|
|
||||||||
B Regulates BCL3 Transcription in T Lymphocytes Through an Intronic Enhancer 1


* Department of Internal Medicine, Section of Hematology/Oncology, and
Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, NE 68132
| Abstract |
|---|
|
|
|---|
81 bp is required for full enhancer activity. At the 5' end of this minimal sequence is a
B site, as confirmed by EMSAs. Mutation of this site in the context of the full-length HS3 abolished enhancer activity. Cotransfection with NF-
B p65 expression constructs dramatically increased luciferase activity, even without stimulation. Conversely, cotransfection with the NF-
B inhibitor I
B
reduced activation. Together, these results demonstrate a critical role for NF-
B in BCL3 transcriptional up-regulation by TCR-mimetic signals. | Introduction |
|---|
|
|
|---|
B family of proteins, whose primary role is to regulate the NF-
B family of transcription factors, which have important general roles in regulating genes involved in cell proliferation and apoptosis; however, their most striking roles are in inflammation and in innate and adaptive immune responses. This regulation occurs through transcriptional activation of a wide variety of genes that contain NF-
B recognition elements (
B sites). Disruption of the BCL3 locus in mice results in marked defects in immune function and in the microarchitecture of secondary lymphoid organs (3, 4). In BCL3-null mice, B cells largely fail to form a well-organized follicular organization in the lymph nodes and spleen, and fail to form germinal centers. Although capable of IgM responses, their ability to make isotype-switched responses to T-dependent Ags is markedly impaired. In addition, Th1 and CTL responses are highly defective in BCL3-null mice. At least some of the defects in lymphocyte responses are secondary to alterations in other cell types, including follicular dendritic cells (5).
A recent study catalogued the transcriptional response of T cells in vivo to superantigen stimulation in the presence or absence of adjuvants, providing activating or tolerogenic signals, respectively (6). Of the 23 genes that responded to both of the tested adjuvants, BCL3 showed the greatest differential expression, and forced expression of BCL3-increased T cell survival in vitro or in vivo after an in vivo stimulation without adjuvant. BCL3 is markedly up-regulated by superantigen stimulation (7), but its mRNA level then declines below basal levels in the absence of adjuvant, whereas it remains highly elevated when adjuvants are present. These results suggest that BCL3, transcriptionally up-regulated initially by TCR stimulation and later by adjuvant-derived stimuli, may be an important mediator of survival signals required for an effective immune response.
Dendritic cells (DCs) 3 have been known for some time as the most effective APCs for activation of naive T cells, but only in recent years has their equally important role in immune tolerance become recognized. DCs that are otherwise tolerogenic can be converted to fully activating DCs by adjuvants. Presumably, differences in signals from phenotypically different DCs are responsible for the differences in transcriptional regulation of T cells in the presence or absence of adjuvants, but the nature of the critical signals to T cells is poorly understood.
We have begun to dissect transcriptional regulation of BCL3 in T cells because its up-regulation is a marker and a mediator of adjuvant-induced survival signals in T cells (6). Using several complementary strategies, we have identified an intronic enhancer necessary for its up-regulation in response to stimuli that mimic TCR activation. We demonstrate that this enhancer contains an essential cis-regulatory element that is responsive to NF-
B.
| Materials and Methods |
|---|
|
|
|---|
The human T cell lymphoma cell line Jurkat (clone E6-1; American Type Culture Collection, Manassas, VA) was grown in RPMI 1640 medium (Cellgro, Herndon, VA) supplemented with 10% FCS (Invitrogen, Carlsbad, CA), 1 mM sodium pyruvate (Cellgro), 100 U/ml penicillin, 100 µl/ml streptomycin, and 25 mM HEPES, in an atmosphere of 5% CO2. For stimulation, the following concentrations were used, unless otherwise described: PHA (Sigma-Aldrich, Saint Louis, MO), 1 µg/ml; PMA, 50 ng/ml; ionomycin, 1 µg/ml. For inhibitors PD98059 (LC Laboratories, Woburn, MA), 50 nM; bisindolymaleimide I, V, and IX (LC Laboratories), each at 400 nM; cyclosporin A (CsA; Sigma-Aldrich), 100 ng/ml.
RNA isolation and Northern blotting
Total RNA was isolated from Jurkat cells using TRIzol (Life Technologies) and stored in formamide. A total of 10 µg of RNA was loaded per lane in an agarose/formaldehyde gel and electrophoresed 4 h at 5 V/cm. After blotting to Immobilon Ny+ membrane, hybridization with an [
-32P]dCTP-labeled 1.38-kb BCL3 cDNA probe (SacI fragment) was performed in 50% deionized formamide, 0.25 M sodium phosphate (pH 7.2), 0.25 M NaCl, and 7% SDS overnight at 42°C. Images were captured with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Real-time quantitative RT-PCR (qPCR)
The expression of BCL3 and IL-2 relative to a housekeeping gene, ACTB (
-actin), was measured using an ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Primers and probes for BCL3, IL-2, and ACTB were designed using Primer Express software (Applied Biosystems). BCL3 primers: GAAAACAACAGCCTTAGCATGGT and CTGCGGAGTACATTTGCG; probe, CACGGCGCCAACGTGAACGC. IL-2 primers: TCACCAGGATGCTCACATTTAAGT and CTGGGTCTTAAGTGAAAGTTTTTGC; probe, ACATGCCCAAGAAGGCCACAGAACTG. ACTB primers: TGCCGACAGGATGCAGAAG and GCCGATCCACACGGAGTACT; probe, ATCAAGATCATTGCTCCTCCTGAGCGC. Probes were labeled with FAM at the 5' ends as the reporter dye and TAMRA at the 3' ends as the quencher dye.
All RNA samples were treated with DNase I, and then 2 µg RNA was transcribed into cDNA using Superscript II reverse transcriptase (Invitrogen), following the manufacturers directions. A corresponding PCR on RNA from each sample (non-RT control) was performed to verify the absence of genomic DNA contamination.
Real-time PCR was conducted with the TaqMan Universal PCR Master Mix (Applied Biosystems) using 5 µl of cDNA with or without dilution in a 25 µl reaction mixture with a final concentration of 200 nM probe and 400 nM primers. After incubation at 50°C for 2 min, AmpliTaq Gold was activated by incubation at 95°C for 10 min. Forty PCR cycles were performed with denaturation at 95°C for 15 s, and combined annealing and extension at 60°C for 1 min. Serial dilutions of cDNA were used to construct standard curves for the target genes (BCL3 and IL-2) and the endogenous reference gene (ACTB). For each unknown sample, the relative amount of target cDNAs and reference cDNAs applied to the PCR system was calculated using linear regression analysis from the corresponding standard curves. Then the normalized expression level of the target gene in each sample was calculated by dividing the quantity of the target transcript with the quantity of corresponding reference transcript. The normalized values of the target transcript were used to compare its relative expression levels in different samples.
Plasmids
pGL3 Basic and Control, firefly (Photinus) luciferase reporter vectors are from Promega (Madison, WI), as are Renilla luciferase vectors pRL-SV40 and pRL-TK (thymidine kinase). IL-2pLuc
BK, a luciferase reporter construct under the control of the IL-2 enhancer/promoter, was a gift of E. Rothenberg (California Institute of Technology, Pasadena, CA). Making use of
bacteriophage clones of the human BCL3 locus, various portions of the BCL3 promoter region were cloned into the pGL3 Basic plasmid, either directly or indirectly. All promoter fragments described in this work extend to an NcoI site (ending at +212), which overlaps the translation initiation site. Pr11 extends from an EcoRI site (beginning at -1700); Pr21 from a BglII site (beginning at -813); and Pr31 from a BstEII site (beginning at -489). Pr41 extends from -194 and was prepared by PCR using the primer GGACGGTACCAGATCTCAGCAGGGGTGGGGACAC (BCL3-derived sequences in this and later oligonucleotides are underlined and shown 5' to 3'). TK luciferase constructs were prepared by cloning a 233-bp PvuII-HindIII promoter fragment from pRL-TK into pGL3 Basic.
Candidate enhancer regions were cloned indirectly into the SalI site of pGL3 derivatives. E3 + 4 (+4642 to +6259) is derived from an Acc65I-NcoI fragment; E3 (+4642 to +5034) from an Acc65I-SacII fragment; and E4 (+5666 to +6259) from an Ecl136II-NcoI fragment. E34 was derived from E3 + 4 by deletion of an internal SacII-Ecl136II fragment (+5037 to +5665).
Deletions were prepared from an E3 construct by PCR using oligonucleotides containing a SalI or XhoI site (underlined below). PCR products were digested with SalI and XhoI and cloned into the SalI site of P11. Forward oligonucleotides are labeled from a to e, and reverse oligonucleotides from 1 to 10. a, GGCGGTCGACGTCGACCTCGAGTACCTCTG; b, GGCGGTCGACTCTCCCCCAAGGCAAAC; c, GGCGGTCGACTTCTGCCTCAGCTGCCTG; d, GGCGGTCGACTGGGGGAAATCCCTTCCCG; e, GGCGGTCGACAAATCCCTTCCCGCAGAA; 1, GGCGCTCGAGCTCGAGGGTGTGAAGAGGAG; 2, GGCGCTCGAGAAGAGGAGCCGGTGG; 3, GGCGCTCGAGTCTCAGCCCCAGCG; 4, GGCGCTCGAGAAGGGGTTAAGGTTGGAG; 5, GGCGCTCGAGCGCCAGGAGGGGGGAG; 6, GGCGCTCGAGTGAGTGACGGGTGCTG; 7, GGCGCTCGAGACGGGTGCTGACGTGGG; 8, GGCGCTCGAGCTGACGTGGGGGAGGCA; 9, GGCGCTCGAGCTGGGTTGCGGTCAAG; 10, GGCGCTCGAGATTTCCCCCAGCAGGCAG.
Mutations were introduced into the plasmid P11E3 by using the QuikChange site-directed mutagenesis kit (Stratagene, Cedar Creek, TX), according to the manufacturers instructions. For ease of selection, in each case a novel restriction site was introduced. The following oligonucleotides and their complementary sequences were used (alterations are underlined): AP1, CAAGGCAAACACTTCGAACTCAGCTGCCTGCTG; AP4-1, CAAACACTTCTGCCTCAGAGTCCTGCTGGGGGAAATCCC; AP4-2, GAACTTGACCGCAACCCATAGGCTCTGCCTCCCCCACG;
B, CTCAGCTGCCTGCTGTTTTAAATCCCTTCCCGCAG; Ets, GCTGGGGGAAATCCCGGGCCGCAGAACTTGACC; cAMP response element-1 (CRE-1), CTGCTCTGCCTCCCCACATGTAGCACCCGTCACTCAC; CRE-2a, CTCCCCCACGTCAGCGAATTCCACTCACTCGCAGC; CRE-2b, ACGTCAGCACCCGTGCATGCATCGCAGCCTCCCC; Mut4, GGAAATCCCTTCCCGACTAGTGTGACCGCAACCCAG; Mut2, CTTCCCGCAGAACTTGCGGCCGCCCCAGCTGCTCTGC; Mut3, GCAACCCAGCTGCTCGCGGCCGCCCACGTCAGCACCC. The 2xCRE comprises the alterations found in both CRE-1 and CRE-2b. All mutations were confirmed by sequencing.
Transient transfection and luciferase analysis
Jurkat cells were transfected by using DMRIE-C reagent (Invitrogen). DNA (1 µg) and DMRIE-C (2 µl) were separately diluted in 100 µl each. The DNA and DMRIE-C samples were then combined in wells of a 24-well plate and incubated at room temperature for 40 min; to this was added 5 x 105 cells resuspended in 100 µl of complete medium without serum or antibiotics. After incubation at 37°C and 5% CO2 for 5 h, complete medium with serum and antibiotics was added to a final volume of 1 ml/well. After 37 h, transfected Jurkat cells were stimulated with PMA, PHA, ionomycin, PHA + PMA, or ionomycin + PMA for 6 h. Inhibitors, if used, were added 15 min before stimulation, unless otherwise noted. Cells were harvested 48 h after transfection and washed in cold PBS before lysis in 50 µl passive lysis buffer (Dual Luciferase Assay Kit; Promega). Luciferase activity was measured with a Luminoskan luminometer, according to the manufacturers protocol. All transfection experiments were performed in at least three different experiments, with similar results.
Analysis of DNase I hypersensitivity
HT2 cells or Jurkat cells, with or without stimulation with PHA + PMA, were washed in PBS, suspended in ice-cold buffer A (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40, 0.15 mM spermine, and 0.5 mM spermidine) containing 0.5% Nonidet P-40. After 10 min to allow lysis, the nuclei were pelleted, washed in buffer A, and then resuspended in buffer A + Ca (buffer A containing 1 mM CaCl2) at
8 x 106 cells/ml. Aliquots (0.5 ml) were added to 0.1 ml of buffer A + Ca containing 0, 1.2, 3.6, 12, 36, or 72 Kunitz units of DNase I (Promega) and incubated at 37°C for 5 min. After quenching with 12 µl of 0.5 M EDTA and 60 µl 20% SDS, samples were digested with proteinase K and RNase A. DNA was then extracted using phenol-chloroform and ethanol precipitation. A total of
8 µg DNA digested with either HindIII or EcoRV was used in each lane of a 0.8% agarose gel. Electrophoresis and Southern blotting were as previously described. Three HindIII fragments comprising the great majority of the mouse BCL3 locus were subcloned into Bluescript KSII+ (Stratagene) from BAC RPCI-23 33H23. Probes for Southern blotting were isolated from these plasmids: probe A, a 424-bp StuI-SphI fragment containing exon 2; probe B, an 881-bp Bsu36I fragment from within intron 2; and probe C, a 513-bp BstEII-XmnI fragment that includes exon 7. Human probes D and E for Southern blot hybridization are 846- and 518-bp EcoRV-PstI fragments in the vicinity of the BCL3 exon 1, isolated from plasmid p
1.4P (2).
Extraction of nuclear proteins and EMSA
Nuclear proteins were extracted from Jurkat cells, either with or without stimulation with PHA + PMA for 2.5 h, using NE-PER nuclear and cytoplasmic extraction reagents (Pierce, Rockford, IL), according to the manufacturers protocol. The concentration of nuclear proteins was determined according to the manual for the BCA Protein Assay Reagent (Pierce). The wild-type
B (wt-
B) oligonucleotide was designed to yield a 4-nt 5' overhang. After annealing of complementary strands, the resulting double-stranded oligonucleotide was labeled with [
-32P]dCTP by filling in using the Klenow fragment.
Oligonucleotides used as probes and competitors in these studies are: wt-
B, CTGCTGGGGGAAATCCCTT and CGGGAAGGGATTTCCCCCAGCAG; Mut1-
B, CTGCTGGGGGAAATAACTT and CGGGAAGTTATTTCCCCCAGCAG; Mut2-
B, CTGCTGTGTGAAATAACTTCCCG and CGGGAAGTTATTTCACACAGCAG; IGK-
B, GAGGGGACTTTCCGAG and CTCGGAAAGTCCCCTC; the altered nucleotides are underlined.
For EMSA of NF-
B, 15 µg of nuclear extract proteins was incubated in the following binding buffer: 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 5% glycerol, 1 mM DTT, 2 µg poly(dI-dC), 2 µg BSA, and 2 x 104 dpm double-stranded oligonucleotide probe for 20 min at room temperature. The reactions were loaded onto 4% nondenaturing polyacrylamide gel and were electrophoresed in 25 mM Tris-HCl, 90 mM glycine, and 1 mM EDTA for 3.54 h at 150 V at 4°C.
EMSA supershifts were conducted by incubating nuclear extract and oligonucleotides for 20 min at room temperature after the incubation of Ab with the nuclear extract on ice for 2 h. Control mouse IgG and Ab to NF-
B p50 subunit (nuclear localization sequence) were from Santa Cruz Biotechnology (Santa Cruz, CA).
| Results |
|---|
|
|
|---|
1, which hydrolyzes phosphatidylinositol 4,5-bisphosphate to yield two second messengers, diacylglycerol (DAG) and inositol trisphosphate; the latter induces release of intracellular calcium stores. The combination of a calcium ionophore, such as ionomycin, and PMA, a pharmacological analog of DAG, can effectively mimic TCR signaling, leading to proliferation and synthesis of cytokines, such as IL-2. In T cells, DAG activates not only isoforms of protein kinase C (PKC), but also RasGRP, a guanine nucleotide exchange factor for Ras proteins (8, 9). The most important PKC isoform in TCR signaling is PKC
(10), which activates several pathways, including one leading to NF-
B activation (11). We used Northern blot hybridization for initial characterization of the mRNA response (Fig. 1A) of BCL3. A transcript was not detected in the absence of stimulation, but was readily apparent after 2 h of stimulation. PMA alone also induced mRNA accumulation, whereas calcium ionophore did not. At the 2-h time point, neither CsA nor the mitogen-activated protein/extracellular signal-regulated kinase kinase (MEK) inhibitor PD98059 inhibited transcriptional up-regulation (but see Fig. 1C), whereas bisindolylmaleimide IX, a PKC inhibitor, reduced message level by 66%, based upon normalization with actin mRNA.
|
-actin RNA levels were used for normalization. At 2 h stimulation, BCL3 mRNA showed responses (data not shown) similar to those seen with Northern blot analysis. IL-2 mRNA at this time point was too low to facilitate comparisons. Upon stimulation with PHA + PMA, BCL3s mRNA increases with a much shorter lag than that seen with IL-2 (Fig. 1B); this is consistent with the fact that BCL3, but not IL-2, is an immediate early gene in response to mitogenic stimulation. BCL3 mRNA level peaks at 5 h with a 75-fold induction over basal levels. Despite a longer lag in induction, IL-2 message peaks at the same time point, but with a 2900-fold induction over baseline, reflecting a virtual absence without stimulation.
To facilitate comparison with IL-2, the 5-h time point was used for a more extensive qPCR analysis. Calcium ionophore is not required for BCL3 up-regulation, whereas it is required for IL-2 (Fig. 1C). In TCR stimulation, a particularly important role for calcium is in activation of calcineurin, a protein phosphatase responsible for activation and nuclear import of NF-AT, a family of transcription factors that regulates numerous genes important in T cell activation and differentiation. CsA can inhibit calcineurin in T cells. Consistent with the apparent lack of requirement for calcium in BCL3 activation, CsA failed to inhibit BCL3 transcription, but did almost entirely inhibit IL-2 transcription, as expected. In contrast, BCL3 transcription was inhibited by either PD98059, a MEK inhibitor, or bisindolylmaleimide I and bisindolylmaleimide IX, PKC inhibitors. For all of the inhibitors, the extent of inhibition was less than the inhibition of IL-2. Although other possibilities exist, this difference may simply be due to the lag in IL-2 transcriptional response. Intracellular levels of inhibitors may initially be low and insufficient to block early BCL3 transcription, but higher at later times when IL-2 transcription normally increases. This interpretation is consistent with apparent lack of effect of PD98059 at the 2-h time point by Northern blot and qPCR and the reduced effectiveness of the PKC inhibitor. These results suggest that both the PKC and the Ras-Raf-MEK-extracellular signal-regulated kinase pathways, activated by DAG, are essential for BCL3 activation.
Initial attempts to show appropriate transcriptional regulation of reporter constructs containing only the BCL3 promoter were unsuccessful. Consequently, to identify potential distal regulatory elements, we assessed evolutionary conservation within and surrounding the locus. As a complementary approach, we identified regions of open chromatin structure by their increased sensitivity to cleavage by DNase I.
Using the alignment program Vista (http://www-gsd.lbl.gov/vista) (12), we compared the sequences within and flanking the human, mouse, and rat BCL3 loci. Fig. 2 illustrates sequence comparison of 30 kb encompassing the mouse locus to human and rat sequences. The graph shows sequences having greater than 50% conservation with human sequences. Regions of at least 75% identity over 100 bp are shaded. Due to the more recent separation of mouse and rat in evolution, their two loci are much more similar to each other than to the human sequences; thus, 90 and 95% are used as cutoffs for graphing and shading, respectively. In the mouse to human comparison, all of the exons are conserved, as expected, although the small exon 3 failed to meet the shading criterion. Strikingly, however, several regions 5' of the gene and two regions within the second intron are also highly conserved. The regions highly conserved between mouse and rat are remarkably similar to those conserved between mouse and human; however, several upstream and intronic regions are more highly conserved than many of the exons. The 5' untranslated region is more conserved than the coding regions within exon 1, perhaps relating to its dual role in promoter activity and in translational regulation.
|
-1.5 kb; HS2, corresponding to the promoter; HS3, at
+5 kb; and HS4, at
+6 kb. In a previous analysis in a human B cell line (H. Ohno and T. McKeithan, unpublished), four homologous HSs were similarly identified. Notably, each of the four HSs corresponded to regions highly conserved among the three species analyzed above. No evidence for HSs corresponding to more 5' conserved regions was seen under these conditions.
|
5 kb downstream from the beginning of exon 1. Thus, HS3, but not HS4, is present in Jurkat cells. A poorly defined smear corresponded to HS2, which includes the 5' end of exon 1 and sequences immediately upstream of it. Only in stimulated Jurkat cells was HS1 identified. As in the mouse, the predicted positions of the HSs corresponded to highly conserved regions. Initial characterization of luciferase reporter constructs
Luciferase reporter gene constructs that contain these four HSs were prepared and analyzed in the Jurkat T cell line. For most experiments, a promoter construct (P11) was used that extends from -1700 to +212 (the translation start site), including HS1 and HS2 and the entire 5' untranslated region (UTR), placed immediately upstream of luciferase coding sequences. A 1.6-kb fragment containing HS3 and HS4 was inserted at a distal site to generate P11E3 + 4.
Translation of BCL3 mRNA is regulated through a pathway dependent upon phosphatidylinositol 3-kinase and mammalian target of rapamycin (13, 14). The 5' UTR of BCL3 is highly GC rich (91%) and may form stable secondary structures that impede ribosomal scanning for the initiation codon. Thus, a potential concern in this analysis is the presence in the constructs of the BCL3 5' UTR upstream of luciferase, which may therefore impede mRNA translation. The Jurkat cell line, however, lacks functional PTEN (15, 16), a phosphoinositide 3-phosphatase, and thus the phosphatidylinositol 3-kinase pathway is constitutively active. As a result, the BCL3 5' UTR should not be expected to interfere with translation in this cell line.
Little or no stimulation of luciferase activity by PHA, PMA, or both together was found upon using the P11 construct. In contrast, these treatments led to up to 11-fold stimulation with P11E3 + 4. This argues strongly that the HS3 and HS4 region contains a distal, downstream enhancer. PMA was consistently more effective that PHA, in marked contrast to the IL-2 response, in which PMA alone showed little stimulation (Fig. 4A).
|
CsA, which blocks calcium-dependent calcineurin signaling, was used to further assess whether a calcium signal is required for BCL3 activation. Whereas it inhibited IL-2 reporter activity, it did not block luciferase activity from the BCL3 reporter P11E3 + 4 (Fig. 4C), corresponding to what was found with the endogenous gene.
Additional constructs were prepared to assess the relative importance of the HS3 and HS4 regions, in the context of both P11 and TK promoters. Equivalent results were found with the two promoters, but only the latter is shown in Fig. 4D. Luciferase activity of a construct containing HS4 (TKE4) was not consistently different from the TK promoter alone, whereas constructs containing HS3 (TKE3) or HS3 and HS4 without the sequences between them (TKE34) were similar to TKE3 + 4 (Fig. 4A). These results demonstrated that HS3 is responsible for enhancer activity in Jurkat cells in response to PHA + PMA. The absence of an effect from HS4 is consistent with the absence of an HS at this site in Jurkat cells.
Given the apparent dominant role of the enhancer in transcriptional activation, only limited analysis of the promoter was performed in this study. The DNase hypersensitivity at HS1 in stimulated Jurkat cells suggested that this region might be involved in activation. Thus, we compared a small series of constructs with 5' deletions of the promoter region, all extending to the translation initiation codon. P41E3 + 4, the shortest construct (-195/+212), is truncated at the immediate 5' end of the CpG island that overlaps the promoter and first exon. All showed full activity despite the fact that only the longest, P11E3 + 4, contains the HS1 region (Fig. 4E). These results imply that HS1 is not required for transcriptional up-regulation of BCL3 under these conditions.
Enhancer analysis
Using a web-based program (17, 18) to identify potential transcription factor binding sites (MatInspector; http://genomatix.de), a number of candidate sites in the HS3 region were found that are conserved between mouse and human (Fig. 5, lower panel). These include possible sites for AP1, NF-
B, Ets, CREB/ATF, and STATs, as well as two potential sites for AP4. In the human, but not the mouse, a second slightly more divergent potential CREB/ATF site (CRE) is found immediately 3' of the first site.
|
B site, did not decrease enhancer activity; rather, they increased it, suggesting that a negative regulatory element may be present. Deletions that extend into the
B greatly reduce enhancer activity. Deletions from the 3' end do not decrease activity unless they impinge upon the two potential CRE sites. A region as small as 81 bp suffices for full enhancer activity.
Site-directed mutagenesis (Fig. 5B) within the full-length HS3 provides results consistent with these deletions. Corresponding mutations were also made in the minimal 81-bp region (results not shown). No obvious effects are seen for two mutations at sites outside the minimal region, whereas a mutation within the
B site virtually eliminates enhancer activity (Fig. 5B). Notably, the effect on activity is actually greater than the deletion extending partially into the site, which, however, may not entirely abolish binding by NF-
B (see below, Fig. 6). Mutation of the 5', evolutionarily conserved putative CRE site caused a smaller, but still marked reduction in enhancer activity, which was further increased by additional mutation of the second putative CRE site. Equal or greater effects of these mutations were seen in the context of the minimal promoter (results not shown). Mutations in a number of other locations yielded small decreases in enhancer activity, but with variability among experiments.
|
B site (GGGAAATCCC) within the enhancer is an exact match for the
B consensus (GGGRNNYYCC, in which R = A, G, and Y = C, T), and is predicted to be a high affinity site (19) that binds NF-
B p50 homodimers or p50-p65 heterodimers with higher affinity than the prototypical IGK
B site. We performed EMSAs using oligonucleotides from this site to determine whether it can in fact bind NF-
B. Shifted complexes are seen using nuclear extracts from stimulated and, to a much lesser extent, from unstimulated cells. The complexes can be effectively competed with the identical (wt) oligonucleotide at 100-fold excess or with the prototypical
B site from the intronic enhancer of the Ig L chain
locus. In contrast, much less competition was provided by a mutant oligonucleotide (mut1) corresponding to the introduced site-directed mutation. The residual competition implies that the mutant oligonucleotides retain a weak affinity for NF-
B. It is notable that 5' deletion e (see E3e2, Fig. 5) leads to a residual site changed to a similar extent as in mut1. This may be responsible for the small remaining enhancer activity seen with this deletion. A second oligonucleotide (mut2) with additional alterations within the site showed almost no competition. In T cells, as in most other cell types, homo- and heterodimers that include the p50 subunit are typically the most abundant forms of NF-
B. Thus, we also performed EMSA in the presence of an Ab to p50. As expected, this led to supershifted complexes, which were not seen with control Ab.
We sought to determine whether luciferase expression driven by the BCL3 enhancer is affected by cotransfection of constructs that either enhance or inhibit NF-
B activity. We cotransfected the P11E3 + 4 reporter with an expression construct (20) for a form of I
B
with mutations in the two N-terminal serine residues whose phosphorylation is required for stimulation-induced degradation. Cotransfection with this superrepressor (SR) led to a dose-dependent decrease in both basal and stimulated levels of luciferase activity (Fig. 7A). Conversely, cotransfection with increasing quantities of expression constructs for the p50 and the p65 (RelA) subunits of NF-
B led to a dose-dependent increase in both basal and stimulated levels of luciferase (Fig. 7B). Unexpectedly, an increase in basal activity was also seen with the constructs containing the BCL3 promoter alone or with an enhancer mutated in its
B site; these values were not consistently further increased by stimulation with PHA + PMA. These results are discussed further below.
|
| Discussion |
|---|
|
|
|---|
Analysis of deletions narrowed the core enhancer activity to
81 bp, extending from a 5'
B site to two putative 3' CRE sites. Mutation of individual sites within HS3 identified one of these putative CRE sites, which is evolutionarily conserved, as important in enhancer activity. The most dramatic of the site-directed mutations was elimination of the
B site, which virtually abolished enhancer activity. Cotransfection of the reporter construct containing the enhancer with an I
B
-SR expression construct led to a marked, dose-dependent decrease in transcription, whereas cotransfection with expression constructs for the p50 and p65 subunits of NF-
B considerably increased expression. These results are consistent with an essential role for the
B site in enhancer function. Surprisingly, cotransfection with expression constructs for the p50 and p65 subunits of NF-
B also increased expression of a BCL3 promoter construct either lacking an enhancer or containing the HS3 enhancer mutated at the
B site. These results suggest that the promoter itself, which contains two evolutionarily conserved putative
B sites, can respond to NF-
B, at least under experimental conditions. Up-regulation of BCL3 in hepatocytes in response to TNF-
has been ascribed to one of these sites (21); however, it should be noted that the study did not assess the potential contribution by distal enhancers.
Among its other effects, TCR activation, through a very complex series of steps, leads to membrane recruitment and activation of phospholipase C
1, which hydrolyzes phosphatidylinositol 4,5-bisphosphate to yield two second messengers, DAG and inositol trisphosphate. The latter induces release of cytoplasmic calcium stores, whereas DAG activates at least two pathways. DAG binding to RasGRP leads to activation of Ras and its downstream signaling cascade, whereas its binding to PKC activates several other pathways, including one leading to NF-
B activation. In T cells, the most important PKC isoform in TCR signaling is the calcium-independent novel isoform PKC
(10). Treatment with ionomycin, a calcium ionophore, and with PMA, a DAG analog, can mimic many aspects of TCR signaling, including stimulation of IL-2 synthesis, which requires both second messengers.
It is intriguing that, in contrast to IL-2 and several other genes, a calcium signal is not required for transcriptional activation of BCL3, which promotes active immunity. Conditions inducing a more prominent calcium signal than DAG-dependent signals tend to promote T cell anergy (22). PKC
is required for NF-
B activation by the TCR (11). The current results imply that NF-
B binding to the HS3 enhancer element partially mediates the TCR stimulation of BCL3 transcription. TCR activation is also known to result in phosphorylation of members of the CREB/ATF family through successive activation of RasGRP, Ras, Raf, MEK, extracellular signal-regulated kinase 1 or 2, and Rsk2 (23, 24). The presence of two potential CRE sites at the 3' end of the minimal enhancer raises the possibility that phosphorylation of CREB/ATF transcription factors bound to these sites may play an important role in enhancer function. Notably, some members of this family of transcription factors can bind to NF-
B proteins (25), and NF-
B p65 and phosphorylated CREB/ATF can interact with the important, closely related coactivators p300 and CBP through independent sites (26). Further analysis will be required to determine whether synergistic recruitment of coactivators by these transcription factors plays an essential role in the function of the BCL3 HS3 enhancer, and to determine the mechanism by which the intronic enhancer activates the promoter. Additional experiments in cell lines and in normal T cells will also be required to confirm the roles of the cis elements that we have identified in BCL3 regulation after physiological activation of the TCR and costimulatory molecules.
In other cell types, a variety of stimuli that function, at least in part, through NF-
B also increases transcription of BCL3. Thus, LPS up-regulates it in B cells (27), TNF-
in hepatocytes (21), and IL-1 in chondrocytes and synovial cells (28). Further evidence will be required to determine whether these stimuli act through the
B site in HS3. In fact, as noted above, there is evidence that TNF-
up-regulates BCL3 in hepatocytes through a conserved, atypical
B site present in the promoter.
Another member of the I
B family, I
B
, is also positively regulated by NF-
B, in this case through
B sites in the promoter (29). Its activation is part of a negative autoregulatory loop, whereby NF-
B activation leads to increased synthesis of an NF-
B inhibitor. Such autoinhibitory loops are common, especially in the case of transcription factors that are tightly regulated (30). NFKB1, NFKB2, and RELB, which encode three of the five NF-
B subunits, are also regulated in part through NF-
B itself (31, 32, 33, 34). Because the p105 and p100 proteins synthesized from the NFKB1 and NFKB2 genes can heterodimerize with other NF-
B subunits and sequester them in the cytoplasm, their transcriptional regulation by NF-
B can also be considered a negative autoregulatory circuit. In contrast, the RELB NF-
B subunit is a transcriptional activator of a subset of
B-regulated genes that, when in a heterodimer with NFKB2 p52, is resistant to inhibition by I
B
(35). Thus, transient activation of the classic NF-
B p50-p65 heterodimer can lead to sustained NF-
B activity through induction of the RELB subunit. NF-
B-induced synthesis of BCL3 protein, which has an antiapoptotic role, as does classic NF-
B, shows similarities to induction of RELB, and in fact the two genes are induced in many of the same contexts.
Work in the Marrack laboratory has identified BCL3 as the best known marker, at the mRNA level, for the adjuvant-dependent survival signal to T cells (6). Thus, understanding its transcriptional regulation in T cells can potentially aid in dissecting these signals, which to date poorly are understood. BCL3 is markedly up-regulated by superantigen stimulation (7), but its mRNA level then declines below basal levels in the absence of adjuvant, whereas it remains highly elevated when adjuvants are present. The work presented in this study analyzes the first, Ag-dependent phase of this biphasic response. Considerable evidence supports the notion that T cell proliferation, survival, and differentiation are actually programmed at the time of initial Ag engagement both in vitro and in vivo. It remains to be determined whether the later phase of BCL3 expression is dependent upon a previous Ag-dependent activation, whether autocrine or paracrine signals are required for the later phase, and whether it also is dependent upon the HS3 enhancer.
| Acknowledgments |
|---|
B
-SR, IL-2pLuc
BK, and MT2T-p50 and -p65 expression constructs, respectively. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Timothy McKeithan, Department of Internal Medicine, University of Nebraska Medical Center, 986495 Nebraska Medical Center, Omaha, NE 68132. E-mail address: tmckeith{at}unmc.edu ![]()
3 Abbreviations used in this paper: DC, dendritic cell; ATF, activating transcription factor; CRE, cAMP response element; CsA, cyclosporin A; DAG, diacylglycerol; HS, DNase hypersensitive site; MEK, mitogen-activated protein/extracellular signal-regulated kinase kinase; PKC, protein kinase C; qPCR, quantitative real-time PCR; SR, superrepressor; TK, thymidine kinase; UTR, untranslated region; wt, wild type. ![]()
Received for publication June 17, 2003. Accepted for publication August 7, 2003.
| References |
|---|
|
|
|---|
B required for proper secondary lymphoid organ microarchitecture: functions enhanced by Bcl-3. J. Immunol. 163:6581.
in T cell activation. Annu. Rev. Immunol. 20:761.[Medline]
is required for TCR-induced NF-
B activation in mature but not immature T lymphocytes. Nature 404:402.[Medline]
B DNA-protein interactions. Proc. Natl. Acad. Sci. USA 99:8167.
B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.
B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-
B1 residence. J. Biol. Chem. 276:32080.
B sites in the I
B
promoter are required for induction of gene expression by TNF
. Nucleic Acids Res. 22:3787.
B. Oncogene 20:7722.[Medline]
B p50/p105 gene: regulation by NF-
B subunits and by c-REL. J. Immunol. 150:2794.[Abstract]
B indicates that it participates in its own regulation. EMBO J. 11:195.[Medline]
B2: evidence for
B-mediated positive and negative autoregulation. Mol. Cell. Biol. 14:7695.
B complexes with I
B
determine pools of constitutive and inducible NF-
B activity. EMBO J. 13:4608.[Medline]
Related articles in The JI:
This article has been cited by other articles:
![]() |
J. Yang, R. S. Williams, and D. P. Kelly Bcl3 Interacts Cooperatively with Peroxisome Proliferator-Activated Receptor Gamma (PPAR{gamma}) Coactivator 1{alpha} To Coactivate Nuclear Receptors Estrogen-Related Receptor {alpha} and PPAR{alpha} Mol. Cell. Biol., August 1, 2009; 29(15): 4091 - 4102. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xue, P. B. Thippegowda, G. Hu, K. Bachmaier, J. W. Christman, A. B. Malik, and C. Tiruppathi NF-{kappa}B regulates thrombin-induced ICAM-1 gene expression in cooperation with NFAT by binding to the intronic NF-{kappa}B site in the ICAM-1 gene Physiol Genomics, June 1, 2009; 38(1): 42 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Kim, N. Sharma, and J. K. Nyborg The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter J. Virol., December 1, 2008; 82(23): 11939 - 11947. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, L. Ye, G. J. Christianson, J.-Q. Yang, D. C. Roopenian, and X. Zhu NF-{kappa}B Signaling Regulates Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG via Intronic Binding Sequences J. Immunol., September 1, 2007; 179(5): 2999 - 3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Yeh, S.-H. Kuo, K.-H. Yeh, S.-E. Chuang, C.-H. Hsu, W. C. Chang, H.-I Lin, M. Gao, and A.-L. Cheng A Pathway for Tumor Necrosis Factor-{alpha}-induced Bcl10 Nuclear Translocation: Bcl10 IS UP-REGULATED BY NF-{kappa}B AND PHOSPHORYLATED BY Akt1 AND THEN COMPLEXES WITH Bcl3 TO ENTER THE NUCLEUS J. Biol. Chem., January 6, 2006; 281(1): 167 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Puppo, M. Musso, D. Pirulli, P. Griseri, T. Bachetti, S. Crovella, G. Patrone, I. Ceccherini, and R. Ravazzolo Comparative genomic sequence analysis coupled to chromatin immunoprecipitation: a screening procedure applied to search for regulatory elements at the RET locus Physiol Genomics, November 17, 2005; 23(3): 269 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sironi, G. Menozzi, G. P. Comi, R. Cagliani, N. Bresolin, and U. Pozzoli Analysis of intronic conserved elements indicates that functional complexity might represent a major source of negative selection on non-coding sequences Hum. Mol. Genet., September 1, 2005; 14(17): 2533 - 2546. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |