply that the subsequent inhibitory signal of CTLA-4 overrides a simultaneously transmitted CD28 activation signal. The predominance of CTLA-4 signaling over CD28 has been demonstrated in recent reports in which CD28 activation pathways were directly inhibited as a result of simultaneous CTLA-4 cross-linking (45, 46, 47, 48, 49). Because CD80 can bind to both CD28 and CTLA-4, there must be important structural differences that shift the equilibrium in favor of the CTLA-4 inhibition pathway over the CD28 activation pathway. A careful analysis of the amino acid sequence of CD86 and CD80 (15, 16, 17) and alignment with the Ig consensus sequence using CLUSTALW (50), reveals some interesting differences in the C-domain of CD80 and CD86 that may affect CTLA-4 binding (data not shown). Projecting these amino acid sequence differences onto the sB7-1 crystal structure (46), we have identified four extra amino acids either in the B-C loop (insertion 144–147 KKMS) or in the C-D loop (insertion 150–153 LRTK) in the CD86 molecule. Both inserts contain two positive amino acids, one nonpolar amino acid, and one uncharged polar residue. Therefore, it seems likely that these insertions would change the conformation of the B-C or C-D loop of the CD86 molecule in comparison to CD80. As CTLA-4 does not directly bind to these residues, alterations in this area may affect CTLA-4 binding through prevention of important postbinding conformational change and/or altered dimerization capacity. In addition, it was also proposed by the crystal structure of B7-1/CTLA-4, that the glycosylation of Asn 173 located on the C-domain could have a profound effect on the stabilization of the B7-1 dimers (21). Thus, the C-domain likely stabilizes the interaction of the B7-1 dimers, as well as with CTLA-4. Thus the presence of the C-domain of CD80 in muscle cells transfected with wild-type CD80 seems to have a very early inhibitory effect on the inflammation (Fig. 5), which coincides with a preferential binding to and signaling through CTLA-4. This interaction probably relates to secondary structural interactions.

These data suggest a hypothesis for immune regulation involving the C-domains during costimulation by CD80/86. A recent study by Santra and coworkers (27) suggested that in dual CD80/86 KO mice either CD80 or CD86 was a strong positive signal in a plasmid vaccine model. Furthermore detailed structural analysis of the molecular interactions between CD80 or CD86 and CTLA-4 (20, 21) report that there is no interaction between the C-domains of these molecules and their ligands. However, through interactions between the C-domains, CD80 or 86, do form specific homodimers. Furthermore, these interactions are likely not equal. It is possible that the CD80 C-domain has a stronger interaction with another CD80 molecule through the C-domain than CD86 has with CD86. A simple model that would explain the data reported here and be consistent with the literature would suggest that when both molecules are coexpressed then a null or off signal is delivered through the greater stabilization and interaction of CD80 vs CD86. This stabilization coupled with the higher affinity of CD80 for CTLA-4 would shift the balance of the interaction between CTLA-4 and CD80 leading to the off signal. Furthermore, we would speculate that heterodimers do not provide a strong on signal as they could interfere with homodimer formation. This would explain the result reported by Santra and is consistent with the prior DNA immunization work. To test this hypothesis, we first examined the timing of expression of CD80 vs CD86 on dendritic cells (Fig. 6). Consistent with the hypothesis, CD86 is activated initially and then CD80 expression dramatically increases. This again supports transition from the initial strong positive signal to the later negative signal.

This model provides important testable hypotheses for further enhancement of the immune response and importantly provides a simple method for designing inhibitors of the CD80/86 pathway by blocking the interactions of the C-domains, which should inhibit immune responses as well. Furthermore, the engineered form of the B7 ligand may be particularly useful as a vaccine adjuvant seeking to maximize the positive immune response. Conversely, it may be possible to engineer a form of the B7 ligand that includes the CD80 C-domain that could inactivate an ongoing human immune response. Such a construct may have important applications for transplantation tolerance or in the treatment of autoimmune disease. Further investigation of the engineering of novel costimulatory molecules likely is an important area for immune manipulation.


    Acknowledgments
 
We thank Kaity Lin, Fariba Jousheghany, Monica Viveros Rogel, Habibollah Rahbar, Antony Tsai, Chenthamarakshan Vasu, and Amy Wang for technical support, and the National Institutes of Health Aids Research Reagent Program for providing several HIV plasmids.


    Footnotes
 
1 This work was supported by National Institutes of Health Awards P01-AI-48241, P01-AI-05397, and U01-AI-54988 (to D.B.W.). Back

2 Address correspondence and reprint requests to Dr. David B. Weiner, Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, 505 Stellar-Chance Laboratories, 422 Curie Boulevard, Philadelphia, PA 19104. E-mail address: dbweiner{at}mail.med.upenn.edu Back

3 Abbreviations used in this paper: TM, trans-membrane spanning domain; V-domain, variable-like region; C-domain, constant-like region; HTLV, human T cell leukemia virus; RD, rhabdomyosarcoma. Back

Received for publication January 13, 2003. Accepted for publication July 30, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Green, J. M., P. J. Noel, A. I. Sperling, T. L. Walunas, G. S. Gray, J. A. Bluestone, C. B. Thompson. 1994. Absence of B7-dependent responses in CD28-deficient mice. Immunity 1:501.[Medline]
  2. Sperling, A. I., J. A. Auger, B. D. Ehst, I. C. Rulifson, C. B. Thompson, J. A. Bluestone. 1996. CD28/B7 interactions deliver a unique signal to naive T cells that regulates cell survival but not early proliferation. J. Immunol. 157:3909.[Abstract]
  3. Fukumoto, T., N. Torigoe, S. Kawabata, M. Murakami, T. Uede, T. Nishi, Y. Ito, K. Sugimura. 1998. Peptide mimics of the CTLA4-binding domain stimulate T-cell proliferation. Nat. Biotechnol. 16:267.[Medline]
  4. Krummel, M. F., J. P. Allison. 1995. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J. Exp. Med. 182:459.[Abstract/Free Full Text]
  5. Walunas, T. L., C. Y. Bakker, J. A. Bluestone. 1996. CTLA-4 ligation blocks CD28-dependent T cell activation. J. Exp. Med. 183:2541.[Abstract/Free Full Text]
  6. Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K. P. Lee, C. B. Thompson, H. Griesser, T. W. Mak. 1995. Lymphoproliferative disorders with early lethality in mice deficient in CTLA-4. Science 270:985.[Abstract/Free Full Text]
  7. Lindstein, T., C. H. June, J. A. Ledbetter, G. Stella, C. B. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339.[Abstract/Free Full Text]
  8. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindsten, C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-xL. Immunity 3:87.[Medline]
  9. Egen, J. G., J. P. Allison. 2002. Cytotoxic T lymphocyte antigen-4 accumulation in the immunological synapse is regulated by TCR signal strength. Immunity 16:23.[Medline]
  10. Brunner, M. C., C. A. Chambers, F. K. Chan, J. Hanke, A. Winoto, J. P. Allison. 1999. CTLA-4-mediated inhibition of early events of T cell proliferation. J. Immunol. 162:5813.[Abstract/Free Full Text]
  11. Freeman, G. J., A. S. Freedman, J. M. Segil, G. Lee, J. F. Whitman, L. M. Nadler. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J. Immunol. 143:2714.[Abstract]
  12. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, Jr, L. A. Lombard, G. S. Gray, L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter-receptor that costimulates human T cell proliferation. Science 262:909.[Abstract/Free Full Text]
  13. Ellis, J. H., M. N. Burden, D. V. Vinogradov, C. Linge, J. S. Crowe. 1996. Interactions of CD80 and CD86 with CD28 and CTLA4. J. Immunol. 156:2700.[Abstract]
  14. Fargeas, C. A., A. Truneh, M. Reddy, M. Hurle, R. Sweet, R. P. Sekaly. 1995. Identification of residues in the V domain of CD80 (B7-1) implicated in functional interactions with CD28 and CTLA4. J. Exp. Med. 182:667.[Abstract/Free Full Text]
  15. Guo, Y., Y. Wu, X. Kong, Y. Liu. 1998. Identification of conserved amino acids in murine B7-1 IgV domain critical for CTLA4/CD28:B7 interaction by site-directed mutagenesis: a novel structural model of the binding site. Mol. Immunol. 35:215.[Medline]
  16. Guo, Y., Y. Wu, M. Zhao, X. P. Kong, Y. Liu. 1995. Mutational analysis and an alternatively spliced product of B7 defines its CD28/CTLA4-binding site on immunoglobulin C-like domain. J. Exp. Med. 181:1345.[Abstract/Free Full Text]
  17. Peach, R. J., J. Bajorath, J. Naemura, G. Leytze, J. Greene, A. Aruffo, P. S. Linsley. 1995. Both extracellular immunoglobin-like domains of CD80 contain residues critical for binding T cell surface receptors CTLA-4 and CD28. J. Biol. Chem. 270:21181.[Abstract/Free Full Text]
  18. Rennert, P., K. Furlong, C. Jellis, E. Greenfield, G. J. Freeman, Y. Ueda, B. Levine, C. H. June, G. S. Gray. 1997. The IgV domain of human B7-2 (CD86) is sufficient to co-stimulate T lymphocytes and induce cytokine secretion. Int. Immunol. 9:805.[Abstract/Free Full Text]
  19. Inobe, M., N. Aoki, P. S. Linsley, J. A. Ledbetter, R. Abe, M. Murakami, T. Uede. 1996. The role of the B7-1a molecule, an alternatively spliced form of murine B7-1 (CD80), on T cell activation. J. Immunol. 157:582.[Abstract]
  20. Schwartz, J. C., X. Zhang, A. A. Fedorov, S. G. Nathenson, S. C. Almo. 2001. Structural basis for co-stimulation by the human CTLA-4/B7-2 complex. Nature 410:604.[Medline]
  21. Stamper, C. C., Y. Zhang, J. F. Tobin, D. V. Erbe, S. Ikemizu, S. J. Davis, M. L. Stahl, J. Seehra, W. S. Somers, L. Mosyak. 2001. Crystal structure of the B7-1/CTLA-4 complex that inhibits human immune responses. Nature 410:608.[Medline]
  22. Kim, J. J., M. L. Bagarazzi, N. Trivedi, Y. Hu, K. Kazahaya, D. M. Wilson, R. Ciccarelli, M. A. Chattergoon, K. Dang, S. Mahalingam, et al 1997. Engineering of in vivo immune responses to DNA immunization via codelivery of costimulatory molecule genes. Nat. Biotechnol. 15:641.[Medline]
  23. Agadjanyan, M. G., J. J. Kim, N. Trivedi, D. M. Wilson, B. Monzavi-Karbassi, L. D. Morrison, L. K. Nottingham, T. Dentchev, A. Tsai, K. Dang, et al 1999. CD86 (B7-2) can function to drive MHC-restricted antigen-specific CTL responses in vivo. J. Immunol. 162:3417.[Abstract/Free Full Text]
  24. Iwasaki, A., B. J. Stiernholm, A. K. Chan, N. L. Berinstein, B. H. Barber. 1997. Enhanced CTL responses mediated by plasmid DNA immunogens encoding costimulatory molecules and cytokines. J. Immunol. 158:4591.[Abstract]
  25. Tsuji, T., K. Hamajima, N. Ishii, I. Aoki, J. Fukushima, K. Q. Xin, S. Kawamoto, S. Sasaki, K. Matsunaga, Y. Ishigatsubo, et al 1997. Immunomodulatory effects of a plasmid expressing B7-2 on human immunodeficiency virus-1-specific cell-mediated immunity induced by a plasmid encoding the viral antigen. Eur. J. Immunol. 27:782.[Medline]
  26. Santra, S., D. H. Barouch, A. H. Sharpe, N. L. Letvin. 2000. B7 co-stimulatory requirements differ for induction of immune responses by DNA, protein and recombinant pox virus vaccination. Eur. J. Immunol. 30:2650.[Medline]
  27. Santra, S., D. H. Barouch, S. S. Jackson, M. J. Kuroda, J. E. Schmitz, M. A. Lifton, A. H. Sharpe, N. L. Letvin. 2000. Functional equivalency of B7-1 and B7-2 for costimulating plasmid DNA vaccine-elicited CTL responses. J. Immunol. 165:6791.[Abstract/Free Full Text]
  28. Wang, B., J. D. Boyer, K. E. Ugen, V. Srikantan, V. Ayyaroo, M. G. Agadjanyan, W. V. Williams, M. Newman, L. Coney, R. Carrano, et al 1995. Nucleic acid-based immunization against HIV-I: induction of protective in vivo immune responses. AIDS 9:S159.
  29. Takebe, Y., M. Seiki, J. Fujisawa, P. Hoy, K. Yokota, K. Arai, M. Yoshida, N. Arai. 1988. SR{alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8:466.[Abstract/Free Full Text]
  30. Kim, J. J., V. Ayyavoo, M. L. Bagarazzi, M. A. Chattergoon, K. Dang, B. Wang, J. D. Boyer, D. B. Weiner. 1997. In vivo engineering of a cellular immune response by coadministration of IL-12 expression vector with a DNA immunogen. J. Immunol. 158:816.[Abstract]
  31. Kim, J. J., N. N. Trivedi, L. K. Nottingham, L. Morrison, A. Tsai, Y. Hu, S. Mahalingam, K. Dang, L. Ahn, N. K. Doyle, et al 1998. Modulation of amplitude and direction of in vivo immune responses by co-administration of cytokine gene expression cassettes with DNA immunogens. Eur. J. Immunol. 28:1089.[Medline]
  32. Horspool, J. H., P. J. Perrin, J. B. Woodcock, J. H. Cox, C. L. King, C. H. June, D. M. Harlan, D. C. St Louis, K. P. Lee. 1998. Nucleic acid vaccine-induced immune responses require CD28 costimulation and are regulated by CTLA4. J. Immunol. 160:2706.[Abstract/Free Full Text]
  33. Borriello, F., M. P. Sethna, S. D. Boyd, A. N. Schweitzer, E. A. Tivol, D. Jacoby, T. B. Strom, E. M. Simpson, G. J. Freeman, A. H. Sharpe. 1997. B7-1 and B7-2 have overlapping, critical roles in immunoglobulin class switching and germinal center formation. Immunity 6:303.[Medline]
  34. Gajewski, T. F.. 1996. B7-1 but not B7-2 efficiently costimulates CD8+ T lymphocytes in the P815 tumor system in vitro. J. Immunol. 156:465.[Abstract]
  35. Harding, F. A., J. P. Allison. 1993. CD28–B7 interactions allow the induction of CD8+ cytotoxic T lymphocytes in the absence of exogenous help. J. Exp. Med. 177:1791.[Abstract/Free Full Text]
  36. Rudy, W., B. Guckel, M. Siebels, M. Lindauer, S. C. Meuer, U. Moebius. 1997. Differential function of CD80- and CD86-transfected human melanoma cells in the presence of IL-12 and IFN-{gamma}. Int. Immunol. 9:853.[Abstract/Free Full Text]
  37. Schwartz, R. H.. 1992. Costimulation of T lymphocytes: the role of CD28, CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy. Cell 71:1065.[Medline]
  38. Weissman, D., Y. Li, J. M. Orenstein, A. S. Fauci. 1995. Both a precursor and a mature population of dendritic cells can bind HIV: however, only the mature population that expresses CD80 can pass infection to unstimulated CD4+ T cells. J. Immunol. 155:4111.[Abstract]
  39. Levine, B. L., J. D. Mosca, J. L. Riley, R. G. Carroll, M. T. Vahey, L. L. Jagodzinski, K. F. Wagner, D. L. Mayers, D. S. Burke, O. S. Weislow, et al 1996. Antiviral effect and ex vivo CD4+ T cell proliferation in HIV-positive patients as a result of CD28 costimulation. Science 272:1939.[Abstract]
  40. Carroll, R. G., J. L. Riley, B. L. Levine, Y. Feng, S. Kaushal, D. W. Ritchey, W. Bernstein, O. S. Weislow, C. R. Brown, E. A. Berger, et al 1997. Differential regulation of HIV-1 fusion cofactor expression by CD28 costimulation of CD4+ T cells. Science 276:273.[Abstract/Free Full Text]
  41. Riley, J. L., R. G. Carroll, B. L. Levine, W. Bernstein, D. C. St Louis, O. S. Weislow, C. H. June. 1997. Intrinsic resistance to T cell infection with HIV type 1 induced by CD28 costimulation. J. Immunol. 158:5545.[Abstract]
  42. Riley, J. L., B. L. Levine, N. Craighead, T. Francomano, D. Kim, R. G. Carroll, C. H. June. 1998. Naive and memory CD4 T cells differ in their susceptibilities to human immunodeficiency virus type 1 infection following CD28 costimulation: implications for transmission and pathogenesis. J. Virol. 72:8273.[Abstract/Free Full Text]
  43. Riley, J. L., K. Schlienger, P. J. Blair, B. Carreno, N. Craighead, D. Kim, R. G. Carroll, C. H. June. 2000. Modulation of susceptibility to HIV-1 infection by the cytotoxic T lymphocyte antigen 4 costimulatory molecule. J. Exp. Med. 191:1987.[Abstract/Free Full Text]
  44. Inobe, M., P. S. Linsley, J. A. Ledbetter, Y. Nagai, M. Tamakoshi, T. Uede. 1994. Identification of an alternatively spliced form of the murine homologue of B7. Biochem. Biophys. Res. Commun. 200:443.[Medline]
  45. Lee, K. M., E. Chuang, M. Griffin, R. Khattri, D. K. Hong, W. Zhang, D. Straus, L. E. Samelson, C. B. Thompson, J. A. Bluestone. 1998. Molecular basis of T cell inactivation by CTLA-4. Science 282:2263.[Abstract/Free Full Text]
  46. Ikemizu, S., R. J. Gilbert, J. A. Fennelly, A. V. Collins, K. Harlos, E. Y. Jones, D. I. Stuart, S. J. Davis. 2000. Structure and dimerization of a soluble form of B7-1. Immunity 12:51.[Medline]
  47. Griffin, M. D., D. K. Hong, P. O. Holman, K. M. Lee, M. J. Whitters, S. M. O’Herrin, F. Fallarino, M. Collins, D. M. Segal, T. F. Gajewski, et al 2000. Blockade of T cell activation using a surface-linked single-chain antibody to CTLA-4 (CD152). J. Immunol. 164:4433.[Abstract/Free Full Text]
  48. Calvo, C. R., D. Amsen, A. M. Kruisbeek. 1997. Cytotoxic T lymphocyte antigen 4 (CTLA-4) interferes with extracellular signal-regulated kinase (ERK) and Jun NH2-terminal kinase (JNK) activation, but does not affect phosphorylation of T cell receptor {zeta} and ZAP70. J. Exp. Med. 186:1645.[Abstract/Free Full Text]
  49. Olsson, C., K. Riesbeck, M. Dohlsten, E. Michaelsson, K. Riebeck. 1999. CTLA-4 ligation suppresses CD28-induced NF-{kappa}B and AP-1 activity in mouse T cell blasts. J. Biol. Chem. 274:14400.[Abstract/Free Full Text]
  50. Thompson, J. D., D. G. Higgins, T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673.[Abstract/Free Full Text]
  51. Agadjanyan, M. G., N. N. Trivedi, S. Kudchodkar, M. Bennett, W. Levine, A. Lin, J. Boyer, D. Levy, K. E. Ugen, J. J. Kim, D. B. Weiner. 1997. An HIV type 2 DNA vaccine induces cross-reactive immune responses against HIV type 2 and SIV. AIDS Res. Hum. Retroviruses 13:1561.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
E. Bolesta, A. Kowalczyk, A. Wierzbicki, C. Eppolito, Y. Kaneko, M. Takiguchi, L. Stamatatos, P. A. Shrikant, and D. Kozbor
Increased Level and Longevity of Protective Immune Responses Induced by DNA Vaccine Expressing the HIV-1 Env Glycoprotein when Combined with IL-21 and IL-15 Gene Delivery
J. Immunol., July 1, 2006; 177(1): 177 - 191.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Agadjanyan, M. G.
Right arrow Articles by Weiner, D. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agadjanyan, M. G.
Right arrow Articles by Weiner, D. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS